ID: 917327864

View in Genome Browser
Species Human (GRCh38)
Location 1:173851587-173851609
Sequence TGGCTGAGTCATGATTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917327858_917327864 27 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327864 1:173851587-173851609 TGGCTGAGTCATGATTCTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 135
917327859_917327864 26 Left 917327859 1:173851538-173851560 CCTTTTTCCTCAAGAACAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 251
Right 917327864 1:173851587-173851609 TGGCTGAGTCATGATTCTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 135
917327861_917327864 19 Left 917327861 1:173851545-173851567 CCTCAAGAACAGCAGCTGTAGGT 0: 1
1: 0
2: 2
3: 13
4: 133
Right 917327864 1:173851587-173851609 TGGCTGAGTCATGATTCTTCAGG 0: 1
1: 0
2: 2
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917327864 Original CRISPR TGGCTGAGTCATGATTCTTC AGG Intronic
902137287 1:14320303-14320325 TGTCTGAGTCCTAATTCTTGAGG + Intergenic
902850586 1:19152903-19152925 TGACTGACTCAGGACTCTTCAGG - Intronic
904909203 1:33921530-33921552 TGGCTGAGTCTTGACTGTACTGG + Intronic
905551947 1:38848965-38848987 TGGCTGAGTTTTGATTTTTGTGG - Intronic
910496078 1:87829526-87829548 TAGTTGAGTAATTATTCTTCAGG - Intergenic
910697044 1:90030530-90030552 TGGCTGATTCTTCATCCTTCAGG + Intronic
911186769 1:94912292-94912314 TTTCTGAGTCTAGATTCTTCTGG - Intronic
912750006 1:112279582-112279604 TGGATGAGACCTGATACTTCAGG + Intergenic
914445844 1:147750160-147750182 TGGCTCAGTCTGGATTCTCCAGG + Intergenic
915546515 1:156601826-156601848 TAGCTGTGTCCTGATTTTTCAGG + Intergenic
916238498 1:162614543-162614565 TTGCTGAATCATGTTTATTCAGG + Intergenic
916817478 1:168367760-168367782 TGGCTGATTCTTGATTCCACAGG + Intergenic
917327864 1:173851587-173851609 TGGCTGAGTCATGATTCTTCAGG + Intronic
920422116 1:205842049-205842071 TGGCTGAGGGATGATTAGTCAGG + Intronic
920742220 1:208591794-208591816 GGGCTGAGTCATGAGTCTACTGG - Intergenic
924095717 1:240548928-240548950 TTGTTCAGTCATTATTCTTCTGG - Intronic
924603039 1:245508061-245508083 TTTCTGAGCCATGATTCCTCAGG + Intronic
1065272993 10:24055473-24055495 TGGCTGAGTCTTTCTTCTTCAGG - Intronic
1066386304 10:34944261-34944283 TGGCTTATTCATGAGTTTTCTGG - Intergenic
1073588219 10:104731385-104731407 TTACTGAGTCATGTTCCTTCTGG + Intronic
1074035090 10:109730797-109730819 GAGCTTAGTCATTATTCTTCAGG - Intergenic
1076027480 10:127128010-127128032 CTGCTGAGTCGTCATTCTTCTGG + Intronic
1079108726 11:17591379-17591401 TGGCTCTGTCATGAGTATTCAGG + Intronic
1086522279 11:87683095-87683117 TGGCTGAGTCAGGACTCTAAAGG - Intergenic
1086866977 11:91991410-91991432 TAACTGAGTCATGCTTCTACAGG - Intergenic
1087345474 11:96965679-96965701 TAGTTGGCTCATGATTCTTCAGG + Intergenic
1095894486 12:47266814-47266836 TAGCTGAGACTTGATGCTTCTGG + Intergenic
1095951083 12:47782366-47782388 TGTCTGAGTCACAACTCTTCGGG + Exonic
1098597392 12:72290666-72290688 TGGTTGTGTCATCAGTCTTCTGG + Intronic
1099162064 12:79254273-79254295 TAGCTGTGTCATCATTCTTAAGG - Intronic
1101686994 12:107034347-107034369 TGGCTTATTCATGAGTTTTCCGG - Intronic
1101860939 12:108481943-108481965 TGGCTAAGACATGAGTCTTTGGG + Intergenic
1103311138 12:120009319-120009341 TGCCTGATTCAAGAGTCTTCAGG + Intronic
1106206400 13:27600058-27600080 TGAATGAGTCATGAATTTTCTGG - Intronic
1107720284 13:43241321-43241343 TGGTAGACTCATCATTCTTCTGG - Intronic
1108503844 13:51091686-51091708 TGGCTGAATCATCACTCTACAGG + Intergenic
1108942637 13:55977058-55977080 TGGCTGAGTCAAGGTTTTTATGG - Intergenic
1110357295 13:74582101-74582123 TGTCTGTGTCATCATCCTTCAGG - Intergenic
1112792900 13:103022794-103022816 TGCCTGAGTCTATATTCTTCAGG + Intergenic
1114763793 14:25347990-25348012 TGGCAGGGTCATGTTTCTTCTGG + Intergenic
1115312843 14:31996490-31996512 TGTTTTAGTCATGATTCGTCTGG - Intergenic
1115326187 14:32142133-32142155 TCGTTGAGTCATCATTCTCCTGG + Intronic
1116934074 14:50719514-50719536 AGGTTAAGTCATGATTCTGCAGG + Intergenic
1118978269 14:70695797-70695819 TTACTGAGTCTTGATTCTTTTGG + Intergenic
1119505773 14:75171685-75171707 TGGCAGAGCCATGTTTCTTCTGG - Intronic
1120250761 14:82059849-82059871 TGGCTGAAACATGAATCTTGGGG - Intergenic
1120631248 14:86893533-86893555 TAACGGAGTCATGATTTTTCAGG + Intergenic
1122595273 14:102886029-102886051 TGGCTGAGTCATTATTGTCACGG - Intronic
1124218184 15:27826612-27826634 TGGCTGGATCCAGATTCTTCAGG + Intronic
1124812135 15:32951802-32951824 TGGCTGAGTCATCATTCATGGGG - Intronic
1125258128 15:37790502-37790524 TGGCAGAGTCGTGATTCCGCTGG - Intergenic
1131452213 15:92552121-92552143 TGGCAGAGTCAAGGTTCTCCTGG + Intergenic
1131692443 15:94841772-94841794 TGGGTTTGTCCTGATTCTTCAGG + Intergenic
1133506685 16:6419084-6419106 TGACTCAGTCATTATTCTACAGG + Intronic
1137802713 16:51275797-51275819 TGGCTGATCCATGCCTCTTCTGG - Intergenic
1143615385 17:8046396-8046418 TGGCTGAGCCCTGTGTCTTCCGG - Intronic
1146205711 17:30903961-30903983 TGGCTAAGACAGGGTTCTTCAGG - Intronic
1150205897 17:63407065-63407087 TGGCCTAGGCATAATTCTTCAGG - Intronic
1152944551 17:83191905-83191927 TGGCTGAGTGAAGTTTGTTCAGG + Intergenic
1155553998 18:26997802-26997824 AGGCTGAACCATGATTTTTCGGG + Intronic
1157021000 18:43782193-43782215 TAGCTGTGACATGATTCCTCAGG - Intergenic
1157647062 18:49285304-49285326 GGGCTGTGCCATGATTCTTCCGG - Intronic
1159497348 18:69223173-69223195 TGGCTGACACCTGATTCTTCTGG + Intergenic
1159837416 18:73355354-73355376 GGAATGAGTCATGATTTTTCTGG + Intergenic
1168521839 19:57057368-57057390 TGTCTGCATCATGATTCTCCAGG - Intergenic
927347106 2:22057876-22057898 TGGATTATTCATGATTTTTCTGG + Intergenic
929123669 2:38503695-38503717 TGGCTAAGTCCTGTTCCTTCAGG + Intergenic
931832341 2:66065798-66065820 TGGCTGACTCATGGTCCTCCTGG + Intergenic
932066238 2:68564702-68564724 TGGCTGAGTCAGGATTCCAATGG + Intronic
935585795 2:104798977-104798999 TGGGGGAGGCATCATTCTTCTGG + Intergenic
935970961 2:108530492-108530514 TGGCAGAGCCTTGACTCTTCTGG + Intergenic
936626373 2:114153675-114153697 TGGTTTAGTCATCATTCTGCTGG + Intergenic
937677228 2:124605234-124605256 TGACTAAGCCATGATTCTGCAGG - Intronic
939500711 2:142980037-142980059 TGGATTATTCATGATTTTTCTGG + Intronic
939598524 2:144158859-144158881 TGACTGAATTAGGATTCTTCTGG + Intronic
941178235 2:162226905-162226927 TAGCTGGGGCATGATTCTTCAGG + Intronic
942541740 2:177022249-177022271 TTGCTGAGTCCTCATTCCTCGGG + Intergenic
944736849 2:202574798-202574820 TAGCAGAGTCATGCTTATTCAGG - Intergenic
944804360 2:203266663-203266685 TTACTGTGCCATGATTCTTCTGG - Exonic
946352423 2:219164004-219164026 AGGCTGATTTCTGATTCTTCAGG + Intronic
947304741 2:228731773-228731795 TGGTTGAGTCATGTAACTTCTGG + Intergenic
1169442862 20:5647511-5647533 TAGCCCAGTCATGATTCTTATGG - Intergenic
1170926298 20:20727436-20727458 TGGCTTTGCCATGATGCTTCTGG + Intergenic
1172740547 20:37163126-37163148 TGGATTAGTTAGGATTCTTCAGG - Intronic
1173207583 20:41007015-41007037 TGGCTGAGTCCAGGTTCTTATGG + Intergenic
1173459330 20:43230291-43230313 TGGCTGAGTCTGGATCCTTGAGG - Intergenic
1174321133 20:49742408-49742430 GGTCTGATTCAGGATTCTTCTGG + Intergenic
1174433647 20:50489823-50489845 TGGCTGGCTCATGGTTCTGCAGG - Intergenic
1177211218 21:18074060-18074082 TGGCTGAGACATGAATCTAATGG + Intronic
1177620947 21:23592424-23592446 TGATTGACTCATGATTCTGCAGG + Intergenic
1178330626 21:31687708-31687730 TTTCTGAGTCTTCATTCTTCAGG - Intronic
1178565828 21:33683519-33683541 TGGCTGAGTCTTGAGTCATCTGG + Intronic
952273899 3:31858758-31858780 TGGCTGAGTCTGGATTATACTGG + Intronic
952966699 3:38625498-38625520 TGCATGAGTCATGCTGCTTCTGG + Intronic
954995998 3:54882222-54882244 TGGCTTAGACATGAATTTTCTGG - Intronic
956678865 3:71759469-71759491 TGGCTCAGTCATGCCTCCTCTGG + Intergenic
957219444 3:77363166-77363188 TTGCTGAGTCATGCTTGATCTGG - Intronic
958573978 3:95923662-95923684 TGGATTACTCATGAGTCTTCTGG + Intergenic
960869708 3:122236351-122236373 ATGCTGGTTCATGATTCTTCCGG + Intronic
961063688 3:123855742-123855764 TGGCAAAGTGATGATGCTTCTGG - Intronic
961508926 3:127389578-127389600 TGGATGAGTCACCATTCTTGTGG - Intergenic
961569609 3:127788403-127788425 TGGCTGAGTTAAAATTCTGCTGG - Intronic
962404200 3:135086214-135086236 TGGCTGATTCTGGATTCTTAAGG - Intronic
965845984 3:172961954-172961976 TGGCTGAGTCCTCTTTCTTAAGG - Intronic
966644288 3:182226065-182226087 TGGCAGAGCCATGTTCCTTCTGG + Intergenic
966830962 3:184008352-184008374 TGCCTGAGGCATGATTATTCAGG - Intronic
972919527 4:43921033-43921055 TGACTGCTTTATGATTCTTCAGG - Intergenic
976466266 4:85372268-85372290 TGGCTGAGACATGCTAGTTCTGG + Intergenic
978371289 4:108031691-108031713 TGTGTGAGTCATGAATCTTCAGG + Intronic
979781880 4:124662005-124662027 TGGCTGATTCATTAGTCATCTGG + Intergenic
979956169 4:126956037-126956059 TGGCTGAGTCAGGGTTTTTAAGG - Intergenic
981833048 4:149023900-149023922 TGGCAGAAGCATTATTCTTCTGG - Intergenic
982823445 4:159973303-159973325 TAGCTGGCTCATGATTCTGCAGG + Intergenic
983783716 4:171705577-171705599 TGGCAGAGTCCTGACTCTCCAGG - Intergenic
984030085 4:174593156-174593178 TGGCTGAGTCATGATTCATGAGG + Intergenic
984391879 4:179145112-179145134 TGTCTGAGCCATGATTTTTTTGG + Intergenic
984712575 4:182897983-182898005 TGGCTGAGTCCTGTCTCCTCAGG - Intronic
985091355 4:186365463-186365485 TGCCTAAGTCGTGATTTTTCTGG + Intergenic
995359138 5:111274072-111274094 TGGCTGTGTCTTGATGTTTCTGG + Intronic
995380848 5:111531666-111531688 TGACTGAGTCTTGGTTCTTAAGG - Intergenic
1000471017 5:161642034-161642056 TTTCTGAGACTTGATTCTTCAGG + Intronic
1002948428 6:1784726-1784748 TGGCTGGCTCATGCTTCTTTTGG + Intronic
1003641205 6:7877040-7877062 TGGCTGATTCATTTTTGTTCAGG + Intronic
1008217358 6:48809849-48809871 TGGCTGAGTCATAATTGTAATGG + Intergenic
1009941508 6:70294450-70294472 TGGCAGATTCAGGATTCCTCTGG - Exonic
1011913074 6:92466577-92466599 TAATTGAGTCATGATTCTGCTGG + Intergenic
1015388425 6:132652600-132652622 TGGCTCAGACATTATTCTTAAGG + Intergenic
1017955711 6:159176149-159176171 TGGGTGGGTCATAACTCTTCAGG + Intronic
1022904872 7:34846018-34846040 TGGCTGAGTCATGCTGCATGTGG - Intronic
1023339778 7:39207582-39207604 TGGCAGAGTCATAATGCCTCCGG - Exonic
1024437447 7:49376318-49376340 TGGCTGTCTCATAATGCTTCTGG - Intergenic
1028731612 7:94157664-94157686 TGGATGATTCATGAGTTTTCTGG + Intergenic
1029193619 7:98789032-98789054 TGGCTGTGACATGGTTATTCTGG + Intergenic
1036459200 8:8936891-8936913 TGGCTCATTCATGAGTTTTCTGG - Intergenic
1038770953 8:30479157-30479179 CCACTGAGTCATGATTCTTCGGG + Intronic
1043939116 8:86176697-86176719 TGGCTGATTCACTATTCTGCGGG - Intergenic
1047688129 8:127322018-127322040 TAATTGACTCATGATTCTTCAGG - Intergenic
1047994816 8:130324192-130324214 GGGTTGAGTCATGATGCTTCTGG - Intronic
1056078538 9:83065397-83065419 TGGCTGGGCCATGTGTCTTCAGG + Intergenic
1056822065 9:89850132-89850154 GGGCTGAGTCCTGATTCTTCTGG - Intergenic
1058181195 9:101802040-101802062 TGACTGAGTCATCACACTTCAGG + Intergenic
1059019154 9:110554591-110554613 AGGCTGGCTCCTGATTCTTCTGG - Intronic
1059851912 9:118351334-118351356 TGGCTGAGTCTGAACTCTTCCGG - Intergenic
1062300630 9:135866031-135866053 TGCCTGTGCCATGATTCTGCTGG - Intronic
1187283678 X:17882626-17882648 TTGCTAAATCATGATTTTTCTGG + Intergenic
1190094268 X:47466497-47466519 TGGGCGAGTCATGTGTCTTCTGG + Intronic
1191790605 X:64968418-64968440 TGGCTCAGTCATCAATTTTCAGG + Intronic
1192615881 X:72621610-72621632 TGTATCAGTCATGAGTCTTCTGG + Intronic
1199364369 X:146962267-146962289 TGGCTGAATCATGAATCTCAAGG + Intergenic
1201645747 Y:16229837-16229859 TACCTGAGTCACGATTTTTCAGG + Intergenic
1201657066 Y:16355479-16355501 TACCTGAGTCACGATTTTTCAGG - Intergenic