ID: 917327865

View in Genome Browser
Species Human (GRCh38)
Location 1:173851588-173851610
Sequence GGCTGAGTCATGATTCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917327859_917327865 27 Left 917327859 1:173851538-173851560 CCTTTTTCCTCAAGAACAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 251
Right 917327865 1:173851588-173851610 GGCTGAGTCATGATTCTTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 166
917327861_917327865 20 Left 917327861 1:173851545-173851567 CCTCAAGAACAGCAGCTGTAGGT 0: 1
1: 0
2: 2
3: 13
4: 133
Right 917327865 1:173851588-173851610 GGCTGAGTCATGATTCTTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 166
917327858_917327865 28 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327865 1:173851588-173851610 GGCTGAGTCATGATTCTTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917327865 Original CRISPR GGCTGAGTCATGATTCTTCA GGG Intronic
902137288 1:14320304-14320326 GTCTGAGTCCTAATTCTTGAGGG + Intergenic
903908730 1:26706254-26706276 GGCAGATTCATGATTTTCCATGG + Intronic
904854814 1:33489679-33489701 TGCAGAGCCATGATTCTTAAAGG - Intronic
907763546 1:57386251-57386273 GGCAGAGTCTTTATCCTTCAAGG + Intronic
908396715 1:63731750-63731772 TTCTGAGTCATGTTTCATCAAGG + Intergenic
908653518 1:66362599-66362621 GCCTGAGTGATGTTTCTTCCAGG + Intronic
909266332 1:73563016-73563038 GACAGTGTGATGATTCTTCAAGG + Intergenic
910650847 1:89565490-89565512 GGCTAAGTCTTCATCCTTCAGGG - Intronic
910945314 1:92585257-92585279 GGCTGAGTCAGGATTATTTGAGG + Intronic
911458723 1:98161613-98161635 GTCAGTGTGATGATTCTTCAAGG + Intergenic
912750007 1:112279583-112279605 GGATGAGACCTGATACTTCAGGG + Intergenic
915546516 1:156601827-156601849 AGCTGTGTCCTGATTTTTCAGGG + Intergenic
917327865 1:173851588-173851610 GGCTGAGTCATGATTCTTCAGGG + Intronic
918176189 1:182047564-182047586 GGCTGAGGCCTGATTCTGCTTGG + Intergenic
920825015 1:209416886-209416908 GGATCAGTCATGGTTCTGCAAGG - Intergenic
920842419 1:209565897-209565919 GGCAGTGGCATGAGTCTTCACGG - Intergenic
921072266 1:211670986-211671008 GGCTGGGTCTTGACTGTTCAAGG - Intronic
1063917686 10:10900624-10900646 GACTGAGTCTTTTTTCTTCAAGG + Intergenic
1068688671 10:59894351-59894373 GGCTGAGTAATGATTGGACAAGG - Intronic
1070823349 10:79375914-79375936 AGCTGAGTCATGATCCATCTAGG - Intergenic
1072769680 10:98127124-98127146 GGCTGAGTGACTCTTCTTCAAGG - Intergenic
1074035089 10:109730796-109730818 AGCTTAGTCATTATTCTTCAGGG - Intergenic
1075294424 10:121261958-121261980 GGCTGAGTCATTATTGGTAAGGG + Intergenic
1076304498 10:129454955-129454977 TGTTGAGTCCTGATTCTTCCAGG + Intergenic
1079294386 11:19219246-19219268 GGCTGATTCCAGATTGTTCATGG - Intergenic
1080065858 11:28012291-28012313 GGTTAGGTCATGTTTCTTCATGG - Intergenic
1081112372 11:39151963-39151985 GACAGTGTAATGATTCTTCAAGG - Intergenic
1084378269 11:68793294-68793316 AGGTGAGTCAAGCTTCTTCAGGG - Exonic
1086522278 11:87683094-87683116 GGCTGAGTCAGGACTCTAAAGGG - Intergenic
1087694863 11:101365037-101365059 GGCAGGGTGGTGATTCTTCAAGG - Intergenic
1088451928 11:109990923-109990945 TGCTGTGTCATGATATTTCATGG - Intergenic
1090458802 11:126871660-126871682 GGGTGATTCCTGCTTCTTCAAGG - Intronic
1090471732 11:126986895-126986917 GGCTGAGTCTTGCTTCCTTATGG - Intronic
1090627710 11:128620466-128620488 TCCTGAGTCATGATTTTGCACGG + Intergenic
1091033382 11:132211551-132211573 GGCTGATGCTTGATTCTGCATGG + Intronic
1094284323 12:28775595-28775617 GGCTGAGCCATGTTTGTTCCTGG + Intergenic
1095408837 12:41899757-41899779 TGCTGAGTCATGGTTCAACATGG - Intergenic
1096537798 12:52286508-52286530 GGCTGAGTCAAAATTCTGAAGGG + Intronic
1098946123 12:76591762-76591784 GGCTTGGGAATGATTCTTCATGG - Intergenic
1099162063 12:79254272-79254294 AGCTGTGTCATCATTCTTAAGGG - Intronic
1099204113 12:79708858-79708880 GGATGAGTCTAAATTCTTCAGGG + Intergenic
1100081454 12:90856787-90856809 TCCTGAGTCCTGATCCTTCAAGG + Intergenic
1100792889 12:98150091-98150113 GGCTGAGTCATACATCTACAAGG - Intergenic
1100852218 12:98724565-98724587 AGATGAGTCATAATGCTTCAAGG - Intronic
1104178472 12:126355378-126355400 GGCTGAGTCCTGCTTCCTCTTGG + Intergenic
1107143092 13:37025332-37025354 GTCTGAGTCAGGTTTCTCCAGGG - Exonic
1107233652 13:38142156-38142178 ATCTGATTCATGAATCTTCATGG + Intergenic
1108503845 13:51091687-51091709 GGCTGAATCATCACTCTACAGGG + Intergenic
1108941048 13:55953211-55953233 GACTGTGTGATGATTCCTCAAGG + Intergenic
1109633808 13:65086275-65086297 GGCTGGGGCATCATGCTTCATGG - Intergenic
1109661204 13:65462868-65462890 GACAGTGTCATGATTCCTCAAGG - Intergenic
1110239768 13:73254232-73254254 TGCTGACTCCTGATTCTCCAAGG + Intergenic
1113312837 13:109148928-109148950 GGTTGAGACATGAAACTTCAGGG + Intronic
1115045201 14:28983541-28983563 AGCTGTGTGGTGATTCTTCAAGG + Intergenic
1116177903 14:41496680-41496702 GGCAGTGTGATGATTCCTCAAGG + Intergenic
1118021527 14:61720940-61720962 GCCTGAGTCATGTTTTTTAAAGG - Intronic
1118315682 14:64724621-64724643 GACTGAGTCAAGATTCCTTAGGG - Intronic
1118715937 14:68560180-68560202 GGCTGAGAAACGATTTTTCACGG + Intronic
1119828772 14:77682024-77682046 TGCTGAGTCCTGAGTCTTCCTGG + Intronic
1121044277 14:90776673-90776695 GGCTGGGTAAGGTTTCTTCAGGG - Intronic
1125235386 15:37506796-37506818 GACAGAGTGATGATTCCTCAAGG - Intergenic
1125508512 15:40281035-40281057 GGCTGGGTCCTTATTCTCCAAGG + Intronic
1128928152 15:71677913-71677935 GGCTGAGTCTTGAATTTTTATGG + Intronic
1134377387 16:13690124-13690146 GGCTGTGTCATCATTTTTAATGG - Intergenic
1134843519 16:17421139-17421161 GTCTGAGTCTTGATTTTCCATGG - Intronic
1138033518 16:53580027-53580049 GGCTGAGTCTGGAAACTTCATGG + Intergenic
1139646328 16:68333690-68333712 GGCAGAGTCAGCATACTTCATGG - Intronic
1140389636 16:74574019-74574041 TACTGACTCATGATTCTCCACGG + Intronic
1145408792 17:22637031-22637053 GACAGTGTGATGATTCTTCAAGG + Intergenic
1152146268 17:78570558-78570580 GCCTGGGTCTTGTTTCTTCAAGG - Intronic
1152944552 17:83191906-83191928 GGCTGAGTGAAGTTTGTTCAGGG + Intergenic
1156797543 18:41065803-41065825 GGCTGGGTCCTCATTCTTTATGG - Intergenic
1157647061 18:49285303-49285325 GGCTGTGCCATGATTCTTCCGGG - Intronic
1160289969 18:77583303-77583325 GACAGAGTGGTGATTCTTCAAGG + Intergenic
1164303044 19:23978806-23978828 GCCTAAGTCATGAGTCTTAATGG + Intergenic
1164467074 19:28496472-28496494 GACAGTGTCATGATTCCTCAAGG + Intergenic
1165294291 19:34913989-34914011 GGCTAATTCATTATTCTTCAAGG - Intergenic
1168267010 19:55228694-55228716 GGCTGAGCAGTGAGTCTTCAGGG + Exonic
1168521838 19:57057367-57057389 GTCTGCATCATGATTCTCCAGGG - Intergenic
938712378 2:133986579-133986601 AGGTGAGTCATGCTTCTGCAGGG - Intergenic
939110442 2:138000269-138000291 GCCAGAGTGATGATGCTTCATGG - Intronic
943190041 2:184663742-184663764 GGCTGAGTCCTGAGTTTTTATGG - Intronic
947221181 2:227794141-227794163 GGCAGAGTTATGTTTCTTCTAGG + Intergenic
1172113611 20:32561410-32561432 GGCTGAGTCCTTTTTCTTAATGG + Intronic
1174849092 20:53974433-53974455 GGCTGTGTTATGATTCTTATTGG - Intronic
1175066285 20:56291336-56291358 GGCTGACTCCAGAGTCTTCATGG - Intergenic
1178064511 21:28889143-28889165 GCCTGAGTCTTAATGCTTCAAGG - Intergenic
1178330625 21:31687707-31687729 TTCTGAGTCTTCATTCTTCAGGG - Intronic
1179490445 21:41737789-41737811 GGGTGAGTCACCATTCTGCAGGG + Intergenic
950140202 3:10609971-10609993 GACTGAGTCAGGATTTTTCCAGG - Intronic
950579312 3:13852271-13852293 GGTTGAGTCTTGTTTCCTCATGG + Intronic
955400774 3:58589943-58589965 GGCAAAGTCCTCATTCTTCAAGG + Intronic
956699949 3:71949932-71949954 GGCTCAGTCAGGATCCTCCATGG + Intergenic
956786317 3:72645278-72645300 GGATGAGTGATCCTTCTTCAGGG - Intergenic
957152288 3:76500952-76500974 GGCTGTGTCATAATTCTAGAAGG + Intronic
957706632 3:83795391-83795413 AGCTGAGTCCTGATTGGTCAGGG + Intergenic
958060276 3:88470943-88470965 GGCAGTGTGGTGATTCTTCAAGG + Intergenic
960143658 3:114175210-114175232 GCTAGAGTGATGATTCTTCATGG - Intronic
960463397 3:117965207-117965229 TGCTGAGCCGTGATTGTTCAGGG - Intergenic
960869709 3:122236352-122236374 TGCTGGTTCATGATTCTTCCGGG + Intronic
961242493 3:125424057-125424079 GGCTGAGTATTGAGTCTTTAAGG + Intergenic
961792177 3:129384167-129384189 GGCCGAGACATGTTTCTTCCTGG + Intergenic
965715887 3:171602591-171602613 TGCTGCTTCAAGATTCTTCATGG - Exonic
970905766 4:21214260-21214282 ATCTGAGTTATGATTTTTCATGG - Intronic
971750098 4:30635740-30635762 GGCTGAGGCTTGCTTCTACAAGG + Intergenic
971978635 4:33724821-33724843 GGCTGAGTCAGCGTTCCTCATGG - Intergenic
972848005 4:43013279-43013301 AGCTGAGTTATGCTTTTTCATGG - Intronic
979501493 4:121445674-121445696 GCCAGTGTAATGATTCTTCAAGG + Intergenic
979956168 4:126956036-126956058 GGCTGAGTCAGGGTTTTTAAGGG - Intergenic
982022894 4:151222006-151222028 GGCTAAGTCATTATTCTAGATGG - Intronic
982416969 4:155145312-155145334 GGCTGAGTCATGCTTTTTATTGG + Intergenic
985748497 5:1661309-1661331 GACTGAAACACGATTCTTCAGGG + Intergenic
986764659 5:10914001-10914023 GGCTGAGTCATGATTGGAAATGG - Intergenic
988344261 5:30017893-30017915 GGGTGAAGCATGAATCTTCAGGG - Intergenic
989099336 5:37809678-37809700 GGCTGCATGATGACTCTTCATGG + Intergenic
990634490 5:57709433-57709455 AGCTGAGTCATGCTTCTGGATGG + Intergenic
991951505 5:71950783-71950805 GACTGTGTGATGATTCCTCAAGG - Intergenic
994086930 5:95769096-95769118 GCCTGAGCCTTAATTCTTCAAGG + Intronic
995612727 5:113927231-113927253 GACTGGATCATCATTCTTCAAGG + Intergenic
996684460 5:126265598-126265620 GGCTGAGTCAGGGTTTTTTATGG - Intergenic
1000874548 5:166619848-166619870 GTGTTAGTCATGGTTCTTCAAGG + Intergenic
1002617700 5:180465918-180465940 GGCTGACACATGGTTCTCCAGGG - Intergenic
1003186048 6:3831457-3831479 GTTTTAGTCATGAATCTTCAAGG + Intergenic
1003641206 6:7877041-7877063 GGCTGATTCATTTTTGTTCAGGG + Intronic
1004547605 6:16613589-16613611 GGCTGAGGCAGGATTGCTCAAGG + Intronic
1007461485 6:42022476-42022498 GGCTGGGTCATGGTTTTTAACGG + Intronic
1007930669 6:45687682-45687704 GGCTGACTCATCTTGCTTCATGG - Intergenic
1011717180 6:90119254-90119276 GATTCAGTCATGATTCTTCCAGG + Intronic
1012008890 6:93754544-93754566 GGCTGAATAATGGTCCTTCAAGG + Intergenic
1012182529 6:96172412-96172434 TGCTTAGTAATGATTCTACATGG + Intronic
1013969652 6:116001561-116001583 AGCTGAGTCATGATTGGCCAAGG - Intronic
1014129247 6:117811782-117811804 GGCAGGCTCATGATTCTTAAAGG + Intergenic
1015388426 6:132652601-132652623 GGCTCAGACATTATTCTTAAGGG + Intergenic
1016697782 6:147017893-147017915 GACAGATACATGATTCTTCAGGG - Intergenic
1017583837 6:155898260-155898282 GGGTTAGTCATGATGCTTCTAGG + Intergenic
1017615390 6:156241765-156241787 GGCTGCGATATGATCCTTCAGGG + Intergenic
1018544348 6:164919023-164919045 GCCTGGGTCCTGAGTCTTCAGGG + Intergenic
1019311658 7:364846-364868 GGCTGAGTCCTGGTTCTCTAAGG - Intergenic
1019311666 7:364886-364908 GGCTGAGTCGTGGTTCTGTAAGG - Intergenic
1023615997 7:42020480-42020502 GAAAGATTCATGATTCTTCATGG - Intronic
1024478926 7:49844026-49844048 GGCTGGGTGATGATTCATGAAGG + Intronic
1026463427 7:70633919-70633941 GGCTGTGTCAGGATTATTCTAGG + Intronic
1026942051 7:74292885-74292907 GGCAGAATCATAATTGTTCAGGG - Intronic
1032376455 7:131423994-131424016 TGCTGGGTCATGATACTTCAAGG + Intronic
1034190659 7:149210850-149210872 GGCTGAGCCAGGATTCCTCCAGG + Intronic
1036204757 8:6796955-6796977 GGCTGTGTCCAGAGTCTTCAGGG - Intergenic
1037544641 8:19906790-19906812 GGCAGTGTGGTGATTCTTCAAGG - Intronic
1038862268 8:31400646-31400668 GTCTTAGTGATGAGTCTTCATGG + Intergenic
1040677009 8:49762598-49762620 GGCTGAGTGTTGAATCTCCATGG + Intergenic
1040758712 8:50812048-50812070 GGCTGTGATATGTTTCTTCATGG + Intergenic
1044590239 8:93907363-93907385 GTCTGGGTCTTGATTCTTGAAGG - Intronic
1046058756 8:109110701-109110723 GGCTGAGTGATGATTCATGGTGG - Intronic
1046594723 8:116248062-116248084 GGCTGAGTCATTATGCTACCTGG - Intergenic
1047787467 8:128167885-128167907 GACTGAGGCATGATTCAGCATGG - Intergenic
1048224573 8:132572643-132572665 GTCAGAGTCTTGATTCTACAAGG - Intronic
1049247092 8:141568703-141568725 GGCTGAGTCATGGTGCTTGCAGG + Intergenic
1049546668 8:143235015-143235037 TGCTGCCTCATGATTCTCCAAGG - Intergenic
1056822064 9:89850131-89850153 GGCTGAGTCCTGATTCTTCTGGG - Intergenic
1059019153 9:110554590-110554612 GGCTGGCTCCTGATTCTTCTGGG - Intronic
1060678141 9:125535570-125535592 GGCTGAGTGAGGATTAATCAAGG - Intronic
1061580656 9:131533711-131533733 GGCTGACTCATGCTTCTTTAAGG - Intergenic
1185997884 X:4973301-4973323 GGCTGAGACAGGATCTTTCATGG + Intergenic
1187045274 X:15641936-15641958 TGCTGTGGCATGATTATTCATGG + Intronic
1191790606 X:64968419-64968441 GGCTCAGTCATCAATTTTCAGGG + Intronic
1193315571 X:80061106-80061128 GGCAGTGTGGTGATTCTTCAAGG - Intergenic
1193353616 X:80490315-80490337 GACAGTGTGATGATTCTTCAAGG - Intergenic
1193513241 X:82432425-82432447 TGCTGAGTCACCATTTTTCATGG - Intergenic
1193991521 X:88313917-88313939 GACAGTGTCATGATTCCTCAAGG + Intergenic
1194452141 X:94057501-94057523 GGTTTAGTCATGATGCATCAGGG - Intergenic
1194897766 X:99467131-99467153 GGCTAAGTCATATTTCTCCATGG + Intergenic
1197783843 X:130181278-130181300 GGCTGAGTGAAGATTTTACAGGG - Intronic
1198189502 X:134288195-134288217 GGCTGAGTCTGGAGTTTTCATGG - Intergenic
1199117978 X:144015150-144015172 GACGGAGTTGTGATTCTTCAAGG + Intergenic