ID: 917327866

View in Genome Browser
Species Human (GRCh38)
Location 1:173851589-173851611
Sequence GCTGAGTCATGATTCTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917327858_917327866 29 Left 917327858 1:173851537-173851559 CCCTTTTTCCTCAAGAACAGCAG 0: 1
1: 0
2: 2
3: 35
4: 296
Right 917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
917327863_917327866 -10 Left 917327863 1:173851576-173851598 CCATCATGCACTGGCTGAGTCAT 0: 1
1: 0
2: 3
3: 12
4: 143
Right 917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
917327861_917327866 21 Left 917327861 1:173851545-173851567 CCTCAAGAACAGCAGCTGTAGGT 0: 1
1: 0
2: 2
3: 13
4: 133
Right 917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
917327859_917327866 28 Left 917327859 1:173851538-173851560 CCTTTTTCCTCAAGAACAGCAGC 0: 1
1: 0
2: 0
3: 18
4: 251
Right 917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917327866 Original CRISPR GCTGAGTCATGATTCTTCAG GGG Intronic
900725653 1:4214794-4214816 TCTGACTCTTGATTCTTCAAAGG - Intergenic
902099643 1:13975405-13975427 GCTGAGAGGTGATGCTTCAGAGG + Intergenic
908581087 1:65518041-65518063 GCAGAGTCCTGTTTCTCCAGAGG + Intronic
908846655 1:68331387-68331409 GCACAGTCATTATTCATCAGTGG + Intergenic
910320962 1:85943416-85943438 TGTTAGTCAGGATTCTTCAGAGG - Intronic
912431040 1:109628584-109628606 GCTGAGTCAGAGCTCTTCAGGGG - Intronic
912931502 1:113967704-113967726 GTTTGGTCCTGATTCTTCAGTGG + Intronic
916800628 1:168212711-168212733 CCTGTGAAATGATTCTTCAGAGG + Intergenic
917327866 1:173851589-173851611 GCTGAGTCATGATTCTTCAGGGG + Intronic
917670740 1:177270971-177270993 GCTGAATCATGTTTCTTTATTGG - Intronic
917678918 1:177346687-177346709 GCTGAGGGAAGACTCTTCAGAGG + Intergenic
921375872 1:214472719-214472741 ACTGACTCATGCTTTTTCAGGGG + Intronic
922341591 1:224660891-224660913 GGTGAGCCTTGACTCTTCAGTGG - Intronic
924597455 1:245459855-245459877 CTTGAATCATGATTTTTCAGTGG - Intronic
924665705 1:246069720-246069742 TCTGCCTCAGGATTCTTCAGAGG - Intronic
1067913780 10:50374689-50374711 GATGAGTGAGGATTCTTAAGAGG - Intronic
1070823348 10:79375913-79375935 GCTGAGTCATGATCCATCTAGGG - Intergenic
1075111959 10:119595499-119595521 GCTGAGTCATCACTCTTCATTGG + Intronic
1075294425 10:121261959-121261981 GCTGAGTCATTATTGGTAAGGGG + Intergenic
1078620527 11:12902995-12903017 GCTGTGTCATGATTGTTTGGAGG + Intronic
1083570523 11:63759326-63759348 TCATAGTCATGATCCTTCAGAGG + Exonic
1084367474 11:68712010-68712032 GCTGAGAGATGCATCTTCAGGGG + Intronic
1084378197 11:68792735-68792757 CCTGAGTCTGGATTCCTCAGGGG - Intronic
1086522277 11:87683093-87683115 GCTGAGTCAGGACTCTAAAGGGG - Intergenic
1087102530 11:94379619-94379641 GATGAATCATAAGTCTTCAGTGG - Exonic
1091569327 12:1670663-1670685 TCTGAGTCATGGGTCTACAGAGG + Intergenic
1094217026 12:27953402-27953424 GATGTGTCATGGTTCTTCATAGG - Intergenic
1099015558 12:77339783-77339805 GCTGAGTCATGAAACATGAGTGG + Intergenic
1099773319 12:87092793-87092815 GCAGAGTCATGCTTCCTCAGAGG + Intergenic
1108677345 13:52748536-52748558 GCCCATTCATGATTCTGCAGTGG - Intergenic
1109640042 13:65179787-65179809 TATTAGTCATGATTCTCCAGAGG - Intergenic
1118978271 14:70695799-70695821 ACTGAGTCTTGATTCTTTTGGGG + Intergenic
1124514295 15:30353050-30353072 GCTGAGACCTGCTTTTTCAGAGG + Intergenic
1124728624 15:32177714-32177736 GCTGAGACCTGCTTTTTCAGAGG - Intergenic
1128028384 15:64459259-64459281 GCAGAGTCATGCTCCTTCAGTGG + Intergenic
1130819447 15:87479017-87479039 CCTGGGTCATGATTCTGCAAAGG - Intergenic
1131254247 15:90851369-90851391 GCTGAGTCAGGATCCATCTGGGG + Intergenic
1142424796 16:89996031-89996053 GCTGAGTCATGTCTGTTGAGGGG - Intergenic
1142870429 17:2816270-2816292 TCTGAGTCATGAGTACTCAGAGG - Intronic
1143979330 17:10854743-10854765 TTTGAGTAATGGTTCTTCAGAGG + Intergenic
1144131784 17:12253495-12253517 GCTGAGTCCTGCTTCTTCTCTGG + Intergenic
1147661182 17:42117922-42117944 CCTGAGTCTGGATTCTGCAGGGG - Exonic
1157718791 18:49907662-49907684 GCTGAATCATCATTCTTCATAGG + Intronic
1157798044 18:50593807-50593829 CCTGAGTCAGGGTTCTCCAGAGG + Intronic
1161025968 19:2037364-2037386 GCTGAGTCAGGAGTTTTGAGGGG - Intergenic
1161058903 19:2204613-2204635 GCTGAGTCAGGGTACTGCAGTGG + Intronic
1166062262 19:40333959-40333981 GTTGATGCATGATTCTTCTGTGG - Intronic
1167077504 19:47258341-47258363 GCTGCGTCTAGATTCTGCAGGGG + Exonic
930589603 2:53311823-53311845 GCTGAGTCCTGATTGTTCTCAGG - Intergenic
938712377 2:133986578-133986600 GGTGAGTCATGCTTCTGCAGGGG - Intergenic
941423581 2:165315492-165315514 GCTGAATCAAGAGACTTCAGTGG + Exonic
1180722942 22:17922968-17922990 ACTTAGGCATGATTCATCAGTGG + Intronic
1181319794 22:21995456-21995478 GCTGAGCCATTAGTCTTCTGAGG - Intergenic
951911809 3:27758387-27758409 GCTGTGGCATCCTTCTTCAGTGG + Intergenic
954803338 3:53200362-53200384 CCTGAGTCATGAGTCAGCAGTGG + Intergenic
954942720 3:54389387-54389409 ACTGAGGCAAGAATCTTCAGTGG + Intronic
955634299 3:61009106-61009128 GCTGCCTCCTTATTCTTCAGAGG - Intronic
956786316 3:72645277-72645299 GATGAGTGATCCTTCTTCAGGGG - Intergenic
959814609 3:110661128-110661150 GCTGGGCCAAGAATCTTCAGTGG - Intergenic
967658735 3:192079374-192079396 ATTGAGTCATGATTCAGCAGGGG - Intergenic
967921510 3:194617566-194617588 GCTGAGTCATGATCAATCAAAGG - Intronic
971355746 4:25893988-25894010 GCTCAGAAATGCTTCTTCAGTGG + Intronic
971761646 4:30773619-30773641 GCAGCACCATGATTCTTCAGTGG - Intronic
971771532 4:30903631-30903653 TCTGAGTCATGATTCATCTTTGG - Intronic
973100305 4:46259602-46259624 GCTGAATCATTATTCTTATGGGG + Intronic
974002325 4:56524085-56524107 GTTGTGTTATTATTCTTCAGTGG - Exonic
974237243 4:59198065-59198087 GATGAGACATCATCCTTCAGGGG - Intergenic
975545850 4:75559877-75559899 GCTGTGTGATTATTATTCAGTGG - Intronic
978890704 4:113823427-113823449 GATTAGTCATGGTTTTTCAGAGG - Intergenic
981494618 4:145377413-145377435 TCATAGTCATGATCCTTCAGAGG + Intergenic
982895237 4:160912825-160912847 TCTGAATTATGATACTTCAGTGG - Intergenic
984105576 4:175541301-175541323 GCTGAGTCAGGGGTCTTCATAGG + Intergenic
984386561 4:179067127-179067149 GCTCAATCATGCCTCTTCAGGGG - Intergenic
985748498 5:1661310-1661332 ACTGAAACACGATTCTTCAGGGG + Intergenic
986386940 5:7243831-7243853 TCTGTGCCATGATTCTTCTGCGG - Intergenic
986673871 5:10167091-10167113 GCAGGGTCATGCTTCTTCTGAGG - Intergenic
986858288 5:11897953-11897975 GCTGCTTCTTTATTCTTCAGAGG - Intronic
988344260 5:30017892-30017914 GGTGAAGCATGAATCTTCAGGGG - Intergenic
990634491 5:57709434-57709456 GCTGAGTCATGCTTCTGGATGGG + Intergenic
991411126 5:66346809-66346831 GGTGAGTTAGGATTCTGCAGGGG - Intergenic
993732870 5:91443987-91444009 GATGACTCATGATTATTCAATGG + Intergenic
997626471 5:135334526-135334548 GCAAATTCATGATTCTTCTGAGG + Exonic
999037762 5:148372740-148372762 GTTTAGTCATGATTATTAAGTGG - Intergenic
999858381 5:155619698-155619720 CCTGATTCCTGAGTCTTCAGGGG - Intergenic
1000697605 5:164407225-164407247 GCAAAGTCATGTTTCTTGAGGGG + Intergenic
1001414398 5:171534485-171534507 GCTAAGTCAAGATTCATCAAAGG - Intergenic
1003236519 6:4300139-4300161 TATTAGTCAGGATTCTTCAGAGG - Intergenic
1003641207 6:7877042-7877064 GCTGATTCATTTTTGTTCAGGGG + Intronic
1005402537 6:25449421-25449443 CCTGGGCCATGATTCTTCTGGGG - Intronic
1008144116 6:47869237-47869259 GCTGGGGCATAATTGTTCAGGGG - Intergenic
1009390572 6:63139032-63139054 GCTGAGTTCAGATTCCTCAGTGG - Intergenic
1010302119 6:74273402-74273424 GCTGCCTCAGGATTCTGCAGAGG - Intergenic
1011118574 6:83924550-83924572 AGTGAATTATGATTCTTCAGGGG - Exonic
1012182530 6:96172413-96172435 GCTTAGTAATGATTCTACATGGG + Intronic
1016697781 6:147017892-147017914 ACAGATACATGATTCTTCAGGGG - Intergenic
1018544350 6:164919024-164919046 CCTGGGTCCTGAGTCTTCAGGGG + Intergenic
1021634816 7:22681890-22681912 TCTGAGTCATAATACTTCAGTGG - Intergenic
1022500149 7:30877617-30877639 GCTGGGCCCTGAGTCTTCAGTGG - Intronic
1022681427 7:32550139-32550161 CCTGAGTAATCATTCTTCAAAGG + Intronic
1023486558 7:40693605-40693627 GGTGATTCATGCTCCTTCAGAGG - Intronic
1026145578 7:67743703-67743725 GGTGAGTCATTCTGCTTCAGAGG + Intergenic
1031088730 7:117327512-117327534 GCTGAGTAATTATTCTTTTGGGG - Intergenic
1032376456 7:131423995-131424017 GCTGGGTCATGATACTTCAAGGG + Intronic
1033030574 7:137822097-137822119 GCTGAATTATTATTATTCAGTGG - Intronic
1034744092 7:153506979-153507001 GCTGAGTTTTGAACCTTCAGTGG + Intergenic
1036096933 8:5734601-5734623 GCAGAGCCAGGAATCTTCAGAGG - Intergenic
1038124585 8:24658429-24658451 ACTGAGGCATCATTCTACAGAGG - Intergenic
1048720383 8:137317554-137317576 GCTGAGTGATGATGCTGCAGAGG + Intergenic
1057254317 9:93532398-93532420 ACTCAGTCATGATTCTTCTAAGG - Intronic
1057402097 9:94732920-94732942 GCCAAGTCAAGATCCTTCAGTGG + Intronic
1059495688 9:114707342-114707364 GCTGATTAATGATGTTTCAGAGG - Intergenic
1192544173 X:71999019-71999041 GCTGAGTCTTGATGCATGAGTGG - Intergenic
1195995476 X:110727277-110727299 GCTGCTTTAGGATTCTTCAGAGG + Intronic
1197030098 X:121802916-121802938 CCTGACTCATGCTTCTTCACTGG - Intergenic
1199407431 X:147478920-147478942 GTTTAGTCATGATTACTCAGTGG + Intergenic
1199887692 X:152037897-152037919 GCTCAGTTATAATTCTGCAGTGG - Intergenic