ID: 917328390

View in Genome Browser
Species Human (GRCh38)
Location 1:173856719-173856741
Sequence CTAAGGCAATTCCTCCATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917328390 Original CRISPR CTAAGGCAATTCCTCCATGA GGG (reversed) Exonic
910803595 1:91168260-91168282 CTAAGGTGATGCCTCCCTGAGGG + Intergenic
913333097 1:117683539-117683561 CTAGGGCACTTCCTGCATGTGGG + Intergenic
913431806 1:118803372-118803394 GAAAGGCACTTCCTACATGATGG - Intergenic
917328390 1:173856719-173856741 CTAAGGCAATTCCTCCATGAGGG - Exonic
1062943304 10:1440008-1440030 CTGAGGCAGGTCCTTCATGATGG + Intronic
1064327852 10:14367241-14367263 CTAAGGCTTCTCCTCCATGAGGG - Intronic
1064454802 10:15477443-15477465 ATAAAGCAAGTTCTCCATGAAGG - Intergenic
1067979063 10:51062080-51062102 CAAAAGTAAATCCTCCATGAAGG - Intronic
1072218647 10:93309148-93309170 CTAAGACAGTTCCTCCAAGGAGG - Intronic
1074702824 10:116107351-116107373 CTAAGGGAATTCATCCAGCATGG - Intronic
1076220881 10:128732135-128732157 CTAAGGGCATTCCTCCAGGTTGG + Intergenic
1076340114 10:129739831-129739853 CTAAGACAATTCTTCCAGTATGG + Intronic
1076765375 10:132630332-132630354 CTAGGGAAAGGCCTCCATGAGGG + Intronic
1078069360 11:8098111-8098133 CCAAGGCAACTCTTCCATGGTGG - Intronic
1078146938 11:8728479-8728501 CTAAGTTAATTCTTACATGAAGG + Intronic
1078682232 11:13487667-13487689 CAAAGGCAATTCTTCCATTGTGG + Intergenic
1080241166 11:30128673-30128695 GGAAGGCAATTCATCCATGAAGG + Intergenic
1080766865 11:35305224-35305246 GTAAGAAAATACCTCCATGAGGG - Intronic
1081683107 11:45022677-45022699 CTGAGCCAGTTCCTCCATGCGGG + Intergenic
1083432671 11:62622309-62622331 CTCAGGCAATTCCGTGATGAGGG - Intergenic
1084290479 11:68162465-68162487 CTTAGGCAACACCTCCCTGAGGG + Intronic
1084312954 11:68327175-68327197 CAAAGCCAAGTCCTCCAGGACGG + Intronic
1084903364 11:72327137-72327159 CTAAGGCAGCCCCTCCATGGTGG + Intronic
1086058899 11:82680502-82680524 CTAAGTCAGTTCCTGGATGAGGG - Intergenic
1090829063 11:130408489-130408511 CAAAGGCAACTCCTGCAGGAAGG - Exonic
1096290588 12:50339248-50339270 CTCAAGCAATTCCTCCATTTTGG + Intronic
1097491825 12:60281335-60281357 ATAAGGCATTTCTTCCATTAGGG - Intergenic
1100525784 12:95418371-95418393 GTAAGACTATTCCTCCAGGAAGG + Intergenic
1101321689 12:103678491-103678513 CTGGGTAAATTCCTCCATGAAGG - Intronic
1111373648 13:87351141-87351163 ATAAAGCCATTCCCCCATGAAGG + Intergenic
1116223864 14:42122749-42122771 CCTAAGCAATTCCTCCTTGATGG - Intergenic
1119079741 14:71681200-71681222 ATCAGGCAATTCCTGCATAAGGG - Intronic
1120260011 14:82171877-82171899 CAAATGCAAATCCTCCATGAAGG - Intergenic
1127621237 15:60736771-60736793 CTACGGCCATACCTCCCTGAAGG + Intronic
1127641456 15:60919434-60919456 ATAATGCAATTCCTTCATGAGGG + Intronic
1128678250 15:69627585-69627607 CCAAGGGAAGTCCTACATGAGGG + Intergenic
1129115176 15:73361629-73361651 CTGAGTGAATTCCTCCATGGTGG + Intronic
1132157841 15:99509056-99509078 CTGAGCCAATTACTACATGAGGG - Intergenic
1137022019 16:35437603-35437625 CAAAGTCAAGTCATCCATGATGG - Intergenic
1139667332 16:68466840-68466862 CTAATTCCATTCCCCCATGATGG + Intergenic
1141552311 16:84814167-84814189 CCAAAGAAAGTCCTCCATGAAGG + Intergenic
1142852341 17:2710373-2710395 CCAAGGCAACTCCGCTATGATGG + Intronic
1147501737 17:40972130-40972152 ATGAGGCACTTCTTCCATGAAGG + Intergenic
1148441241 17:47712691-47712713 CAAAGGCAATTGCTCATTGAAGG + Intergenic
1148710117 17:49673684-49673706 CAAATGCACTTCCTCCAGGAAGG + Intronic
1148921547 17:51039599-51039621 CTAAGGCAAGTCCTCCTCTAGGG + Intronic
1149969034 17:61197440-61197462 CTAAGACAATGCCTCAATGTTGG - Intronic
1150580892 17:66473033-66473055 ATGGGGCAATTCCTCCATAATGG - Intronic
1153457735 18:5297513-5297535 CTAAGGTATTAGCTCCATGATGG + Intergenic
1156356122 18:36341789-36341811 CTAAGGAAAATCCTCTCTGAAGG + Intronic
1158258539 18:55582406-55582428 CTAAAACAATTCAGCCATGATGG - Intronic
1159756472 18:72371653-72371675 CAAAGGCATGTCCTACATGATGG - Intergenic
1160347591 18:78146476-78146498 CCAAGGCAATTTCTGCATGATGG - Intergenic
1163475145 19:17521406-17521428 CTTAGGAAATTCATCCATGGTGG - Intergenic
932904525 2:75734762-75734784 AAAAGGCACTTCCTACATGACGG + Intergenic
933797414 2:85930658-85930680 CTAAGCCAATGACTGCATGAAGG - Intergenic
935873847 2:107484828-107484850 TTGAGGCAATTCCTTCAGGATGG - Intergenic
937942304 2:127295507-127295529 CTGAGGAAATTTCTACATGATGG + Intergenic
938840208 2:135153815-135153837 CTAAGCCAATTCCTGCTAGAAGG + Exonic
941304977 2:163853383-163853405 CTCAGGCAATTCCTACATCTTGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1169481058 20:5981192-5981214 CTAATGCAATTCCTCAGAGATGG - Intronic
1169759964 20:9080469-9080491 CTAGTGCAATTCCTTCATGATGG - Intronic
1170469069 20:16650175-16650197 CTAGAGCAATGCCTCCATGTTGG - Intergenic
1173159035 20:40638860-40638882 CAAAGCCAATTCTTCCATTATGG + Intergenic
1173456727 20:43208539-43208561 GTAAGGCAATTACTCCATAAGGG - Intergenic
1177783864 21:25648573-25648595 CAAATGCAATTTCTCCCTGAAGG + Intronic
1178892306 21:36530399-36530421 TTAAGGCAAGTGCTGCATGAAGG - Intronic
1179179635 21:39034559-39034581 CTAGGGCATTTCCTCCAAGCAGG - Intergenic
1181446310 22:22977744-22977766 CTAAGTCAATTCCTGGGTGAGGG + Intergenic
1182627009 22:31654840-31654862 CTCAGGCAATTCCTCCACCTTGG - Intronic
952834588 3:37592301-37592323 ATAAGGCTATTCCTCGTTGAAGG + Intronic
955113624 3:55974707-55974729 CGAAGCCACTGCCTCCATGAAGG + Intronic
956023273 3:64955128-64955150 CAAAGGCACTTCCTCTCTGAGGG + Intergenic
956090388 3:65660253-65660275 CTAAGGCACTAACGCCATGAAGG + Intronic
957615329 3:82519100-82519122 CTGAGGCATTCCCTCCCTGAAGG + Intergenic
957988299 3:87598245-87598267 GAAAGGCACTTCTTCCATGATGG + Intergenic
959597801 3:108146835-108146857 CTAAGGGAAGTCCTCCAACAAGG + Intergenic
961011311 3:123438012-123438034 CTAAGCAATTTCCTCCCTGAGGG + Intronic
963535096 3:146517869-146517891 CTAAGGCAACTCCTCTAGGAGGG + Intronic
969997082 4:11324253-11324275 CTAATAGAAGTCCTCCATGAGGG - Intergenic
970482382 4:16489476-16489498 CTCAGGTTTTTCCTCCATGAGGG + Intergenic
975401752 4:73945976-73945998 ATAAGGCACTTAATCCATGATGG - Intergenic
975489329 4:74971219-74971241 CAAAGGCATGTCCTACATGATGG + Intronic
977471076 4:97443715-97443737 CTAAAGGAAATCCTCCCTGAAGG + Intronic
978929561 4:114294445-114294467 CAAAGGAACTTCCTCCATGGTGG + Intergenic
980060457 4:128123207-128123229 CTGAGGCAGGTCCTCCAAGAAGG - Intronic
980644705 4:135628445-135628467 CTTAGGCAAATACTTCATGACGG - Intergenic
984269600 4:177535144-177535166 CAAAGGCACGTCCTACATGATGG + Intergenic
986261210 5:6147993-6148015 CTAAGGCAATTAGGCCATAAAGG - Intergenic
988482976 5:31645157-31645179 CTAAGTTTATTCCTCCCTGAAGG - Intronic
988793037 5:34626511-34626533 CTTAGGCAGTTCCTTCAGGAGGG + Intergenic
989737557 5:44727054-44727076 CTAAGTCAATGCCTCCCTGAAGG - Intergenic
990809224 5:59703407-59703429 ATAAGGTACTTCCTCCATTAAGG - Intronic
991188699 5:63842659-63842681 CCAAGTCAAATCATCCATGAAGG - Intergenic
991722795 5:69509402-69509424 CAAAGCCACTTCCTCCATAAGGG - Exonic
993561397 5:89415366-89415388 ATAAGCCAATTCCTCTATAAAGG - Intergenic
996863882 5:128095739-128095761 CTAAGCCAATTCTTCCAGTATGG + Intronic
997436804 5:133881545-133881567 CTGAGGAAATTCCTCAGTGAGGG - Intergenic
997759610 5:136432688-136432710 CAATGGCATCTCCTCCATGAAGG - Intergenic
999166961 5:149557667-149557689 CTAAAGCAACTCCTCCTGGATGG - Intronic
999279246 5:150354085-150354107 CTGAGTGAATTCCTCCATCAGGG - Intergenic
1006168263 6:32078604-32078626 CTAAGGCCATACCACCCTGAAGG - Intronic
1009441030 6:63678310-63678332 GTTAGGCTATTCCACCATGATGG - Intronic
1011871235 6:91895684-91895706 CCAAGGCTATTCTTCCATGCAGG + Intergenic
1012039374 6:94185007-94185029 CTAATAGAATTTCTCCATGAGGG + Intergenic
1015541246 6:134316373-134316395 CTAGGGCAATTCCACCAAAATGG - Intronic
1016335714 6:143002895-143002917 CAAAGGCACTTCTTCTATGATGG + Intergenic
1021469159 7:20981576-20981598 CTTACGCAATCACTCCATGAAGG + Intergenic
1024500315 7:50098731-50098753 ATAAGGTAAGACCTCCATGATGG - Intronic
1026565177 7:71484059-71484081 CTCAGGCAAGTCCTTCAGGAGGG - Intronic
1028391653 7:90323519-90323541 CTCAGGCAATTCCTAAATGACGG + Intergenic
1032716479 7:134513181-134513203 CCAAGGCAATTTCCCAATGAAGG - Intergenic
1033433019 7:141306316-141306338 CAAAGGGCATCCCTCCATGATGG - Intronic
1036411651 8:8507107-8507129 CTGATGCTCTTCCTCCATGAAGG - Intergenic
1042296110 8:67220050-67220072 CTAAGGCATAAGCTCCATGAGGG + Intronic
1048507616 8:135035169-135035191 CCAAGGCAATTGCTGCAGGATGG - Intergenic
1051085083 9:13339266-13339288 CAAAGGCATTTCTTACATGATGG + Intergenic
1054801459 9:69353805-69353827 CTAAGTCAATTCCTACAAAAAGG - Intronic
1056716853 9:89038384-89038406 CAAAGGCAACTCCTCCAGAAGGG + Intronic
1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG + Intergenic
1058438789 9:104988757-104988779 CAAATGCAACTCCTCCCTGAGGG + Intergenic
1059982219 9:119785472-119785494 GTCTGGCAATTCATCCATGAAGG + Intergenic
1061645782 9:132000175-132000197 CTAAGGCTTTTTTTCCATGAAGG - Intronic
1186587633 X:10893081-10893103 CAAAGTGAATGCCTCCATGAAGG - Intergenic
1187307708 X:18111677-18111699 ATAAGGAAATTCCTCCATACTGG - Intergenic
1189366214 X:40390801-40390823 CTGAGGAAATCCCTCCTTGAGGG + Intergenic
1193455876 X:81730593-81730615 CAAAGGCAATTCTTACATGGTGG - Intergenic
1197882161 X:131178222-131178244 CTGTGCCAATTCCTCCAGGAGGG + Intergenic
1198059515 X:133031373-133031395 ATAAGCCAATTCCTCTATTAGGG + Intronic
1198118407 X:133567008-133567030 TTACGGCAATTCCTGCTTGAGGG - Intronic
1198204427 X:134452564-134452586 CTAAGGCCATACCTCCCTGAAGG - Intergenic
1198803335 X:140469626-140469648 CTAAGGGAATTCCTCTGTGAAGG + Intergenic
1202086259 Y:21139981-21140003 CTAAAACACTTCCTCCATTAAGG + Intergenic