ID: 917328412

View in Genome Browser
Species Human (GRCh38)
Location 1:173857079-173857101
Sequence CATGGCAATCAGAAGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917328412_917328416 10 Left 917328412 1:173857079-173857101 CCAGTGTCCTTCTGATTGCCATG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 917328416 1:173857112-173857134 TTGCTTGTTTTGTCAAAGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 290
917328412_917328417 29 Left 917328412 1:173857079-173857101 CCAGTGTCCTTCTGATTGCCATG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 917328417 1:173857131-173857153 AAGGAAGAGTAAGAAATTCTAGG 0: 1
1: 0
2: 6
3: 54
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917328412 Original CRISPR CATGGCAATCAGAAGGACAC TGG (reversed) Intronic
901916200 1:12502470-12502492 CCTGGCACTCAGAGCGACACTGG + Intronic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
903341870 1:22659648-22659670 CATGGGATTTAGCAGGACACTGG + Intronic
905628203 1:39502605-39502627 GGGGGCAGTCAGAAGGACACAGG + Intronic
906103192 1:43276205-43276227 CATTGCAACCAGAAGCCCACTGG + Intergenic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906572478 1:46855568-46855590 CATGGCAATCAACTAGACACTGG - Intergenic
906599295 1:47110319-47110341 CATGGCAATCAACTAGACACTGG + Intronic
906813533 1:48853710-48853732 CATGGGAATCTGAAGGATAAAGG - Intronic
908280428 1:62528195-62528217 CATGGCAATCGCAGGGACATCGG - Exonic
909140998 1:71865123-71865145 GATGGCAATCAGGAGGCCACTGG - Intronic
911142821 1:94524380-94524402 CATGGCAACAAGTAGGACAGAGG + Intergenic
913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
916350637 1:163845720-163845742 AATAGCAATCAGAAATACACAGG - Intergenic
917254463 1:173099476-173099498 CAAAGCAATCAAAAGGTCACTGG - Intergenic
917328412 1:173857079-173857101 CATGGCAATCAGAAGGACACTGG - Intronic
918154093 1:181828444-181828466 CATGGCAATCATAAAGAAAATGG + Intergenic
918224843 1:182472015-182472037 AATGGCCTGCAGAAGGACACTGG - Intronic
920398892 1:205664896-205664918 CGGGGCAATCACAAGCACACGGG + Intronic
921330944 1:214035262-214035284 CATGGCAATCAAAAAGAAATAGG + Intronic
921374604 1:214460850-214460872 CATGGCTTTCAGAAGGATCCAGG - Intronic
921657830 1:217761941-217761963 AATGGTAATCAGAAGGTGACGGG - Intronic
923310228 1:232727940-232727962 CATAGCAATCAGAAGGACAGTGG - Intergenic
924226462 1:241926269-241926291 CTTGGCAATCACAAGAAAACAGG + Intergenic
924260448 1:242224647-242224669 CATGGGAATCAGCAGCTCACAGG + Intronic
1065376537 10:25048935-25048957 CATGGAAATCAGAAAGAAAGAGG + Intronic
1069824305 10:71245891-71245913 CAGGGCAGTCCCAAGGACACGGG + Intronic
1078329018 11:10403388-10403410 GATGGACATCAGAGGGACACAGG - Intronic
1078471489 11:11590494-11590516 CCAACCAATCAGAAGGACACTGG + Intronic
1078607428 11:12789323-12789345 AATGCCAATAAGAATGACACTGG - Intronic
1083263690 11:61536491-61536513 CAGGGCAGTCAGAGGGCCACTGG - Intronic
1088992105 11:114962598-114962620 CATGGCAATGAGAAAGACCTGGG + Intergenic
1089699781 11:120237677-120237699 TATGGAAATCACAAGCACACAGG + Intronic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1091067362 11:132528458-132528480 CAAGGGAACCAGAAGGACAGTGG - Intronic
1092988450 12:13870419-13870441 CATAGCAAACAGAAGGCCACAGG + Intronic
1096239277 12:49950946-49950968 CATGGCAATCTGTAGCACAGAGG - Exonic
1097248251 12:57618385-57618407 CATGGCAAACAGCAGGATTCTGG + Intronic
1099202882 12:79695461-79695483 CAATGCAATCAGAATGCCACTGG - Intergenic
1102057315 12:109906367-109906389 CATGTCAATCAGAAGACCAAAGG - Intronic
1103328400 12:120137032-120137054 CATGGCAGTCAGATGGGGACAGG - Intronic
1108726582 13:53189896-53189918 CATGGCAACCACCTGGACACTGG - Intergenic
1110942839 13:81371532-81371554 CATGACAATCAGAAGTAAAGAGG + Intergenic
1110942878 13:81372567-81372589 CATGACAATCAGAAGTAAAGAGG + Intergenic
1112445334 13:99459173-99459195 CATGGCAATGACAGGGAAACTGG - Intergenic
1115099322 14:29678991-29679013 CCTGTTAATCAGAAGGCCACAGG + Intronic
1116537088 14:46045602-46045624 AATGGAAATCAAAAGGAAACAGG - Intergenic
1117746348 14:58873460-58873482 CATGGCAATCAGGAAAACAGTGG - Intergenic
1118163041 14:63310018-63310040 CATGGTAATTATAAGGACAGTGG - Intergenic
1119663869 14:76470364-76470386 CATAACAGTCAGAAGGTCACAGG + Intronic
1121134632 14:91485309-91485331 CATGGCACTTAGAAGGAGATGGG + Intronic
1121589195 14:95087861-95087883 CATTGCAATCACAGGAACACAGG + Exonic
1122064270 14:99160500-99160522 CATGGCAATCACAAGTAGAAAGG + Intergenic
1128240071 15:66095790-66095812 TGTGGCAATCAGAAGGACCCAGG - Intronic
1129461389 15:75701722-75701744 CATGGACATCTGAGGGACACTGG - Intronic
1129974012 15:79805855-79805877 TCTGGCAATCTGAAGGTCACTGG - Intergenic
1130789159 15:87133648-87133670 CATGGGAATCAGAGGAACAGAGG - Intergenic
1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG + Intergenic
1133200091 16:4198846-4198868 CATGGCCTTCGGAAGGACATTGG - Intronic
1135616095 16:23912416-23912438 CAGGGCAAGCATCAGGACACGGG - Intronic
1138470097 16:57227754-57227776 CATGGCAATATCAGGGACACTGG + Intronic
1142896126 17:2980343-2980365 CTTTGCAATCTGAGGGACACTGG - Exonic
1143760071 17:9095720-9095742 CATTTCAATCAGAAGCACAGAGG - Intronic
1144157391 17:12519414-12519436 CCATCCAATCAGAAGGACACAGG - Intergenic
1144482984 17:15642855-15642877 CAATGCACACAGAAGGACACGGG + Intronic
1144915698 17:18722176-18722198 CAATGCACACAGAAGGACACGGG - Intronic
1149016518 17:51914642-51914664 CATGGCAAAGAGAAGGAAATTGG + Intronic
1149185414 17:53991609-53991631 CATGGCACTCAGCAGGACCTGGG + Intergenic
1150126343 17:62637721-62637743 GAGGGTAATCAGAAGGTCACAGG - Intronic
1152460529 17:80439843-80439865 CATGGCAATCAGAGGGGAAGGGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155386123 18:25279622-25279644 CATGTCAATCAGAAGTGCTCTGG - Intronic
1157452517 18:47799372-47799394 CATCTCAATCAGCAGGACAGTGG + Intergenic
1158988153 18:62840391-62840413 CATGTGAATCTGAAGGACAAGGG - Intronic
1161030305 19:2054991-2055013 GATGGCTCTCAGAGGGACACAGG + Intergenic
1161627499 19:5335798-5335820 CGCGGGAATCAGAAGGAAACAGG + Intronic
925100146 2:1237462-1237484 CCTGTCAATCAGAAGCACACAGG + Intronic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
926074811 2:9933457-9933479 CAAGGCAAACAAAAGCACACAGG - Intronic
927143289 2:20144212-20144234 AATGGCAATCAGAGAGAAACTGG + Intergenic
929030079 2:37641799-37641821 CATGGAAAACAGATCGACACGGG - Intergenic
929952332 2:46423292-46423314 CTTGGCAACTAGATGGACACTGG + Intergenic
930686144 2:54310548-54310570 CATAGGAATGAGAAGGTCACAGG + Intergenic
931717033 2:65037429-65037451 GATGGCAATCAGGAGGTCAGCGG - Intergenic
932962431 2:76429519-76429541 AATGGCAATCAGATGTACAAAGG + Intergenic
933236134 2:79866562-79866584 GATGGCTCTAAGAAGGACACTGG - Intronic
934845388 2:97658815-97658837 CATGGCAAGCAGGACGGCACAGG + Intronic
936253379 2:110886681-110886703 CTTGGCATTCAGAAGGATAGGGG - Intronic
939370650 2:141295605-141295627 CATGAGATTCAGTAGGACACTGG + Intronic
940283766 2:152013518-152013540 CATGGGACTCACAAGGACACAGG - Intronic
941255821 2:163229979-163230001 CAAGGCCATCAGAAATACACTGG - Intergenic
941616006 2:167720387-167720409 CATGGCAAACATCTGGACACTGG + Intergenic
942770110 2:179506988-179507010 CATGTCAATGACAAGGACCCCGG - Intronic
946248808 2:218401042-218401064 CAGGGCAAACAGATGGCCACTGG + Intronic
1170219822 20:13930082-13930104 AATGGCAATCAGAAGGCCGGTGG - Intronic
1176510896 21:7746821-7746843 CATGCCAACCTGAAGGATACAGG - Intronic
1177915385 21:27082642-27082664 CATGGCCATCTGTAGGTCACAGG - Intergenic
1178645009 21:34377350-34377372 CATGCCAACCTGAAGGATACAGG - Intronic
1181153108 22:20899342-20899364 CAGGGCACTTAGAAGGACCCTGG + Intergenic
1182158889 22:28101948-28101970 GATGGCTATCAGCAGGAGACAGG + Intronic
1182347061 22:29673739-29673761 CACGGCCATCAGAGGGACAGGGG - Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183662234 22:39227987-39228009 CTGGGCCATCAGCAGGACACTGG + Intronic
1184033086 22:41906116-41906138 CATGGCAAACCCAAGCACACTGG - Exonic
949401312 3:3667762-3667784 CCTGGGACTCAGGAGGACACAGG - Intergenic
950285020 3:11737869-11737891 CATGGCAATAAGAAAACCACAGG - Intergenic
950965719 3:17144389-17144411 CATGGCAATGTGAAAGACTCTGG - Intergenic
952041053 3:29262444-29262466 CCTGGCAAAGAGAAGGACCCTGG - Intergenic
957322405 3:78649198-78649220 ATTTGCAATCACAAGGACACCGG + Intronic
957555229 3:81758353-81758375 CATGGCAAGCTGATGGGCACTGG + Intronic
959615054 3:108337834-108337856 GAAGGAAATTAGAAGGACACTGG - Intronic
959794890 3:110414313-110414335 CTTGGCACTCAGAAGGAAACAGG - Intergenic
966834383 3:184038076-184038098 GATGGCAATCAGAATGCCACTGG - Exonic
966843159 3:184105814-184105836 GATGGCAACCAGAAAGCCACTGG - Exonic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
973612332 4:52647942-52647964 AATGGAAATAAGAAGGGCACTGG + Intronic
973865149 4:55105451-55105473 GGAGGCAATCAGAAGGACATAGG - Intronic
975770148 4:77711689-77711711 CTTGGCAACCAGATGCACACTGG + Intergenic
975817049 4:78229103-78229125 CTTTGAAATCAGATGGACACTGG + Intronic
977087891 4:92628207-92628229 CATGGACACCAGAAGGAAACAGG - Intronic
978367486 4:107997464-107997486 CATGCCAAGCAGAAGCACACTGG - Intronic
983657988 4:170102019-170102041 CATGGCCATCACCAGGCCACTGG - Intergenic
985117637 4:186607219-186607241 TTTGGGAATGAGAAGGACACTGG - Intronic
987242414 5:16014143-16014165 CATGGGAATCTGAAGAACAGTGG + Intergenic
993086799 5:83373124-83373146 CATGGCAAGCAGAAGGCAAGTGG - Intergenic
993411857 5:87584009-87584031 CATGGGGAACAGATGGACACAGG + Intergenic
994274376 5:97817863-97817885 CCTGGCAAGAAGAAGGAAACAGG - Intergenic
995064957 5:107851205-107851227 CATGGCAATCAGAAGCAAATTGG + Intergenic
995751170 5:115454774-115454796 CGTGGCACTCAGAAGAACACTGG + Intergenic
995843016 5:116462618-116462640 CAAAGAAATCAGAAGGGCACTGG + Intronic
998563480 5:143194043-143194065 CAGTGAAATCAGCAGGACACTGG + Intronic
999333848 5:150698152-150698174 CATCCCAATCAGAAGCTCACAGG - Intronic
999828589 5:155297912-155297934 ACTGGCAATCAGCAGGACACAGG + Intergenic
1002826003 6:775021-775043 CCTGTAGATCAGAAGGACACAGG - Intergenic
1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG + Intergenic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1006975170 6:38093665-38093687 CATGGCTAGCAGAAGATCACTGG + Intronic
1007173788 6:39882856-39882878 CCTGGCCTTCAGAAGGCCACAGG + Intronic
1009378414 6:62999879-62999901 CCTGGCACTCAGGAGGAAACAGG + Intergenic
1010602544 6:77848391-77848413 CATGGGAAGCAGAAGGAAAGAGG + Intronic
1013168469 6:107615410-107615432 CTTGGAAATCAGAGGGACAAAGG + Intronic
1018053551 6:160032195-160032217 CGTGGCAATCACTAGGACATCGG - Intronic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019856836 7:3617647-3617669 CATGGAAGTCAGAAGGTCAAGGG + Intronic
1020161343 7:5774667-5774689 CATTGTAATCACAAGTACACAGG + Intronic
1021759144 7:23886293-23886315 TATGTCATTCAGGAGGACACTGG + Intergenic
1022952685 7:35353597-35353619 CATGTCAATCACAAGGGGACTGG - Intergenic
1022963621 7:35453669-35453691 CATGGACATCAGAAGCACAGAGG + Intergenic
1023227316 7:37984205-37984227 AGTGGGGATCAGAAGGACACAGG + Intronic
1023626336 7:42118717-42118739 CTTGGAAATCAGAAGGCCACTGG - Intronic
1024433628 7:49322066-49322088 CATGGCAAACATAAGCACCCAGG + Intergenic
1024747832 7:52428430-52428452 CATGGTAAGGAGAAGGACAGGGG - Intergenic
1027949596 7:84797583-84797605 AAGCACAATCAGAAGGACACGGG - Intergenic
1029846413 7:103416694-103416716 TATGGCAAGCAGATGGACAAGGG - Intronic
1032257817 7:130311229-130311251 CATGGCAGTCAGAAAAACAAGGG - Intronic
1035320233 7:158024335-158024357 CAAATCAATCAGAAGAACACAGG + Intronic
1035732981 8:1865595-1865617 CAGGGCCATCACCAGGACACGGG + Intronic
1036564349 8:9925520-9925542 CATGGAAATCAGAGGGCCAGGGG - Intergenic
1037487445 8:19361847-19361869 CTTTGTAATCAGAAGCACACAGG + Intronic
1040967649 8:53100628-53100650 CATGCCCAACAGATGGACACGGG + Intergenic
1042881687 8:73499548-73499570 TTTGGCAATCAGTAGGACAAGGG + Intronic
1044743669 8:95352230-95352252 CCTGGAAGTCAGAAGGACCCTGG - Intergenic
1045549806 8:103161528-103161550 AATGGCCATCAGTAGGAGACTGG - Intronic
1047514229 8:125539571-125539593 CCTGGCCAACAGAAGGACACGGG + Intergenic
1048173090 8:132127176-132127198 GCTGGCAATCTGAAGGACAAAGG - Exonic
1048359458 8:133684608-133684630 CTTGGCCCTCAGAAAGACACTGG - Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1057854992 9:98594942-98594964 CTTGGCAAACAGGAGGAAACAGG + Intronic
1059913222 9:119069743-119069765 TATGGCAATCCAAAGGACTCAGG - Intergenic
1188193689 X:27203936-27203958 TATGGCAATATGAGGGACACTGG + Intergenic
1191110612 X:56800814-56800836 TAAGGAAATCAGAAGGACCCGGG + Intergenic
1191169839 X:57432361-57432383 CACGGCAAGAACAAGGACACAGG + Intronic
1191754660 X:64580927-64580949 CATAGCCAGCAGCAGGACACTGG - Intergenic
1193037554 X:76969130-76969152 CATGTTCTTCAGAAGGACACAGG + Intergenic
1196061919 X:111417660-111417682 CATGGGAAACAGAATGACCCTGG + Intergenic
1196345663 X:114654487-114654509 TATGGCAATTGAAAGGACACTGG - Intronic
1197150687 X:123217184-123217206 CAGGGCCTTCAGAAGGTCACTGG + Intronic
1197825979 X:130590810-130590832 CATGGCAAAGGGAAAGACACAGG - Intergenic
1198084026 X:133265910-133265932 CATGGCCATCAAAAGGCCCCTGG + Intergenic
1199382348 X:147184524-147184546 CATGGGACTCAGGAGAACACAGG - Intergenic