ID: 917329633

View in Genome Browser
Species Human (GRCh38)
Location 1:173868327-173868349
Sequence CCCCACCCCCTCCCACGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 455}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917329633_917329638 -8 Left 917329633 1:173868327-173868349 CCGCTCCGTGGGAGGGGGTGGGG 0: 1
1: 0
2: 2
3: 42
4: 455
Right 917329638 1:173868342-173868364 GGGTGGGGGATTTCACTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 140
917329633_917329642 14 Left 917329633 1:173868327-173868349 CCGCTCCGTGGGAGGGGGTGGGG 0: 1
1: 0
2: 2
3: 42
4: 455
Right 917329642 1:173868364-173868386 GACGGTGTTCCGGCCCATTCCGG 0: 1
1: 0
2: 0
3: 1
4: 28
917329633_917329637 -9 Left 917329633 1:173868327-173868349 CCGCTCCGTGGGAGGGGGTGGGG 0: 1
1: 0
2: 2
3: 42
4: 455
Right 917329637 1:173868341-173868363 GGGGTGGGGGATTTCACTTCCGG 0: 1
1: 0
2: 1
3: 17
4: 155
917329633_917329640 4 Left 917329633 1:173868327-173868349 CCGCTCCGTGGGAGGGGGTGGGG 0: 1
1: 0
2: 2
3: 42
4: 455
Right 917329640 1:173868354-173868376 TCACTTCCGGGACGGTGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
917329633_917329639 -4 Left 917329633 1:173868327-173868349 CCGCTCCGTGGGAGGGGGTGGGG 0: 1
1: 0
2: 2
3: 42
4: 455
Right 917329639 1:173868346-173868368 GGGGGATTTCACTTCCGGGACGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917329633 Original CRISPR CCCCACCCCCTCCCACGGAG CGG (reversed) Intronic
900089049 1:911356-911378 CCCCACCCCCTGCCGCGGGCTGG - Intergenic
900106695 1:984394-984416 CCCCCCGCCCTCCCCAGGAGGGG - Intergenic
900174538 1:1285969-1285991 CACCACCACCACCCAAGGAGGGG + Exonic
900559808 1:3298501-3298523 CCCCACCCCCCGGCCCGGAGAGG + Intronic
900673538 1:3870245-3870267 CCCCTCCCCCTCCCATGGTGTGG + Intronic
900792161 1:4687853-4687875 CCCCAGCACCTCCCACACAGAGG - Intronic
901086789 1:6615385-6615407 CCCCAGGGCCGCCCACGGAGCGG - Intronic
902622084 1:17656471-17656493 CCCCATGCCCTCCTAGGGAGAGG - Intronic
902932460 1:19741055-19741077 GCCCACCCCCTGCCAATGAGTGG + Intronic
903186897 1:21634051-21634073 CCCCCCCCCCCCCCCGGGAGGGG - Intronic
904256318 1:29257270-29257292 CCCCATCCCCACCCAGGAAGGGG - Intronic
904608919 1:31714703-31714725 CCCCACCACCTCCCACCTCGGGG - Intergenic
904733305 1:32611503-32611525 CCCCACCGCCCCCGTCGGAGAGG + Intronic
904828779 1:33293545-33293567 CCCCAGCCCCTCTCACTGACTGG - Intronic
905233517 1:36530139-36530161 CCCCACCCCCACCCCCTGATGGG - Intergenic
905292455 1:36931731-36931753 TCCAACCCACTCCCACAGAGCGG + Intronic
905370728 1:37481428-37481450 CCCCAGCCCCTCCCTTGGCGTGG - Intronic
905519797 1:38589125-38589147 CCCCAATCCCACCCACTGAGAGG + Intergenic
905647043 1:39632276-39632298 CCCCACCCCGGCACACTGAGGGG + Intronic
906790547 1:48655189-48655211 CCCCACACCCACCCTAGGAGAGG - Intronic
907663873 1:56417352-56417374 CCCTGCCCCCTCCCACTCAGAGG + Intergenic
908911012 1:69072283-69072305 CCCCACCCCCAGCCAAGGAAGGG - Intergenic
909543064 1:76812641-76812663 CCGCAGCCCCTCCCATGGACTGG + Intergenic
912878962 1:113390415-113390437 CCCCGCCCCCTCCCGCCGCGCGG - Intergenic
913972257 1:143424032-143424054 CCCCACCCCATCACACAGGGAGG + Intergenic
914066639 1:144249645-144249667 CCCCACCCCATCACACAGGGAGG + Intergenic
914112514 1:144716709-144716731 CCCCACCCCATCACACAGGGAGG - Intergenic
915058776 1:153162156-153162178 CCCCACCTCCTCCCTCGGATAGG + Intergenic
915217894 1:154352213-154352235 ACCCACCTCCACCCAGGGAGAGG + Intergenic
916605928 1:166342957-166342979 CCCCACCCCCCACCCCCGAGCGG - Intergenic
916825482 1:168438131-168438153 CCCCAGCCCCTAGCACTGAGAGG - Intergenic
916928585 1:169550284-169550306 CCCCACCCCCCCCCCCCGACAGG + Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
917968594 1:180193688-180193710 CCCCACCCCCTCCCACCCACTGG - Intronic
918243662 1:182641056-182641078 CCACACCCCCTCCCAAGTGGCGG + Intergenic
919712199 1:200739329-200739351 CCTCTCCCCTTCCCTCGGAGCGG - Intergenic
920491022 1:206415485-206415507 CCCCCCCTCCTCCCACCGAGGGG + Intronic
920931618 1:210394170-210394192 TTCCACCTCCTCCCATGGAGAGG + Intronic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
921748874 1:218769475-218769497 CCCCACCCCCACACACAAAGGGG + Intergenic
922474802 1:225899436-225899458 CCCCACCCCCACCCACCCACAGG + Intronic
922558257 1:226549142-226549164 CCCCACGCCCTCCCGCGGCGGGG - Intronic
922566838 1:226606643-226606665 CCCCACCCCCTGCACCCGAGCGG + Exonic
922803755 1:228375510-228375532 CCCCAGCCCCTCGCCAGGAGAGG + Intronic
923094964 1:230767796-230767818 CCCCAGCCACACCCAAGGAGGGG + Intronic
923418697 1:233790945-233790967 CCCCACCCCCACCCCAGGAAAGG + Intergenic
924574697 1:245269227-245269249 CCCCTCCTCCTCCCACCGAACGG + Intronic
924787257 1:247210375-247210397 CCACAGCTCCTCCCACGCAGTGG + Intergenic
1063666046 10:8061359-8061381 CCCTACCCCCTCCCACAGCCTGG + Intronic
1064316928 10:14266155-14266177 CCCCACCCCCTCCCACCCCCAGG - Intronic
1065529361 10:26653140-26653162 CCCCACCCCCTCCGGTGCAGAGG + Intergenic
1065917356 10:30364925-30364947 CCCCACCCCCACCCCCACAGAGG + Intronic
1066440247 10:35431484-35431506 CCCCACCACCACACACAGAGTGG - Intronic
1067214682 10:44292824-44292846 CCCCACCCCCTCCCCCCAACAGG + Exonic
1067473772 10:46553485-46553507 CCCACCACCCTCCCAGGGAGGGG + Intronic
1067685964 10:48466223-48466245 CCCCACCCCGAACTACGGAGGGG - Intronic
1069372699 10:67764386-67764408 CCCCGCCGCTTCGCACGGAGCGG + Intergenic
1069571077 10:69494848-69494870 CCCCGCCCCTTCCCACTGTGGGG + Intronic
1069658036 10:70104959-70104981 CCCGACCCCCTGCCACAGGGTGG - Intronic
1069868974 10:71521627-71521649 CCCTACCCTCTCCCACGGGATGG - Intronic
1069916447 10:71789978-71790000 CCCCAGACCCTCCCGAGGAGCGG + Intronic
1070288579 10:75100445-75100467 CCCCAGTCCCTCCCAAGGAGGGG + Intronic
1070666387 10:78348049-78348071 CCACACTCCCTCCCAAGTAGTGG + Intergenic
1070725920 10:78790395-78790417 CCTCACCCCCTCCCGCTGACTGG - Intergenic
1072205869 10:93204917-93204939 CTCCACCTCCTCCCACTGTGAGG + Intergenic
1073146765 10:101286226-101286248 CCCCACCCCCACCCCCAGACTGG + Intergenic
1073329512 10:102661274-102661296 CCCCACCCACTCCCTCGCGGTGG - Intergenic
1073636215 10:105201298-105201320 CCCCACCCCACCCCACAGACAGG - Intronic
1073872174 10:107878095-107878117 GCCTACCCCCTCCCACCGATAGG - Intergenic
1074441033 10:113477615-113477637 CCCAACCCCCTACCACTTAGGGG - Intergenic
1075129352 10:119725614-119725636 CCACACCCGCTCTCCCGGAGCGG - Intergenic
1076177227 10:128377368-128377390 CCCCACGGCCTCCCACAGGGTGG + Intergenic
1076338896 10:129729071-129729093 CCCCACCCCTCCCCACCCAGTGG - Intronic
1076364559 10:129913737-129913759 TGCCACCCCCTCCCACAGAGGGG - Intronic
1076366846 10:129926749-129926771 GCACACCCCCTCCAGCGGAGGGG - Intronic
1076710644 10:132331995-132332017 CCCGACCCCCTGCCGCGCAGGGG + Intergenic
1076853626 10:133104840-133104862 CCCCAGGCCCAGCCACGGAGAGG - Intronic
1076872382 10:133200328-133200350 CCCCACCTCCGCCCACTGGGAGG - Intronic
1076890093 10:133279153-133279175 CTCGACCCACTCCCACGGAGGGG + Exonic
1076992504 11:282812-282834 CCCCAGCTCTTCCCACGGAGCGG + Intronic
1077307600 11:1875000-1875022 CCCCACCCCATCACACAGGGAGG - Intronic
1077315569 11:1918018-1918040 CCCCATCCTCTCCCATGGTGGGG - Intergenic
1078514365 11:12009399-12009421 GCCCACCCCGCCCCGCGGAGGGG + Intronic
1078768721 11:14326649-14326671 CCCCTCCCCCTCCCAAATAGAGG - Intronic
1079112407 11:17612278-17612300 CCCCACCCACCCGCACGGCGAGG - Exonic
1080388910 11:31826346-31826368 CGCCGCCCCCTCCCAAGGCGTGG + Intronic
1081774406 11:45667436-45667458 CCCCACCCCCACCCAGGGAGTGG + Intergenic
1082811689 11:57482586-57482608 CGCCACCCCGTCCCGCGGCGGGG + Intergenic
1082825383 11:57574033-57574055 CCCCACCACATCCCACCGGGTGG + Intergenic
1083340412 11:61955459-61955481 CCCCCTCCCCTCCCGCGCAGGGG - Intronic
1083625611 11:64070577-64070599 CCCTCCCCTCTCCCCCGGAGGGG + Intronic
1084758358 11:71252689-71252711 CCCCACCCCCGCCCACGCCGCGG + Intergenic
1084907309 11:72358032-72358054 TCCCACACTCTCCCAAGGAGAGG + Intronic
1085044381 11:73344600-73344622 CCCCACGCCGTCTCACTGAGGGG + Intronic
1085266443 11:75240680-75240702 CCACCCCGCCTCCCACGGCGAGG + Intergenic
1085507220 11:77067307-77067329 CCCCACCCCCACCCCCGGCGAGG + Intronic
1086107111 11:83157800-83157822 CCCCACTCCCTCCCCCCCAGAGG - Intronic
1086158081 11:83690669-83690691 CCCCACCCCCACCCACAGCATGG - Intronic
1086254792 11:84862812-84862834 CCCCACCCCCCCCCCCCGACAGG - Intronic
1088418235 11:109613255-109613277 CCCCACCCCCTCATCCAGAGAGG - Intergenic
1089216601 11:116837908-116837930 GCCCACACACTCCCATGGAGGGG - Exonic
1089557077 11:119320689-119320711 CCCCACCCCCTGGCAGGGAAGGG - Intronic
1089744796 11:120609193-120609215 CCCCAGCCCCTCCCACCTCGGGG + Intronic
1090950538 11:131469169-131469191 CCCCACCCACTGCCACTGTGAGG + Intronic
1091219298 11:133920710-133920732 CCCCGCCCCTGCCCACCGAGGGG - Exonic
1091360976 11:134978326-134978348 CCCCACACCCTGCCACTGATGGG + Intergenic
1091402648 12:189988-190010 CCTCACCACCTCCAACAGAGGGG + Intergenic
1091813425 12:3418608-3418630 CCCCGCCTCCACACACGGAGTGG - Intronic
1091850375 12:3692502-3692524 CCCCACCCCCACCCCCAGCGTGG - Intronic
1093467642 12:19466343-19466365 TCCCACCTCATCCCCCGGAGTGG - Intronic
1094253991 12:28400350-28400372 CCCCACCCCCACCCTAGGACTGG + Intronic
1095614613 12:44173187-44173209 CACCTCGCCCTCCCACGTAGTGG + Intronic
1095803862 12:46296808-46296830 CCCCAGCCCCTCCAGAGGAGTGG - Intergenic
1096073649 12:48789170-48789192 CCCCTCCCCCTCCCCAGAAGTGG + Intergenic
1096105496 12:48995050-48995072 CCCCCTCCCCTCACACAGAGCGG + Intergenic
1096230695 12:49895326-49895348 CCCCATCCCCCCCAATGGAGTGG + Intronic
1096336989 12:50764204-50764226 CCCCACCCCCTCACGCAGCGGGG - Intronic
1096551863 12:52378303-52378325 CTCCACCCTCTCCCGCGGCGGGG - Exonic
1096977584 12:55708129-55708151 CCCCATCCCCACCCCGGGAGTGG + Intronic
1097196050 12:57243020-57243042 CCCCACCCCCTCCCAGGCCCAGG + Intergenic
1097449559 12:59719848-59719870 CTCCATGGCCTCCCACGGAGTGG + Intronic
1097959053 12:65514695-65514717 CTCCACCCCCACCCAGGCAGGGG + Intergenic
1100288196 12:93187593-93187615 CCCAACCCTCTCCCACCGTGGGG - Intergenic
1101875972 12:108597258-108597280 CCCCACCCCCACCCAGAGACTGG + Intronic
1102544034 12:113641826-113641848 CCCCACCCCCTCCTCCCTAGCGG + Intergenic
1103703645 12:122860287-122860309 CTCCACCCCCTACCACAGGGAGG + Intronic
1103928694 12:124437723-124437745 CCCCACCCCCACCCACCCTGGGG + Intronic
1104548382 12:129732821-129732843 CCCCATCCCCTCCCTGGGTGTGG - Intronic
1104635484 12:130435804-130435826 CCCCACCCCGTCCTCCTGAGTGG - Intronic
1105322663 13:19343888-19343910 CCCCACCCCCTCCCCCCGACAGG - Intergenic
1105459057 13:20566985-20567007 CGCCACTCCCTTCCACTGAGGGG + Intergenic
1105541714 13:21321600-21321622 CCCCACCCCCTCCTAGGGGCTGG - Intergenic
1107371536 13:39755426-39755448 CCCCACCCCCACCCCAGTAGAGG - Intronic
1108176949 13:47801901-47801923 CCCCACCCAAACTCACGGAGGGG + Intergenic
1108572818 13:51767769-51767791 CCCCCCCCCCGCCCCAGGAGAGG - Intergenic
1110064561 13:71087515-71087537 CCCCCCCCCCGCCCGCGCAGTGG + Intergenic
1111937674 13:94573225-94573247 CCCCACCCTCTCCCATAGATAGG - Intergenic
1113420871 13:110170590-110170612 CCCCAGGCCATGCCACGGAGGGG - Exonic
1113834977 13:113322755-113322777 CCCCACCCCCTCAGAGAGAGCGG - Exonic
1113834995 13:113322807-113322829 CCCCACCCCCTCAGAGAGAGCGG - Exonic
1113849372 13:113409269-113409291 CTCCACCCCCTGCCACAGATGGG - Intergenic
1114073198 14:19131770-19131792 CACCTCCCCCTGCCACAGAGGGG - Intergenic
1114089068 14:19268213-19268235 CACCTCCCCCTGCCACAGAGGGG + Intergenic
1114532508 14:23404617-23404639 CCCCACCACGTCACAGGGAGGGG + Intronic
1115343653 14:32318900-32318922 CCCCACCCCCACCCAAAGAGGGG - Intergenic
1118083897 14:62393773-62393795 CCCCACCCCCTCTAACAGAAGGG - Intergenic
1118752930 14:68819609-68819631 CCCCGCCCACTCCCAGGGAGGGG - Intergenic
1121507375 14:94487076-94487098 CCCCACCCCCGCCCACTTGGTGG - Intergenic
1121843272 14:97152027-97152049 CAGCACCCCCTACCAGGGAGGGG - Intergenic
1122583039 14:102783538-102783560 CCAAACCCCCTCCCACTAAGGGG - Intronic
1122772656 14:104104217-104104239 CCCCATGCCCTCCCAAGGAGAGG - Intronic
1123056983 14:105575394-105575416 CCCCGCCCCCTCCCCCAGCGTGG + Intergenic
1123081227 14:105696391-105696413 CCCCGCCCCCTCCCCCAGCGTGG - Intergenic
1124291658 15:28457293-28457315 ACCCACCCCCTCCCGCCGGGTGG + Intergenic
1124377331 15:29136387-29136409 CACCACCGCCTCGTACGGAGGGG + Exonic
1125685886 15:41563026-41563048 CCCCCACCCCTCCCAAGGAAAGG + Intronic
1125686161 15:41564576-41564598 CCCCATCCCCTCAAAGGGAGGGG - Intronic
1126995247 15:54435570-54435592 CCCCACCCCCACCCACCGAGAGG - Intronic
1127810828 15:62563905-62563927 CCCCACCCCCTTCCATCCAGTGG - Intronic
1128801715 15:70501281-70501303 ACCCACCCCCTCACCCGGACTGG + Intergenic
1129356488 15:74995563-74995585 CCCCGCCCCCAGCCCCGGAGCGG + Intronic
1129955603 15:79634132-79634154 CCCCACCCCCTGCCCCGCTGGGG + Intergenic
1129986428 15:79923323-79923345 CTCCACTCCCTCCTACGGCGCGG - Intronic
1130285229 15:82549253-82549275 ACCCACCATCTCCCACGCAGTGG - Intronic
1130293198 15:82622860-82622882 CCCCACCCTCCTCCACGGACGGG + Intronic
1130312924 15:82770717-82770739 CCCCACCCCCTACAACTTAGTGG - Intronic
1130728032 15:86461192-86461214 CCCCACACCCTACCACCGATGGG - Intronic
1131367020 15:91850248-91850270 CCCCCCCCCCCCCCACGCTGTGG - Intergenic
1132549888 16:549999-550021 CTCCAGCCCCGCCCAGGGAGGGG - Intronic
1132587072 16:710241-710263 CCCCAGCTCCACCCAGGGAGGGG + Intronic
1132715609 16:1288632-1288654 CCCCACTCCCACCCGCCGAGGGG + Intergenic
1132741071 16:1413802-1413824 CCCCACCTCCGCCCAGGCAGCGG + Intronic
1132817323 16:1837332-1837354 CCCCACCCCCACCCACCCTGTGG - Intronic
1132847596 16:2007587-2007609 CGCCCCCACCTCCCACGGAGGGG + Intronic
1132936779 16:2485261-2485283 CCCCACCCCCAACCGCGGGGAGG + Intronic
1133222358 16:4324177-4324199 CCCCTCCCCCTCCCAAGACGGGG - Intronic
1133225840 16:4339994-4340016 CCCCTGCCCCTCCCACGGGGTGG - Intronic
1133768612 16:8854861-8854883 TCCAACCCCATCCCAGGGAGTGG - Exonic
1134051449 16:11140603-11140625 CCCCACCATGTCCCACAGAGTGG + Intronic
1134257869 16:12626498-12626520 CCCCACCCCCCCCCAAAAAGGGG + Intergenic
1135795928 16:25442350-25442372 CCCCCCTCCCTCCCACCAAGTGG - Intergenic
1135881644 16:26263442-26263464 CCTCACCCCATCCCTTGGAGAGG + Intergenic
1136523690 16:30814339-30814361 CCCCGGCCCCGCCCAGGGAGAGG - Intergenic
1137753983 16:50887055-50887077 CCCCACCACCTCCCCCAGGGAGG - Intergenic
1137785257 16:51133232-51133254 CCCCACCCCCACCCCCGGTCTGG - Intergenic
1138510798 16:57507554-57507576 TCCCTCCCCATCCCAGGGAGGGG - Intergenic
1138567803 16:57846204-57846226 GCCCAGCCCCACCCAGGGAGAGG - Intronic
1138762153 16:59557832-59557854 CCCCACCCCCTCCTACAGAAAGG - Intergenic
1139611308 16:68060993-68061015 CCAGACCCCATCCCATGGAGAGG + Intronic
1140384183 16:74519713-74519735 CCCCACCCACTCCCCAGAAGCGG + Intronic
1141132471 16:81445217-81445239 CCCAGCCCCCTCCCCCGGCGCGG + Exonic
1141555444 16:84833998-84834020 CCCTGCTGCCTCCCACGGAGTGG - Intronic
1141598927 16:85113736-85113758 CCCCACAACCTCCCACGGGATGG + Intergenic
1141685435 16:85567188-85567210 CCCCATCCCCTCCCCCGCAACGG - Intergenic
1142758778 17:2030937-2030959 CCCCACCGCCGCCCACACAGTGG + Intronic
1142799538 17:2336971-2336993 GCGCCCCGCCTCCCACGGAGCGG + Exonic
1143099543 17:4497948-4497970 CCCCGCCCCGTCCCACCAAGGGG + Intergenic
1143387925 17:6543152-6543174 CAGCAGCCCCTCCCACTGAGCGG - Intronic
1143917581 17:10305196-10305218 ACCCTCCCCCTCCCATGGTGAGG - Intronic
1144733120 17:17540128-17540150 CCCCATCCCCACCCACGGCCAGG - Intronic
1144787222 17:17838539-17838561 TCCCACCCCCTCCCTGGGAAGGG - Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1146056640 17:29584670-29584692 CCCCACCCCCACCCCAGGACAGG - Intronic
1147190240 17:38734155-38734177 CCCCACCCCCACCCCTTGAGAGG - Exonic
1147250828 17:39151657-39151679 CCCCACCCCCACCGACCCAGCGG - Intronic
1147376672 17:40026816-40026838 CCCCACCGCCACCCTTGGAGTGG + Intronic
1147382556 17:40063904-40063926 CCCCACCCCCACCCCTGGAACGG - Intronic
1147393548 17:40123580-40123602 CCCCTCCCCCTCCCCCTGAGAGG - Intronic
1147819503 17:43233251-43233273 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820595 17:43239399-43239421 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147820807 17:43240664-43240686 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147821617 17:43245133-43245155 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147822711 17:43251291-43251313 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147825228 17:43266087-43266109 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826069 17:43270822-43270844 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147826348 17:43272599-43272621 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147827236 17:43277451-43277473 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147828348 17:43283607-43283629 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147829458 17:43289771-43289793 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147830549 17:43295906-43295928 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1147831233 17:43299494-43299516 CCCCACCCCCTCCCAAGTTCTGG - Intergenic
1148092259 17:45029724-45029746 CCTGACCACCTCCCACTGAGAGG + Intronic
1148560202 17:48601792-48601814 CCCCACCCCCACCCAGGAACGGG + Intronic
1148850142 17:50550636-50550658 CCCCAACCCCTCCCACAGCCAGG - Intronic
1150005059 17:61464032-61464054 CCCCACCCCCTCTCCAGGAATGG - Intronic
1150128445 17:62653369-62653391 CCCCGCCCCCACCCCCGGGGCGG + Intronic
1150435992 17:65154635-65154657 CCTCACCCCCACACACAGAGAGG - Intronic
1151635600 17:75345703-75345725 CCCCACCCCCACCCCCAGGGTGG + Intronic
1152186841 17:78862464-78862486 CTGCTCCCCCTCCCAGGGAGAGG + Intronic
1152234134 17:79129848-79129870 CCCCAGCCCATGCCAGGGAGGGG + Intronic
1152359780 17:79826519-79826541 CCCCACCCCCTGCCATGCACAGG + Intergenic
1152442463 17:80317369-80317391 CCCCATCCCTGCCCACAGAGAGG - Intronic
1152759752 17:82101651-82101673 CCCCACCCCGCCCCACTAAGGGG - Exonic
1152801425 17:82332634-82332656 CCCCACCCAGGCCCACGGTGTGG + Intronic
1153282130 18:3424660-3424682 CCCCACCCCCAGCCTCGGGGAGG + Intronic
1153842903 18:9023002-9023024 CCCCGCCCCCACCCACTGTGAGG + Intergenic
1156471201 18:37378220-37378242 CCCCACGCCCACCCCAGGAGCGG + Intronic
1157452657 18:47799999-47800021 CCCCACCCCACCCCACTTAGAGG + Intergenic
1159084202 18:63769872-63769894 CCCCTTCCCCTCCCAGGTAGAGG - Intronic
1160248663 18:77181948-77181970 CCTGAGCCTCTCCCACGGAGGGG - Intergenic
1160583740 18:79901534-79901556 ACCCGCTCTCTCCCACGGAGGGG + Intergenic
1160871835 19:1281293-1281315 CCCCACCCCCCCCCACCCAGAGG - Intergenic
1161015097 19:1979449-1979471 CCCCACCCCCACCCCCGCCGAGG + Intronic
1161253956 19:3295885-3295907 CACCACCCCCTCCCAAGGCCAGG + Intronic
1161377891 19:3949578-3949600 CCCCAACCCCTCACAGGGAAAGG - Intergenic
1161628631 19:5340374-5340396 CCCAGCCCCCTCCCACGCCGCGG + Intronic
1161681302 19:5681096-5681118 GCCCACCTCCTCCCGGGGAGGGG - Exonic
1161849333 19:6730703-6730725 GCCCACCCCCGCCCCCAGAGCGG + Intronic
1162029465 19:7911173-7911195 CCCCACCCCCTCCCCCGCTGGGG - Intronic
1162145599 19:8610916-8610938 CCCAGCCCCCTCCCACGCGGCGG - Intergenic
1162316236 19:9939827-9939849 CCCCACCCCCCACCATGGTGGGG - Intergenic
1162412948 19:10517457-10517479 CTCCAGCCCCGCCCCCGGAGCGG - Intronic
1162746927 19:12804034-12804056 CCCAATCCCCTCCCCCAGAGAGG - Intronic
1162798240 19:13097660-13097682 CCCCGGCCCCTCCCCCGCAGAGG + Intronic
1162841996 19:13363576-13363598 CCCCACTCCTCCCCACGGGGAGG - Intronic
1163701880 19:18790216-18790238 CCCCACCCCCCGCCCCGGGGCGG + Intronic
1163823970 19:19512614-19512636 CCCCACCCCCTCTTCCCGAGAGG + Intronic
1164562214 19:29300109-29300131 CCCCAGCCCCCGCCAAGGAGTGG - Intergenic
1164684682 19:30158957-30158979 CCCTACTCCCACCCAGGGAGGGG - Intergenic
1164912627 19:32025264-32025286 CCCCACCCTCTCACCCTGAGTGG - Intergenic
1165829566 19:38723809-38723831 TCCCCCCACCTCCCACGGAGAGG + Intronic
1165872245 19:38981178-38981200 ACACACCCCCTCCCACCCAGGGG + Intergenic
1165923793 19:39314788-39314810 GCCCACCGCCTCCCACGGCAGGG + Exonic
1166352074 19:42203989-42204011 CCCCCCACCCTCCCAGGGACAGG - Intronic
1166379664 19:42349389-42349411 CCCCACCCCCTCCTAAGAAGAGG - Intronic
1166530453 19:43539985-43540007 CCCCACCCCCACCCCCTGACAGG - Intergenic
1166704878 19:44903219-44903241 CACCTCCCCCTGCCACAGAGGGG + Exonic
1166827121 19:45616554-45616576 CCCCTCCCCCTCCCCCAGACGGG - Exonic
1166998295 19:46730277-46730299 GCCCAGTCCCTCCCAGGGAGAGG + Intronic
1167596986 19:50432986-50433008 CCCCATCCCCACACAGGGAGGGG - Intronic
1168663242 19:58183580-58183602 ACCGACCCCATCCCACAGAGCGG - Intronic
1168707037 19:58476231-58476253 CCCCAAGCCCTCCCACGGGGTGG - Exonic
1168713304 19:58513711-58513733 CCCCACCACCACCCCAGGAGAGG + Exonic
925008883 2:467420-467442 CACCACCCCCACCCATGCAGGGG - Intergenic
925065553 2:926998-927020 CCCCACACCCTCACAAGGATGGG + Intergenic
925984755 2:9206769-9206791 CCCCGACGCCTCCCGCGGAGAGG - Exonic
926274976 2:11396792-11396814 CCCCGCCCACTCCCACCGACGGG + Intergenic
926929984 2:18027536-18027558 CCCCACCCCCTCCCGCCGACAGG + Intronic
927440421 2:23112308-23112330 CCCCAACCCCACCCCCTGAGAGG + Intergenic
929611758 2:43275970-43275992 CCCCACCCTCTTCCACCAAGCGG - Intronic
929878131 2:45814045-45814067 CCCCTCCCCCTCCCGCACAGAGG + Intronic
930320868 2:49853294-49853316 CCCCTCTCCCTGCCACGGTGTGG + Intergenic
931434996 2:62238353-62238375 CCCCACCCCCGCCCAGGGTTGGG + Intergenic
931517848 2:63059990-63060012 CCCCACCCCCACCCCCGGGCCGG + Intergenic
932699911 2:73985222-73985244 CCCCTCCCCCTCCCCCGGGCCGG - Intergenic
933743473 2:85553119-85553141 CCCCATCCCCTACCAAGAAGGGG + Intronic
933760518 2:85668847-85668869 CCCCAGCCCCTACCCTGGAGGGG - Intergenic
933937631 2:87219181-87219203 CCCCAACTCTTCCCAAGGAGAGG - Intergenic
934176950 2:89584969-89584991 CCCCACCCCATCACACAGGGAGG + Intergenic
934554301 2:95279155-95279177 CCCCACCCCATCCCACCCTGCGG - Intronic
934775069 2:96932173-96932195 CCCCACCCCAGCCCACACAGAGG + Intronic
935581294 2:104758116-104758138 CCCCACCCCACCCCACCCAGGGG + Intergenic
935954581 2:108363039-108363061 CCCAAACCCCACCCACAGAGGGG - Intergenic
936026163 2:109032578-109032600 CCCCACCCCACCCCATGGGGAGG - Intergenic
936355508 2:111746592-111746614 CCCCAACTCTTCCCAAGGAGAGG + Intergenic
937312070 2:120908658-120908680 CTCCAGCCCCTCCCACCGATGGG + Intronic
937470045 2:122166823-122166845 ACTCACCCCCTCCCCCGAAGTGG + Intergenic
938540286 2:132279623-132279645 CCCCACCCCCTCACGGGGATAGG + Intergenic
939164710 2:138627848-138627870 CCCCACACACTTCCACTGAGAGG + Intergenic
940869093 2:158844852-158844874 CCCCACCCCATCCCACACACAGG + Intronic
941372225 2:164679774-164679796 CCCCGCCCCCACCCCCCGAGAGG - Intronic
942047638 2:172109054-172109076 CCCCACCCCCGCCCCCTGACAGG - Intergenic
942449321 2:176099269-176099291 CCCCAATCACTCCCACAGAGAGG - Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
947418558 2:229921943-229921965 CCCCACCCCCCCCAGCGGCGCGG + Exonic
948131120 2:235601260-235601282 CCCCACCCCCAAGCACAGAGAGG - Intronic
948754029 2:240148920-240148942 CCCCACTCCCACCCAGGGACGGG - Intergenic
948973427 2:241447478-241447500 CCCCACCACACCCCACGGGGCGG + Intronic
949055228 2:241924482-241924504 CCCCAGCCCTTCCCACAGTGAGG - Intergenic
1169264725 20:4160930-4160952 CCCCACCCCCTCCCCGGGGCTGG + Intronic
1169338985 20:4781680-4781702 CACCACCCCCACCCCGGGAGGGG - Exonic
1169508831 20:6242453-6242475 CCCCACCCCTTCCCTGGGACAGG - Intergenic
1169793921 20:9441318-9441340 CCCCACCCCAATCCATGGAGAGG - Intronic
1169951686 20:11051329-11051351 CCCCACTCACTCCCATGGGGTGG - Intergenic
1171424882 20:25043063-25043085 CCCCTCCCCCTGCCAGGGACAGG + Intronic
1171869212 20:30512627-30512649 CCCCACCCCCTCACGGGGATAGG + Intergenic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1173340821 20:42151305-42151327 CCCCACCCCCACCCCCTGACAGG + Intronic
1174103295 20:48143761-48143783 CACCACCCCCTCCCACCGGCAGG - Intergenic
1174416796 20:50372858-50372880 CCCCTCACCCTCCCAGGGAAGGG + Intergenic
1175720329 20:61281743-61281765 CGCCACCTCCTCCCCTGGAGGGG + Intronic
1175829387 20:61953700-61953722 CCCGTCCCCCTCCCATGGGGTGG + Intronic
1175839562 20:62018563-62018585 CCCCACCCCGCCCCACAGATGGG + Intronic
1176072573 20:63234763-63234785 CCCGACCCCCACTCACGGCGGGG - Intergenic
1176161886 20:63652590-63652612 CCCCTCCACCTCCCGCGGGGCGG - Intronic
1176215158 20:63944452-63944474 CCCCATCCCGCCCCAGGGAGCGG - Exonic
1176223253 20:63979799-63979821 GCCCACCCCCACGCACAGAGGGG - Intronic
1176311876 21:5154867-5154889 GCCCAACCCCTCCCAAGGCGGGG + Intergenic
1176905432 21:14494544-14494566 CCCCACCCCCTGACAAGCAGTGG - Intronic
1177043783 21:16145457-16145479 CCTCAGCCCCTCCCGCGCAGTGG - Intergenic
1179615989 21:42583760-42583782 CTCCACCACCTCCCCAGGAGGGG - Intergenic
1179845172 21:44107165-44107187 GCCCAACCCCTCCCAAGGCGGGG - Intergenic
1179873555 21:44255963-44255985 CCCCACCCCCTCCCCTAGACCGG - Intronic
1180491639 22:15854123-15854145 CACCTCCCCCTGCCACAGAGGGG - Intergenic
1181334329 22:22117169-22117191 ACCCACTCCCTCCCACCGGGTGG + Intergenic
1182532301 22:30969622-30969644 CGCCGCCGCCTCCCCCGGAGCGG - Intergenic
1183018069 22:35006286-35006308 CCCCACCCCCACCCACTGTTGGG - Intergenic
1183370052 22:37427193-37427215 CCCCACCCCCACTGACGGAGGGG + Intronic
1183698469 22:39436676-39436698 CCCCGCCCCCTCCCCGGGACTGG + Intronic
1183702438 22:39457825-39457847 CCCGACCCCCTCCCACGGCCGGG + Intronic
1184256239 22:43288677-43288699 CCGCATCACCTCCCAAGGAGCGG + Intronic
1184565010 22:45286559-45286581 CCCCAACCCCTGCCCTGGAGGGG + Intronic
1184593772 22:45502593-45502615 CCCCACCCCCTCTCGAGGGGAGG - Intronic
1184769425 22:46588913-46588935 CCCCACCCCCTCCCACAGTAAGG + Intronic
1185235262 22:49708817-49708839 CCCCTCCCCTTCCCACAGATTGG + Intergenic
1185392240 22:50568792-50568814 GCCCACCTCCTCCCATGCAGGGG - Intergenic
950016360 3:9757493-9757515 CCCCAAGCCCTCCCACGCAGAGG + Exonic
950128243 3:10524215-10524237 GCCCACCCCCTCCCTTGAAGAGG - Intronic
950656788 3:14441568-14441590 CCCCACCCCGAGCCAGGGAGAGG + Intronic
950674086 3:14544351-14544373 CCCTAGCCCCTCCCACCCAGAGG + Intergenic
953133963 3:40166961-40166983 CCACACCTCCCCCCACAGAGAGG - Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954416382 3:50395470-50395492 CCCCACCCTGTCCCACAGTGGGG + Intronic
954460806 3:50625898-50625920 CCCCACCCCCACCCCAGGGGAGG + Intronic
954497916 3:50982869-50982891 ACCCACTCCCTCCCACTCAGTGG - Intronic
956322052 3:68008017-68008039 CCCCACCCCTTCTCCCGGGGCGG - Intronic
956787909 3:72657785-72657807 CCCCACCCCCTGCAGTGGAGCGG + Intergenic
958040350 3:88219701-88219723 CCCCACCCCCACCCACCCAGTGG - Intergenic
958040368 3:88219750-88219772 CCCCACCCCCACCCACCCAGTGG - Intergenic
960147798 3:114221543-114221565 CCTCACCCCTTTCCACTGAGAGG + Intergenic
960853453 3:122079270-122079292 CCTCACCCCCACCCAGGAAGAGG - Intronic
963202346 3:142598316-142598338 CCCCACTCCCTCCCACAAACAGG - Intronic
964199755 3:154105756-154105778 CCCCACCCCATCCCTGGGACTGG - Intergenic
965963120 3:174452554-174452576 CCCAACCCCCGCCCACACAGTGG + Intronic
968089915 3:195893339-195893361 CCTCACCCCCTCCCCTGGGGTGG + Intronic
968093051 3:195909779-195909801 CCCCACCCCCCACCCCGGGGCGG - Intronic
968506743 4:974328-974350 CCCCACCCCGGGCCACCGAGCGG + Intronic
968636671 4:1684436-1684458 CCCCGCCCCCTCCGTCGGCGCGG - Intergenic
968823570 4:2875962-2875984 CCACAGCCCCTCACAAGGAGAGG + Exonic
968923043 4:3532472-3532494 CCCCGCCCCCACCCACCGCGCGG + Exonic
968928445 4:3562530-3562552 ACCCACCCCCACGCAGGGAGGGG - Intergenic
968937531 4:3619935-3619957 CCCCACTCCCTCACACTCAGAGG - Intergenic
968983955 4:3865395-3865417 CCCCACCCACTGCCTCGGGGAGG + Intergenic
968985119 4:3870795-3870817 CCCCACCCCCACCCTCGCCGGGG - Intergenic
969297970 4:6280758-6280780 CCCCACCCCTTCCCACTATGCGG + Intronic
969315227 4:6377798-6377820 CCCCAGCCACTCCCTCAGAGTGG + Intronic
969681431 4:8645460-8645482 CCCCACACCCACACACGCAGAGG - Intergenic
971906471 4:32732552-32732574 CCACACCCCACCCCACGCAGGGG - Intergenic
972374800 4:38460273-38460295 CCCCACCGCCTCCCAGAGATGGG + Intergenic
972436995 4:39044652-39044674 CCCCACCCCCTTCCCCGGCTCGG + Intergenic
977668238 4:99665975-99665997 CCCCATCCCCACACACAGAGTGG + Intergenic
977682383 4:99810826-99810848 CCCCACCCCATCCCACAGACTGG - Intergenic
978123689 4:105110594-105110616 CCCCACCCTCTCGGACGGGGCGG - Intergenic
978325335 4:107547492-107547514 CCCCACCCCCACCCCCCGACAGG + Intergenic
980480806 4:133385209-133385231 CCCCGCCCCCTTCCAAGGAGGGG + Intergenic
981745850 4:148051650-148051672 CCCCTCTCCCACCCACTGAGAGG + Intronic
985129641 4:186726713-186726735 CCCCACCGCCTCCAAGGGGGAGG - Intronic
985669731 5:1201175-1201197 CCCCACCCCAGTCCAGGGAGAGG - Intergenic
986790722 5:11157018-11157040 CCCCACCCTATCACACAGAGAGG - Intronic
987401101 5:17477807-17477829 CCACACCCCCTCCCACACTGAGG + Intergenic
988796576 5:34657227-34657249 CCCCACCCCCCACCAGGCAGGGG - Intronic
991342962 5:65632133-65632155 CCCTACCCCCGCCCACCAAGAGG - Intronic
992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG + Intergenic
993069670 5:83144558-83144580 CCCCCCCCACCCCCACGGATTGG + Intronic
994649525 5:102509197-102509219 CCCCACTCCCTACCATGTAGTGG + Intergenic
997233382 5:132258937-132258959 GCCCACCCCCTCCCAAGAACTGG - Intronic
997466384 5:134090676-134090698 CCCCACCCCCTGCCACTGAAAGG + Intergenic
997734086 5:136200779-136200801 TCCCACCCCCTCCCACTAGGAGG + Intergenic
1001036350 5:168299577-168299599 TCCCTCCCCCTCCCGGGGAGAGG + Intronic
1001328795 5:170747904-170747926 CCCCACTCCACCCCAGGGAGGGG + Intergenic
1002183331 5:177442535-177442557 CCCCACCCCCTCCTAGGGGCTGG - Exonic
1004626466 6:17381725-17381747 CTCCATGGCCTCCCACGGAGTGG - Intergenic
1004709416 6:18155584-18155606 CCCCACGCACGCCCCCGGAGTGG - Intronic
1005958829 6:30682607-30682629 CCCCACCCCCACCCAAGCAGCGG + Intronic
1006929649 6:37680121-37680143 CCCCACCCCCGCCCCCGGGAGGG - Intronic
1007375514 6:41453499-41453521 CCCCAGCCCATCCCACTCAGAGG + Intergenic
1007553252 6:42746210-42746232 CCCCGCCCCCTCCGACGCAGAGG - Intergenic
1007577157 6:42932594-42932616 TCCCACGCCCTCCCCAGGAGTGG - Intronic
1007594902 6:43045435-43045457 CCCCAGCCCATCCCAAGGTGTGG - Intronic
1007926113 6:45651100-45651122 CCCCACCCCCTTCAATGGACAGG + Intronic
1009526336 6:64751246-64751268 GCCCCACCCCTCCCACGCAGAGG + Intronic
1010024403 6:71199044-71199066 GCCCACCCCCTCCCACAGCAAGG - Intergenic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1013211662 6:107992298-107992320 CCCCACCCCCACCCACCAGGAGG + Intergenic
1014663311 6:124201220-124201242 CCCCACCACATGCCATGGAGAGG - Intronic
1015166206 6:130202906-130202928 CCCCCCCTCCTCCCCCGCAGTGG + Intronic
1015605729 6:134953050-134953072 CCCCACCACATCCCAAGGGGTGG + Intergenic
1019420370 7:947997-948019 CCCCACTCCCTCTTCCGGAGGGG + Intronic
1019470647 7:1218812-1218834 CCCAGGCCACTCCCACGGAGCGG - Intergenic
1022741789 7:33129243-33129265 CCCCACCCACACGCACCGAGGGG + Intronic
1023836563 7:44072131-44072153 CTCCACCCCCACCCACTTAGCGG - Intergenic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1024058283 7:45680001-45680023 TCCCACCCCATCCCACCCAGAGG - Intronic
1025712464 7:63925791-63925813 CCCCACCCGTTCCCACTGAGGGG - Intergenic
1026164895 7:67900901-67900923 CACCACCCCCTCCCTCGCTGAGG - Intergenic
1026953809 7:74364410-74364432 CCCCAGCCCCTTCCCCGGGGGGG - Intronic
1031966422 7:128031185-128031207 CCCCCCCTCCGCCCAAGGAGCGG + Intronic
1032198950 7:129805544-129805566 CCCCACTTCCTCCAACTGAGAGG - Intergenic
1032266713 7:130374710-130374732 CCATACCCCCTCCCACAGTGCGG + Intergenic
1032909121 7:136408762-136408784 CTCCATCCCCTCACACTGAGAGG + Intergenic
1034113039 7:148557180-148557202 CCCTACCCCCGCCCATGAAGGGG - Intergenic
1034200816 7:149281950-149281972 CACGGCCCCCTGCCACGGAGCGG - Exonic
1034250226 7:149684415-149684437 TCCCACCCCCACCCCCAGAGAGG - Intergenic
1035397544 7:158545044-158545066 GCCCAGCCCCACCCACGGCGAGG + Intronic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1037012663 8:13863116-13863138 CCCTACCCCCACCTACAGAGAGG - Intergenic
1037799418 8:22024416-22024438 CCCCTCCCCAGCCCATGGAGAGG - Exonic
1038406599 8:27326710-27326732 CTCCTCCCCCTCCCCCAGAGTGG - Intronic
1038447749 8:27615596-27615618 CCCCTCCCCCTGGCAAGGAGGGG + Intergenic
1040110330 8:43564367-43564389 CCCCACCCCCTCCCTGGGTCCGG + Intergenic
1040701738 8:50074834-50074856 CCCCACTCCCTCGCAAGCAGAGG - Intronic
1040922689 8:52641003-52641025 CCCCACCCCTGCCCACTCAGAGG - Intronic
1041106930 8:54453702-54453724 CCCCAACCCCTCCCTGGCAGCGG - Intergenic
1041107577 8:54458061-54458083 CCCCACCCCCTCCCCCGGGTCGG + Exonic
1041277856 8:56181560-56181582 CCCCACCCCCTGCCAATGACAGG - Intronic
1041404582 8:57483821-57483843 CCCCACCCCCTACAGCAGAGTGG + Intergenic
1041532148 8:58881050-58881072 CCCCACCTCCTCCCACACAGGGG - Intronic
1042857785 8:73285478-73285500 TCCCACTCCCTCCCACGAAGGGG - Intergenic
1044322129 8:90814422-90814444 CCCAACCCACACCCAAGGAGAGG + Intronic
1044523243 8:93223869-93223891 CCCGCCCCCCACCCACTGAGAGG + Intergenic
1044703628 8:94987291-94987313 CCCAACCCCCTCCAAAGCAGAGG + Intronic
1045489098 8:102655759-102655781 CCCCACCCCCGCCCGCGGCGCGG - Exonic
1046201103 8:110928822-110928844 CCCCACCATCTCCCAGAGAGAGG - Intergenic
1046213587 8:111113341-111113363 CCCCAGCTCCTCACAGGGAGTGG - Intergenic
1047757316 8:127928615-127928637 CCCCACCCTATCCCCCAGAGGGG + Intergenic
1049203199 8:141351718-141351740 CCCCACCCCCACCCCAGGACAGG - Intergenic
1049249619 8:141581172-141581194 CCCCACCCTCTCTCAAGGGGTGG - Intergenic
1049470755 8:142774118-142774140 ACCCAGCCCCTCCCCCGCAGCGG - Intronic
1049578198 8:143399127-143399149 ACCCACCTCCTCCCTCGGTGGGG + Intergenic
1049611561 8:143558462-143558484 CCCCGCCCCCTCCCCCGGCCTGG + Intronic
1049657414 8:143804918-143804940 CCCCATCCCCACTCACAGAGAGG + Exonic
1049708012 8:144051662-144051684 CCCGGCCCCATCCCACAGAGGGG - Intronic
1049732298 8:144184938-144184960 CCCCACCCCCTGCACTGGAGAGG + Intronic
1049747366 8:144268715-144268737 CCCCACCCTCTCTCCCGGCGTGG - Intronic
1049830530 8:144698879-144698901 CCCCAACCCCCCCAAGGGAGGGG - Intergenic
1051887941 9:21914624-21914646 CCCCACCCCCACCCCATGAGAGG - Intronic
1051942783 9:22529158-22529180 CCCCACCCACCCCCACAAAGTGG + Intergenic
1053393466 9:37752196-37752218 CCCCACCCCCACCCCCGCCGTGG + Intronic
1053452143 9:38202294-38202316 CCCCACCCCCACCCCCGCTGAGG - Intergenic
1054141934 9:61537452-61537474 ACCCACCCCCACGCAGGGAGGGG + Intergenic
1054453625 9:65417758-65417780 CCCCACTCCCTCACACTCAGAGG + Intergenic
1054461694 9:65468630-65468652 ACCCACCCCCACGCAGGGAGGGG + Intergenic
1054907030 9:70420722-70420744 CCCAACCCCCTACCCCGGTGGGG + Intergenic
1055112127 9:72570197-72570219 CCCCACCCCCTTTCAAAGAGTGG - Intronic
1056740541 9:89250692-89250714 CCCCACCCCCTCCCCCCCCGGGG - Intergenic
1057028506 9:91755644-91755666 TCCCACCCACTGCCACGGGGTGG + Intronic
1057227386 9:93299593-93299615 CCCCACCCCCACCCCCACAGCGG + Intronic
1057815338 9:98290099-98290121 TCCCACCTCCTCCCCCAGAGTGG + Exonic
1060406575 9:123375890-123375912 CCCCACCCCGCCCCAGGAAGGGG - Intronic
1061033891 9:128102820-128102842 CCCAGCCCCCTCCCACCGGGGGG - Intronic
1061128053 9:128689223-128689245 CTCCACCTCCTCCTACGGCGAGG - Intronic
1061237392 9:129351020-129351042 CCCGGCCCCATCCCACAGAGGGG + Intergenic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1061806776 9:133141311-133141333 CCCCACCCTCTCCCAGGGTCTGG + Intronic
1062161721 9:135083992-135084014 CCTCACCCCCTTCCCTGGAGAGG - Intronic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1187403793 X:18984605-18984627 CCCCCGCCCCTGCCGCGGAGTGG + Intergenic
1188911579 X:35854427-35854449 CCCCTCCCCCAACCACTGAGAGG - Intergenic
1189344737 X:40232434-40232456 CCCCACCCCCTGCCCTGGACAGG - Intergenic
1189376914 X:40473740-40473762 CCCCTCCCCAACCCATGGAGTGG + Intergenic
1189725713 X:43966448-43966470 ACCCACTCCCTCCCAGGAAGGGG + Intronic
1191163431 X:57360824-57360846 CCTCACCCCCACCCACCGACAGG + Intronic
1192208243 X:69110157-69110179 CCCTAGGCCCTCCCATGGAGTGG + Intergenic
1192223076 X:69210577-69210599 CCCCACCTCATCCCGAGGAGGGG - Intergenic
1193743420 X:85244790-85244812 CCCAACCGTCTCCCACGTAGCGG + Intronic
1195239262 X:102935024-102935046 CCCCGCCCCCTCCGACAGTGTGG - Intergenic
1200000362 X:153056787-153056809 CCCCACCCCCACCCCCCGTGGGG - Intronic
1200045542 X:153398980-153399002 CCTCACCCCCACACACGTAGGGG - Intergenic
1200142733 X:153909943-153909965 CCACACCCCCTCCCACAGCTTGG - Intronic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic