ID: 917329990

View in Genome Browser
Species Human (GRCh38)
Location 1:173870777-173870799
Sequence CAGAGAGCTAAGTCCTCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917329984_917329990 23 Left 917329984 1:173870731-173870753 CCCCAAAGGGAAACCGGCGAGGT 0: 1
1: 0
2: 0
3: 2
4: 52
Right 917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 180
917329985_917329990 22 Left 917329985 1:173870732-173870754 CCCAAAGGGAAACCGGCGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 180
917329988_917329990 10 Left 917329988 1:173870744-173870766 CCGGCGAGGTCAGGTTAGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 72
Right 917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 180
917329986_917329990 21 Left 917329986 1:173870733-173870755 CCAAAGGGAAACCGGCGAGGTCA 0: 1
1: 0
2: 0
3: 4
4: 39
Right 917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG 0: 1
1: 0
2: 0
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917329990 Original CRISPR CAGAGAGCTAAGTCCTCCTG AGG Exonic
901181879 1:7347511-7347533 CAGGGAGCTAAGCCTTCCTTGGG + Intronic
901203454 1:7479833-7479855 CACATAGCCAAGTGCTCCTGTGG + Intronic
904715423 1:32464371-32464393 CAGGGAGCTTAGTTCTCATGGGG - Intergenic
905474043 1:38213423-38213445 AAGAGAACTAACTCCTGCTGGGG + Intergenic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
910701134 1:90075338-90075360 CAGCAAGCTAAATCATCCTGAGG + Intergenic
910852646 1:91663897-91663919 CAGACAACTAAGTCGTCCTACGG + Intergenic
912207975 1:107529012-107529034 CAGAGAGCTGGGTGCTGCTGAGG - Intergenic
913047789 1:115089019-115089041 CAGGGACCCAAGTCCTCCGGAGG + Intronic
914045298 1:144086337-144086359 AAGAGAGATAAGTCCAACTGAGG + Intergenic
914132812 1:144874349-144874371 AAGAGAGATAAGTCCAACTGAGG - Intergenic
917139853 1:171824982-171825004 CAGGAAGCTAAGTCCACATGGGG - Intergenic
917329990 1:173870777-173870799 CAGAGAGCTAAGTCCTCCTGAGG + Exonic
918646857 1:186915822-186915844 CAGACAACTAAGTCATCCTACGG + Intronic
919813581 1:201424062-201424084 CACAGGGCTAAGACCTCCAGTGG - Intronic
922220760 1:223556877-223556899 GTGAGCGATAAGTCCTCCTGGGG + Intronic
923219728 1:231882069-231882091 AGAAGAGCCAAGTCCTCCTGTGG - Intronic
923358070 1:233180763-233180785 CAGGGAGCTGAGTCTTCCTGAGG + Intronic
923457220 1:234174938-234174960 CAAAGAGTTCAGTCCTCCTGGGG + Intronic
1063773654 10:9234519-9234541 AAGAGAATTAAGCCCTCCTGAGG + Intergenic
1066511656 10:36105472-36105494 TACAGAGATAAGTCCTCCTGTGG - Intergenic
1066957405 10:42186029-42186051 AAGAGAGATAAGTCCAGCTGAGG + Intergenic
1067210827 10:44259404-44259426 CAGAGAGCACAGGGCTCCTGGGG + Intergenic
1067977862 10:51046314-51046336 CTGAGATCCCAGTCCTCCTGTGG + Intronic
1068671482 10:59727907-59727929 CAGACAACTAAGTCGTCCTGCGG + Intronic
1070457999 10:76636461-76636483 CAGAGAGCTGACTCTACCTGGGG - Intergenic
1071262642 10:83934793-83934815 CCCAGAGCTCAGACCTCCTGTGG - Intergenic
1074825043 10:117208707-117208729 CAAAGAGCTCAGTCCTCTTATGG + Intronic
1075829649 10:125396779-125396801 CACATAGCTCAGTCCTGCTGAGG + Intergenic
1080598985 11:33803665-33803687 CAGAGAGGTCAGTCCACCTAGGG + Intergenic
1083197494 11:61097381-61097403 CAGACAACTAAGTCGTCCTACGG - Intergenic
1084647602 11:70467708-70467730 CAGAGAGCCCAGGGCTCCTGTGG + Intergenic
1084721672 11:70909971-70909993 CGCAGGGCTAGGTCCTCCTGAGG + Intronic
1084748968 11:71191402-71191424 CACAGGGCTGGGTCCTCCTGAGG + Intronic
1085397140 11:76212229-76212251 CAGAGAGCAAAGGCCTCCGGGGG + Intergenic
1091814189 12:3423822-3423844 CAGACAACTAAGTCATCCTATGG + Intronic
1092155110 12:6277104-6277126 CAGAGAGCTTGGTCCTCTGGTGG + Intergenic
1094513323 12:31110216-31110238 CAGGGAAGTAAGTCTTCCTGGGG + Intergenic
1095073161 12:37882957-37882979 CACAGAGTTAAGTCCTTCTTTGG - Intergenic
1095073351 12:37885669-37885691 CACAGAGTTAAGTCCTTCTTTGG - Intergenic
1096694008 12:53337466-53337488 CAGCGGGCTAAGCCCCCCTGTGG - Intronic
1102258190 12:111428287-111428309 CTGAGGGCTAAGTCCCCCTGAGG - Intronic
1107683839 13:42877352-42877374 GAGAGAGGTAAGTTATCCTGGGG - Intergenic
1109582577 13:64362219-64362241 AAGAGAGCAAAGACCACCTGGGG + Intergenic
1115053173 14:29089773-29089795 CAGGGAGCTATCTCCTCCAGGGG - Intergenic
1115641831 14:35340156-35340178 CACAGAGCAAGGTCCTGCTGAGG - Intergenic
1116493707 14:45536288-45536310 CAGAGATCTAATTTCTCCTTGGG - Intergenic
1118408471 14:65451356-65451378 CAGAGAGTTCACTCCTGCTGTGG - Intronic
1202935694 14_KI270725v1_random:85750-85772 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1124382242 15:29176710-29176732 AAGAGATCTAACCCCTCCTGGGG - Intronic
1127685108 15:61335986-61336008 CAGGGTGCTAAGGCTTCCTGTGG - Intergenic
1132219021 15:100091134-100091156 CAGAGCTCAAAGTCCACCTGAGG + Intronic
1135552247 16:23407548-23407570 CAGAGGGCTGAAACCTCCTGGGG - Intronic
1136672219 16:31868858-31868880 CCGGGAGCTAAGTCCTCATTTGG - Intergenic
1138013329 16:53405058-53405080 AAGAAAGCTAGGGCCTCCTGAGG + Intergenic
1139463784 16:67142962-67142984 CAGCCAACTAAGTCCTACTGAGG - Intronic
1141800854 16:86308294-86308316 AAAAGAGGTAACTCCTCCTGTGG + Intergenic
1142506960 17:370601-370623 AAGTCAGCCAAGTCCTCCTGCGG + Intronic
1143191556 17:5043776-5043798 GAGAGAGTCAAGGCCTCCTGAGG - Intronic
1146518881 17:33510896-33510918 CAGAGACCCAGCTCCTCCTGGGG + Intronic
1147317576 17:39628078-39628100 CAGACTACTGAGTCCTCCTGAGG + Intronic
1147975828 17:44247672-44247694 CAGAGAGCTAACTCTGCCAGGGG - Intergenic
1150503878 17:65678626-65678648 CAGAGATCTGTGTGCTCCTGCGG + Intronic
1152082978 17:78199939-78199961 CAGAGACCTAAGGCCTCTGGGGG - Intronic
1152495493 17:80668430-80668452 CAGGGCGCGAAGACCTCCTGCGG - Intronic
1155554035 18:26998160-26998182 GAGAGAGCTAAGTCAGACTGTGG - Intronic
1156241981 18:35263592-35263614 CAGAGACTTCAGTGCTCCTGTGG + Exonic
1164575203 19:29401782-29401804 CAGAGAGCTGAGTCAGCCTCGGG - Intergenic
1165365005 19:35359921-35359943 CTGAAAGCTAGGTCCTCCGGGGG + Exonic
1168059484 19:53883076-53883098 CAGAGAGCGCAGGCCCCCTGTGG + Intronic
1168452009 19:56474086-56474108 CACAAAGCTATGTCCTCCTGAGG + Exonic
1202684856 1_KI270712v1_random:39741-39763 AAGAGAGATAAGTCCAACTGAGG + Intergenic
926491123 2:13527403-13527425 CAGACAACTAAGTCATCCTATGG + Intergenic
928436740 2:31259384-31259406 CACAGAGGTAAGACCTACTGGGG + Intronic
930203275 2:48564372-48564394 GAGTGAGCTAGGTCCTCCAGTGG + Intronic
930682446 2:54271490-54271512 CAGTGTGCTGAGTCCTCCTTTGG - Intronic
931257131 2:60583546-60583568 CAGAAAGCTCAGCACTCCTGAGG + Intergenic
934246863 2:90315105-90315127 AAGAGAGATAAGTCCAACTGAGG - Intergenic
934262463 2:91487498-91487520 AAGAGAGATAAGTCCAACTGAGG + Intergenic
934305512 2:91818487-91818509 AAGAGAGATAAGTCCAGCTGAGG + Intergenic
934327744 2:92034261-92034283 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
934466130 2:94264791-94264813 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
935612792 2:105043360-105043382 AAAAGAACTAATTCCTCCTGGGG - Intronic
935970899 2:108529993-108530015 CAGACAACTAAGTCATCCTACGG - Intergenic
936419236 2:112347578-112347600 CAGATAACTAAGTCATCCTACGG + Intergenic
938398161 2:130965648-130965670 CAGAGGCCTCAGTCCTCCTGGGG + Intronic
942956193 2:181776321-181776343 CAGATAGCTAACTCCTTCAGAGG + Intergenic
945891831 2:215437589-215437611 CAGAGTTCTAATTACTCCTGTGG - Intergenic
946331732 2:219013430-219013452 CAGGGAGCTGTGTTCTCCTGGGG - Intronic
946619048 2:221541249-221541271 CTGAGAACTAAGTCTTGCTGTGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1174134654 20:48371430-48371452 AAGAGAGCTAATCCCTCCTCTGG + Intergenic
1175717690 20:61266316-61266338 AAGAGAGCTAGGTCCTCCCCTGG - Intronic
1175790712 20:61738379-61738401 CACAGAGGGAAATCCTCCTGGGG - Intronic
1178448038 21:32663296-32663318 CAGACAACTAAGTCATCCTACGG - Intronic
1180280041 22:10685426-10685448 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1180587259 22:16903958-16903980 AAGAGAGATAAGTCCTGCTGAGG - Intergenic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1182084437 22:27551582-27551604 CACAGAGCAAAGACCTCCTGGGG + Intergenic
1182460677 22:30481553-30481575 CAGAGAGTGAGATCCTCCTGGGG + Intergenic
1183324510 22:37184100-37184122 CAGAGAGCTAAGTCAGCCCTGGG + Intronic
1184473838 22:44710334-44710356 CAGGAGGGTAAGTCCTCCTGAGG - Intronic
1184528430 22:45039452-45039474 CAGACAGCTGTGTCCTCATGCGG + Intergenic
950316956 3:12010503-12010525 CACAGAGATAAGTTATCCTGGGG + Intronic
951021582 3:17786684-17786706 AAGAAAGCTGAGTCCTCATGTGG - Intronic
951225318 3:20114043-20114065 CAGATACCTAAGTCCCTCTGAGG - Intronic
951674867 3:25226865-25226887 CACAGAGTTAAGTCTTCCTGAGG - Intronic
952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG + Intronic
952505164 3:34000537-34000559 CAGAGAGAGATGTCCACCTGAGG - Intergenic
957406537 3:79779527-79779549 CAGACAACTAAGTCATCCTATGG - Intergenic
960554994 3:119018237-119018259 AAGAGAGAGAAGTCCTCTTGAGG + Intronic
960902247 3:122564517-122564539 CAGAGCTCTAAGTCCTCGGGCGG + Exonic
961057355 3:123800253-123800275 CAGAGAGCTGAGTCCTCGGAGGG + Intronic
962533341 3:136304093-136304115 CTGAGAGCAAAGACCTCGTGAGG - Intronic
962663309 3:137627289-137627311 CACAGGGTTAATTCCTCCTGGGG + Intergenic
962908744 3:139828431-139828453 CAGAGAGCAATGCCTTCCTGGGG - Intergenic
964924337 3:161937643-161937665 CAGACAACTAAGTCATCCTACGG - Intergenic
967980728 3:195063556-195063578 CAGAGAGGTGAGGGCTCCTGGGG + Intergenic
968646980 4:1746081-1746103 CAGAGGGCCAGGGCCTCCTGAGG + Intergenic
968748705 4:2374954-2374976 GACAGAGCCCAGTCCTCCTGTGG + Intronic
968931332 4:3581136-3581158 CACAGACCAAAGTCCTACTGCGG + Intronic
969366207 4:6695780-6695802 CAGAGAACAATGTCCGCCTGAGG + Intronic
969902253 4:10360686-10360708 CAGGGAGGTATGTCTTCCTGTGG - Intergenic
974243846 4:59287912-59287934 CATAAAGCTAAGACTTCCTGAGG - Intergenic
976042171 4:80899627-80899649 CAGAGATTTCAGTCCTCCTAGGG + Intronic
980128250 4:128793901-128793923 AACAGAGCGAAGTCCTCTTGGGG - Intergenic
989321068 5:40134441-40134463 CAGAGAACTAAGTTCTCCACGGG - Intergenic
991675852 5:69089284-69089306 CAGACAACTAAGTCGTCCTACGG + Intergenic
992784126 5:80154118-80154140 CAGAGAGCTCAGGTCTCCTTTGG - Intronic
993795908 5:92267844-92267866 CCTAGAGCTAAGGTCTCCTGTGG - Intergenic
998560238 5:143164836-143164858 TAGAGACCTAATTCTTCCTGAGG - Intronic
998736300 5:145145262-145145284 CAGAGATGTAAGTCATTCTGAGG + Intergenic
1000269293 5:159668313-159668335 CAGAGAGCTAAAGCAACCTGTGG + Intergenic
1000397357 5:160789845-160789867 CAGATACCTAAGTCCTCCTTTGG - Intronic
1001823514 5:174727505-174727527 GAGACACCTGAGTCCTCCTGAGG + Intronic
1002064095 5:176643582-176643604 CAGAGAGCCAAGTCCACCCCCGG - Intronic
1002774659 6:318510-318532 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1002774670 6:318548-318570 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1002774684 6:318596-318618 CTGAGAGCTGAGGCCTGCTGTGG - Intronic
1002904117 6:1435019-1435041 CAGAGAGGTTAGTGCTCATGTGG - Intergenic
1008544623 6:52574350-52574372 CACAGAGATAAGTATTCCTGGGG - Intronic
1014546571 6:122742957-122742979 CAGACAACTAAGTCGTCCTACGG + Intergenic
1015287098 6:131498161-131498183 CAAAGAGCTACATCATCCTGAGG - Intergenic
1018735036 6:166681539-166681561 GAGAGAGCTCAGCCTTCCTGGGG - Intronic
1020068150 7:5205558-5205580 CAGTGAGCCACCTCCTCCTGTGG - Intronic
1021184576 7:17548488-17548510 CTGAGGGCTATATCCTCCTGAGG - Intergenic
1021639819 7:22726420-22726442 CAGAGAGCAAAGTCCTCACTGGG + Intronic
1023908996 7:44540840-44540862 CAGAGTGCTCAGTCCTCCCTAGG + Intronic
1026198152 7:68190747-68190769 CACAGAGCAAAGTCCATCTGAGG + Intergenic
1029822147 7:103156846-103156868 CAGACAACTAAGTCGTCCTATGG - Intergenic
1029839984 7:103351999-103352021 CAGCGAGCTAATTCTTCCTAAGG + Intronic
1032083281 7:128870462-128870484 AAGAGAGCCGAGGCCTCCTGGGG - Intronic
1032457018 7:132080836-132080858 CAGAGAGGGAAGTACTCCTTTGG + Intergenic
1036680127 8:10865844-10865866 CAGAGAGGTTAGCCCACCTGAGG - Intergenic
1039622801 8:39014512-39014534 CAGAGAACAGAGTACTCCTGGGG + Intronic
1040135743 8:43851649-43851671 CAGAGAGTTAAGCCATTCTGTGG + Intergenic
1041515781 8:58697402-58697424 CAGACAACTAAGTCTTCCTACGG - Intergenic
1044049238 8:87479376-87479398 GAGAGAGCTGAGCCCTTCTGAGG + Intronic
1044824345 8:96182371-96182393 GAGAAAGCTAGCTCCTCCTGTGG + Intergenic
1046387627 8:113524560-113524582 CAGAGAGCCAAATCATCCTTTGG - Intergenic
1046712917 8:117533397-117533419 TAGGGAGCTAAATCCTCATGGGG - Intronic
1046713058 8:117535048-117535070 TAGAGAGCTAAATCCTCATATGG - Intronic
1049620465 8:143596134-143596156 CAGAGGGCCTAGTCCTCCAGAGG + Intronic
1049801914 8:144521850-144521872 CTGAGAGCTCAGTGCTTCTGGGG + Exonic
1050280785 9:4047945-4047967 CAGAGAACAAAGACCTCCTTAGG - Intronic
1053696183 9:40641563-40641585 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1054307430 9:63440782-63440804 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1054406162 9:64764793-64764815 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1054439788 9:65250266-65250288 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1054458791 9:65450795-65450817 CACAGACCAAAGTCCTACTGCGG - Intergenic
1054490619 9:65771673-65771695 AAGAGAGATAAGTCCAGCTGAGG + Intergenic
1055214634 9:73844090-73844112 CAGAAAGCAAAGTACGCCTGGGG + Intergenic
1056845337 9:90032589-90032611 CAGGGAGCAACGTCCTCATGTGG - Intergenic
1057393171 9:94655976-94655998 CACAGAACTGTGTCCTCCTGCGG - Intergenic
1058824071 9:108759307-108759329 AAGAGAGCCAGCTCCTCCTGGGG - Intergenic
1060841740 9:126799066-126799088 CTGAAAGCTGAGTCCTCCAGAGG + Intergenic
1061052764 9:128205870-128205892 CAGAGGGCCCAGGCCTCCTGGGG - Intronic
1061622110 9:131817399-131817421 CAGAAATCTAAAACCTCCTGGGG - Intergenic
1062539872 9:137036854-137036876 CAGGGGGCTAGGTCCTCCGGTGG - Exonic
1202778632 9_KI270717v1_random:15224-15246 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1203585704 Un_KI270747v1:1633-1655 AAGAGAGATAAGTCCAGCTGAGG - Intergenic
1185910290 X:3974721-3974743 CAGACAACTAAGTCGTCCTATGG - Intergenic
1186161214 X:6778945-6778967 CAGAGAGCTAATTCATTTTGTGG - Intergenic
1187210257 X:17223235-17223257 AAGAGAGGTAAAGCCTCCTGGGG - Intergenic
1188567672 X:31545043-31545065 AAAAGGGCTAAGTCTTCCTGGGG + Intronic
1190425510 X:50331430-50331452 CAGACAACTAAGTCATCCTACGG + Intronic
1192053017 X:67744595-67744617 CAGGGAGCTGGGCCCTCCTGTGG - Intergenic
1193492383 X:82165659-82165681 CATAGAGCTAAAGCCTCCTCTGG - Intergenic
1194384705 X:93238187-93238209 CAGACAACTAAGTCATCCTATGG - Intergenic
1199635835 X:149810632-149810654 CAGAGAGGCATCTCCTCCTGGGG + Intergenic
1199643837 X:149886223-149886245 CAGAGAGGCATCTCCTCCTGGGG + Intergenic
1199978760 X:152909403-152909425 CAGAAAGCAAAGTACTCCAGGGG - Intergenic
1201193936 Y:11473501-11473523 AAGAGAGATAAGTCCAGCTGAGG - Intergenic