ID: 917332146

View in Genome Browser
Species Human (GRCh38)
Location 1:173892235-173892257
Sequence ACCAAGACCTCAAATAGAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917332146_917332148 18 Left 917332146 1:173892235-173892257 CCCACTCTATTTGAGGTCTTGGT 0: 1
1: 0
2: 0
3: 11
4: 115
Right 917332148 1:173892276-173892298 TATGCATCTATTGAAAGCAATGG 0: 1
1: 0
2: 1
3: 17
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917332146 Original CRISPR ACCAAGACCTCAAATAGAGT GGG (reversed) Exonic
900861373 1:5234821-5234843 AACAATGCCTCACATAGAGTAGG + Intergenic
902532507 1:17099356-17099378 GCCAGGACCTCAAATAGGGTGGG + Intronic
907948857 1:59161501-59161523 ACCAAGATCTCAAATGCATTTGG - Intergenic
908490853 1:64642793-64642815 ACCGAGACCTCACAAAGTGTTGG - Intronic
909235172 1:73143752-73143774 AACAAAACCTCAAGAAGAGTGGG - Intergenic
911532348 1:99059293-99059315 ACCAAAATATCAAATAGAGAAGG - Intergenic
913345222 1:117802530-117802552 GCCAAGACCTCAACTTGAGAGGG - Intergenic
915553671 1:156649350-156649372 AGCAAGACCTTAAGTACAGTTGG + Intronic
917332146 1:173892235-173892257 ACCAAGACCTCAAATAGAGTGGG - Exonic
917628684 1:176872036-176872058 ACCATGGCATCAAATGGAGTTGG + Intronic
919025343 1:192161889-192161911 ACCAAGACCTTATAAAGAGTTGG - Intronic
920431796 1:205923539-205923561 CCCAAGACCTATAATAGGGTAGG - Exonic
920909257 1:210199268-210199290 TCAAAGACCTCAAACAGAGATGG + Intergenic
1068445286 10:57114046-57114068 TCCAAGACCCCAAGTAGAATAGG - Intergenic
1069999717 10:72367268-72367290 AGCAAGATCTCAAATCCAGTGGG + Intergenic
1072085227 10:92072785-92072807 CCCTAGAACTCTAATAGAGTGGG - Intronic
1074897092 10:117786586-117786608 ACCAAGGCCTCCAAGAGAGCAGG - Intergenic
1075449629 10:122540873-122540895 GCCAAGACCTGACATGGAGTAGG + Intergenic
1077354935 11:2111381-2111403 AACAAGTCCTTAAAGAGAGTGGG + Intergenic
1078355956 11:10631562-10631584 ACATAGATCTCATATAGAGTTGG - Intronic
1080720894 11:34847708-34847730 ACTAAGACCTCAAATAAGGCAGG + Intergenic
1086427152 11:86696573-86696595 CCCATGAGCTCAAATGGAGTAGG + Intergenic
1087607628 11:100395526-100395548 CCCTAGACCTCCAATACAGTAGG + Intergenic
1089241314 11:117083164-117083186 ACTAAGAGCTCAATTAGAGCAGG + Intronic
1097964018 12:65559992-65560014 ACAAAGACCTCAAAATGAGAAGG + Intergenic
1099226462 12:79975689-79975711 TCCAAGACATCAAATACAGATGG + Intergenic
1100802753 12:98250526-98250548 ACCAGGCCCTCAAATAGATCAGG + Intergenic
1103659179 12:122500302-122500324 ACCACGACCTCAAACAGAGGGGG + Exonic
1110196344 13:72792679-72792701 ACCTAGACCACAAAAAAAGTAGG + Intronic
1110580943 13:77124788-77124810 ACCAAGATATCAAAGAGAGGGGG + Intronic
1111897566 13:94160025-94160047 AACAAAACCTCAAATAAAGGGGG - Intronic
1113504200 13:110802053-110802075 ATCCAGACCTCAAATAGTCTTGG - Intergenic
1116332650 14:43614935-43614957 ACAAAGACACCAAAGAGAGTTGG - Intergenic
1122311317 14:100796972-100796994 GCCAAGTCTGCAAATAGAGTTGG + Intergenic
1125163216 15:36672030-36672052 ACCAGGAATTAAAATAGAGTAGG + Intronic
1125409605 15:39391771-39391793 TCCAACACCCCAAATACAGTAGG + Intergenic
1127332331 15:57951394-57951416 ACCCAGAACTCAAATAGAGAGGG - Intergenic
1129391576 15:75223566-75223588 ACCAAGACATCAAAGAGGGCGGG - Intergenic
1129472727 15:75764288-75764310 ACCAAGACATCAAAGAGGGCGGG + Intergenic
1129730983 15:77932706-77932728 ACCAAGACACCAAAGAGGGTGGG + Intergenic
1131909494 15:97181557-97181579 AGCAAGACCTCAAATAGAAATGG + Intergenic
1133469428 16:6060029-6060051 TCCAAGACAACAAACAGAGTGGG - Intronic
1134349995 16:13428426-13428448 ACCAAGAGCTCAAAAAAATTGGG + Intergenic
1134384810 16:13761762-13761784 AGCAAGACCTCAAATCTACTGGG + Intergenic
1134659063 16:15970112-15970134 TCAAAGACCCCAAATATAGTGGG + Intronic
1134908328 16:18001106-18001128 ACCAAGACCTCAGATAGCTGTGG - Intergenic
1137357057 16:47777171-47777193 ACAAAGACCTCAAATAATCTAGG - Intergenic
1140686544 16:77439029-77439051 ACCCAGACCTCAAAAACAATGGG + Intergenic
1143623890 17:8096985-8097007 ACCCAAACCCCAAACAGAGTAGG + Intronic
1143692599 17:8582331-8582353 GCCAAGACCTCAAAGAGTGAGGG + Intronic
1147456359 17:40540680-40540702 GCCAAGACCACAAGTTGAGTGGG + Intergenic
1158231875 18:55265709-55265731 ACCAAGTCCTCAAAGAGAAAAGG + Intronic
1162553273 19:11370334-11370356 ACCTAGACCTCCCATAGTGTTGG - Intergenic
927031611 2:19125734-19125756 ACCAAGAACACAAAAAGAGAGGG - Intergenic
928838248 2:35574496-35574518 ACATAGACCTCAAATAAATTAGG - Intergenic
930644922 2:53895635-53895657 ACCAAGAACTAAAAAAGAATGGG - Exonic
931145949 2:59518552-59518574 AAGAAAACCTCAAATGGAGTTGG + Intergenic
931934948 2:67186566-67186588 ACCAAGACGTGAAGCAGAGTTGG - Intergenic
932113633 2:69024615-69024637 ACCAAGACCATAAATTGAGGAGG - Intronic
936407139 2:112214942-112214964 ACTCAGAAGTCAAATAGAGTAGG - Exonic
938106342 2:128533200-128533222 AGGAAGACCTCAAATAAAGTCGG - Intergenic
945357588 2:208857662-208857684 CCCAAGAACTCAAACAGGGTTGG + Intergenic
945698678 2:213142394-213142416 ACCCAGATTTCAAATAGACTTGG + Intronic
946225120 2:218260430-218260452 ACCACGACCTTAATTAGAGGTGG + Intronic
1168982114 20:2014102-2014124 AGCAAGCCCACAATTAGAGTTGG + Intergenic
1170715290 20:18825821-18825843 ACCAAGAGATTAAAGAGAGTTGG + Intronic
1177007166 21:15687846-15687868 AACAAAACTTCAAATAAAGTTGG - Intergenic
1177972243 21:27804777-27804799 ACCCAGATTTAAAATAGAGTTGG - Intergenic
1178330902 21:31690233-31690255 ACCTCGACCTCCCATAGAGTTGG - Intronic
1178680886 21:34670796-34670818 ACCAAGACCTCGAATGGAAGGGG - Intronic
1180527356 22:16306499-16306521 AACAAAACATCAAATGGAGTTGG - Intergenic
1182529850 22:30946792-30946814 ACCAAGAGCTCAAAGACAGCAGG - Intronic
1182729836 22:32479289-32479311 ACCAATATATCAAATAGAGTAGG + Intronic
949370944 3:3334127-3334149 AATAAGACCTCAAATGGAGTTGG + Intergenic
953777817 3:45837926-45837948 TCCAAGACCTCAAGGAGAGCAGG - Exonic
955267678 3:57463005-57463027 ATCAAAACCTCAATTAGATTTGG + Intronic
956604580 3:71060658-71060680 GTCAAGACATCAAATAGAATTGG + Intronic
961079410 3:124013045-124013067 ACCAAGACCTCCAGTAGAAGGGG + Intergenic
962733701 3:138305369-138305391 ACCAAGGGCTGAAATATAGTTGG + Intronic
962739418 3:138352049-138352071 GCCAAGAGTACAAATAGAGTGGG + Intronic
962901710 3:139767296-139767318 ATCAGGAGCTCAAATAGACTTGG - Intergenic
963062719 3:141238000-141238022 ACCAGGACCAAAAATAGTGTTGG - Intronic
963805326 3:149715725-149715747 ACATATACCTCACATAGAGTTGG + Intronic
967691130 3:192474926-192474948 ACAAAGCCCACAAAGAGAGTAGG + Intronic
970122239 4:12769043-12769065 ACCAAGAATTCACATAGAGTTGG - Intergenic
970870654 4:20813219-20813241 AAACAGACCTCAAATAAAGTAGG + Intronic
971139292 4:23906361-23906383 ACCAAGACCTCACAAAGTGCTGG - Intergenic
971162003 4:24142741-24142763 AACAAGACCTCAAGGAGATTAGG + Intergenic
972038999 4:34566506-34566528 TCCAACACCTCAAATCAAGTGGG - Intergenic
976793884 4:88910976-88910998 ACCAAGTCCTCTCACAGAGTAGG - Intronic
976813974 4:89125227-89125249 ACCTAGACCTCATTTAGAGATGG - Intergenic
978030451 4:103935680-103935702 TCCAAAACCTCAAATAAATTTGG + Intergenic
978983259 4:114978435-114978457 TCCAAGACCACAATTAGACTGGG + Intronic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
983430651 4:167646161-167646183 ACAAAGACATAAAATAGATTAGG - Intergenic
984185682 4:176540490-176540512 AAAAAGACCAGAAATAGAGTGGG + Intergenic
986887669 5:12259879-12259901 TCAAACACCTCATATAGAGTAGG - Intergenic
993227915 5:85192896-85192918 ACTAAGACCTCAAAGGGACTAGG + Intergenic
1002084055 5:176759593-176759615 ACCAGGACCTCCAGTACAGTGGG - Intergenic
1002502073 5:179653310-179653332 AACAAGGCCTGAAATAGAGATGG + Intergenic
1003276114 6:4654753-4654775 ACAAAGACTTCAGAAAGAGTTGG - Intergenic
1004310046 6:14537308-14537330 ACCCAGATCTCAAAGGGAGTAGG + Intergenic
1006076055 6:31533205-31533227 GCCATTACCTCAAATAGAGGTGG + Intronic
1006361396 6:33589295-33589317 ATCAAGACCTCAGATAGACTGGG - Intergenic
1007475554 6:42117507-42117529 ACCGAGCCCTCAAGTAGACTGGG - Intronic
1007554817 6:42756944-42756966 AACAAGAGCTCAAAGAGAGAGGG - Intronic
1009992540 6:70862078-70862100 ACCAAGACCTGACACACAGTAGG - Intronic
1011128109 6:84028733-84028755 ACCAAGACTCCAAATAGCCTAGG - Intergenic
1013515320 6:110879945-110879967 ACCAAGAACTTAAATACAGAAGG - Intronic
1014911486 6:127099147-127099169 ACCAAATCTCCAAATAGAGTTGG - Intergenic
1015572011 6:134631591-134631613 ACCTAGACATAAACTAGAGTTGG - Intergenic
1016692722 6:146957005-146957027 ACCCAGAAAGCAAATAGAGTTGG - Intergenic
1017081041 6:150669188-150669210 ATCTAGCCCTCAAATAGAGAGGG + Intronic
1027966036 7:85009688-85009710 AGAAAGACCTCACATAGATTGGG - Intronic
1033985802 7:147223998-147224020 AGCAAGAAATCAAAGAGAGTTGG + Intronic
1042335676 8:67627954-67627976 ACCCAGACATAATATAGAGTTGG - Intronic
1043587231 8:81783497-81783519 CCCAAGACCTCACACAGAGAGGG + Intergenic
1043947490 8:86270955-86270977 ACCAAGAGCTCAAGTAAACTCGG - Intronic
1044321942 8:90811973-90811995 AGCTGCACCTCAAATAGAGTTGG + Intronic
1048499492 8:134962655-134962677 ACCAAGTCCCTAAATAGACTTGG - Intergenic
1050736390 9:8768027-8768049 ACCAATTTCTCAAATACAGTAGG + Intronic
1052641895 9:31179114-31179136 ACCAAGACCCCAAGTAGATAAGG - Intergenic
1053266704 9:36720369-36720391 ACCAGGCCCTCAATTAGGGTCGG - Intergenic
1186473617 X:9839965-9839987 CCGATGACCTCAAATAGAGTAGG - Intronic
1189101119 X:38191083-38191105 ACCAAGGGCTCAAATATTGTGGG - Intronic
1197525305 X:127554596-127554618 AGCATTATCTCAAATAGAGTCGG + Intergenic
1198816748 X:140599657-140599679 GCCTACACCACAAATAGAGTAGG - Intergenic