ID: 917336071

View in Genome Browser
Species Human (GRCh38)
Location 1:173925497-173925519
Sequence CAGTAACCACAGCAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917336071_917336073 5 Left 917336071 1:173925497-173925519 CCCAGCTTCTGCTGTGGTTACTG No data
Right 917336073 1:173925525-173925547 CTCAAAGCTTAACCCTTCCATGG No data
917336071_917336074 13 Left 917336071 1:173925497-173925519 CCCAGCTTCTGCTGTGGTTACTG No data
Right 917336074 1:173925533-173925555 TTAACCCTTCCATGGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917336071 Original CRISPR CAGTAACCACAGCAGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr