ID: 917339877

View in Genome Browser
Species Human (GRCh38)
Location 1:173965046-173965068
Sequence TTGGGTCAACTTAATGAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917339877_917339882 -8 Left 917339877 1:173965046-173965068 CCCACCTCATTAAGTTGACCCAA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 917339882 1:173965061-173965083 TGACCCAAAGAGGCACTCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 153
917339877_917339886 8 Left 917339877 1:173965046-173965068 CCCACCTCATTAAGTTGACCCAA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 917339886 1:173965077-173965099 TCAAGGGTCTTCTCGGAACCAGG 0: 1
1: 0
2: 0
3: 7
4: 68
917339877_917339881 -9 Left 917339877 1:173965046-173965068 CCCACCTCATTAAGTTGACCCAA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 917339881 1:173965060-173965082 TTGACCCAAAGAGGCACTCAAGG 0: 1
1: 0
2: 1
3: 16
4: 168
917339877_917339885 1 Left 917339877 1:173965046-173965068 CCCACCTCATTAAGTTGACCCAA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 917339885 1:173965070-173965092 GAGGCACTCAAGGGTCTTCTCGG 0: 1
1: 0
2: 2
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917339877 Original CRISPR TTGGGTCAACTTAATGAGGT GGG (reversed) Exonic
900434062 1:2619034-2619056 TTTGGCCAACAGAATGAGGTGGG + Intronic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
906624072 1:47310633-47310655 TTGTATCAACTTAGTGAGCTCGG + Intronic
907052164 1:51336794-51336816 TTGCAACAACCTAATGAGGTTGG - Intronic
909199948 1:72678492-72678514 TTGGGTCAACTTGTTAAGGGAGG - Intergenic
911390718 1:97237842-97237864 TTGGGTCAACTAAATAAGGGAGG - Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
916370521 1:164089291-164089313 TTGACTAAAGTTAATGAGGTGGG + Intergenic
917339877 1:173965046-173965068 TTGGGTCAACTTAATGAGGTGGG - Exonic
917592592 1:176492060-176492082 ATGGGTCAAATGAATGAGATTGG + Intronic
918616634 1:186551328-186551350 TTGGTTCAACTTACTGGGATTGG - Intergenic
920369006 1:205465624-205465646 TCAGGACAACCTAATGAGGTAGG - Intergenic
920971936 1:210750224-210750246 TTGCTACAACTTTATGAGGTTGG - Intronic
1069731685 10:70620476-70620498 TTGGTTCAGCCTAAAGAGGTGGG + Intergenic
1071223480 10:83497519-83497541 TTGGCTCAGCCTAAAGAGGTGGG - Intergenic
1074933845 10:118158218-118158240 TTGGGTCAAGGGAAAGAGGTTGG + Intergenic
1074972777 10:118553309-118553331 TTAGGTCAATTTTATTAGGTTGG + Intergenic
1078988626 11:16622145-16622167 TTGGGTCATATGAATGAGGGTGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082871996 11:57952265-57952287 TGAGGTCAACTTAATGAAATAGG - Intergenic
1095471922 12:42546204-42546226 TTGAGACATATTAATGAGGTGGG - Intronic
1097913016 12:64990711-64990733 TTGGGTCAAATTGATTTGGTTGG + Intergenic
1103614495 12:122143451-122143473 TGGGGTGAACGTAATGAGGCGGG + Exonic
1110620465 13:77588541-77588563 TTGGCAGGACTTAATGAGGTAGG - Intronic
1113377361 13:109777580-109777602 TGGGGTCGATTTAATGAGGGTGG - Intronic
1114775916 14:25481093-25481115 TTGTTTCAACTTAATGGAGTGGG - Intergenic
1118994859 14:70826553-70826575 TTGGCACAACCTTATGAGGTAGG - Intergenic
1119584995 14:75825087-75825109 TTACAACAACTTAATGAGGTGGG - Intronic
1120375650 14:83703659-83703681 TTTGATCACCTGAATGAGGTAGG - Intergenic
1121569690 14:94937604-94937626 TTGGGTCCACTAAATAAGGAGGG + Intergenic
1124664133 15:31577497-31577519 TTGGTTCAGCTTAAAAAGGTGGG - Intronic
1127797399 15:62450486-62450508 TGGGGGCCACTTAATGATGTAGG - Intronic
1129965490 15:79731475-79731497 TTGGGACAACATACTGAGTTTGG - Intergenic
1130843389 15:87722813-87722835 GTGGGGAAAGTTAATGAGGTAGG + Intergenic
1130982563 15:88822796-88822818 TAGGGTCCAAATAATGAGGTTGG + Intronic
1133471019 16:6075908-6075930 TTGTGGCAACCTAATGAGGCAGG + Intronic
1134235394 16:12461283-12461305 TTGGGTGAACTTCAAGAGATTGG + Intronic
1137357773 16:47783202-47783224 TTGTGTCAAGCTAATGAGTTTGG - Intergenic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1144842583 17:18197203-18197225 TTGGGTCAACTTGGTGGGGTTGG + Intronic
1156507903 18:37610261-37610283 TTGGGTCAACTGGATGTGATTGG + Intergenic
1159891100 18:73954141-73954163 TTGGATAAACTTAGTGAGGTTGG - Intergenic
1165339798 19:35203278-35203300 TTGGTTCAGCCTAAAGAGGTGGG + Intergenic
925747672 2:7057366-7057388 TAGGGACAGCTTAATGAGGAAGG + Intronic
932952682 2:76312821-76312843 TTGGGTGAAATTAATAAGTTGGG + Intergenic
932993745 2:76821787-76821809 ATGGCTCACCTTAATAAGGTGGG - Intronic
933482733 2:82877225-82877247 TTGGGGTAACTTAAAGAGATGGG + Intergenic
938987208 2:136588955-136588977 TTGGTTAAGCTTAATGAGGGAGG - Intergenic
940256197 2:151732505-151732527 TTGGGTAAATATAATGAAGTTGG + Intronic
940407384 2:153320928-153320950 TTGGCTCAATTTGATGAGGTGGG - Intergenic
945615994 2:212067772-212067794 TTCTGTCAACTGAAAGAGGTAGG - Intronic
1172211857 20:33205264-33205286 TTGGATCTTCTTAATGAAGTGGG + Intergenic
1173071847 20:39775706-39775728 TTGGAAGAACTGAATGAGGTAGG - Intergenic
1175151754 20:56940455-56940477 TTTGGTCATCACAATGAGGTGGG - Intergenic
1176983385 21:15408511-15408533 TAGGGTCAACATAAGGTGGTTGG + Intergenic
1179365169 21:40752321-40752343 CTAGGTCGGCTTAATGAGGTGGG + Intronic
1182121702 22:27791449-27791471 TTGAGTCAAAATGATGAGGTTGG + Intronic
949407697 3:3732005-3732027 TTGAGTCATCTTAAGCAGGTAGG - Intronic
950280030 3:11698961-11698983 TTAGGTCACCTTGATGAGCTGGG + Intronic
950337820 3:12212761-12212783 TTTGCTCAACCTAATGAGTTTGG + Intergenic
953505674 3:43483776-43483798 TTGGTTCATCCTAAAGAGGTAGG + Intronic
954274033 3:49531101-49531123 TGGGGTCATCTTGGTGAGGTCGG - Exonic
957904521 3:86539613-86539635 TTGAGTTAAGTTAATGAGTTTGG + Intergenic
960616279 3:119598949-119598971 TAGGGACAACTAATTGAGGTAGG - Intronic
962452098 3:135528474-135528496 TGAGGTCAGCTTAGTGAGGTCGG - Intergenic
963322931 3:143829124-143829146 GAGGTTCAATTTAATGAGGTCGG + Intronic
970298639 4:14658732-14658754 TAGGGAGAACTTTATGAGGTGGG + Intergenic
970678652 4:18482005-18482027 TGGGGTCAACTTGATGGGGGAGG - Intergenic
971520448 4:27543435-27543457 TTGGGTCAAATTAAATAGGTAGG - Intergenic
973655244 4:53040681-53040703 TTGGAAGAACTTAATGTGGTTGG - Intronic
975094586 4:70443212-70443234 TTTGGCCAAATTAATGAGTTTGG - Intronic
976138601 4:81965711-81965733 TTGCAACAACCTAATGAGGTGGG - Intronic
980657280 4:135806027-135806049 TTTGTTCAACTTACTGAGGATGG + Intergenic
980741854 4:136960901-136960923 ATGTGTAAATTTAATGAGGTAGG + Intergenic
981499371 4:145433185-145433207 TTGCATTAACTTAATGAGTTAGG + Intergenic
982209163 4:153021004-153021026 CTGGGGCAACCTAATGAGCTAGG - Intergenic
985303234 4:188511994-188512016 TTGGGCCAATTTAAAGAAGTTGG + Intergenic
991400923 5:66250822-66250844 TGTGCTCAACTTTATGAGGTGGG - Intergenic
993188229 5:84646877-84646899 TTTGGTCAACCTAATCAAGTGGG - Intergenic
993375793 5:87148399-87148421 TTGGGGTAACTTAAAGAGATGGG - Intergenic
993687243 5:90953391-90953413 TTGACTCAACTAAATGAGGAGGG - Intronic
998414779 5:141938220-141938242 TTATGACAACTTAATGAGTTAGG - Intronic
998591137 5:143479457-143479479 TTGTATCAACCTTATGAGGTTGG + Intergenic
999054313 5:148557393-148557415 TTGGTACAATTTAATGAGATGGG + Intronic
1002943289 6:1736408-1736430 TTTGGTCATCATAAAGAGGTTGG - Intronic
1003146191 6:3512572-3512594 TTTGGTCAATTTAATGGAGTGGG - Intergenic
1004685815 6:17942492-17942514 TTGCTGCAACTTTATGAGGTAGG - Intronic
1004770846 6:18779903-18779925 TTGCCTCAACCTAATGAGGCTGG + Intergenic
1005230489 6:23696380-23696402 TTGGGTGAAGTTAAAGAAGTTGG - Intergenic
1006498177 6:34439243-34439265 TTGGTTCAGCTGAAAGAGGTGGG - Intergenic
1006662282 6:35657541-35657563 TGGGCTCAACTTAATCACGTGGG - Intronic
1008572883 6:52832014-52832036 CTGGGTCATCTTAATGATGGTGG - Intronic
1010733753 6:79418479-79418501 TTCCGTCAAGTTAATGAGGGAGG + Intergenic
1011656501 6:89556801-89556823 TTGCAACAACCTAATGAGGTAGG + Intronic
1012822768 6:104108183-104108205 TTAGTTGAACTTTATGAGGTGGG - Intergenic
1016392328 6:143586892-143586914 TTTGGACAACATAATGAGGTAGG - Intronic
1017314386 6:153013536-153013558 TTAGTTAAACTTAATGAGGAAGG + Intronic
1018073874 6:160191850-160191872 TTGGGTCAGCTTGCTGAGGTTGG - Intronic
1020858854 7:13462604-13462626 TTGAAACAACTTTATGAGGTAGG + Intergenic
1021978308 7:26030395-26030417 GTGGGTCAACTTGAAGGGGTAGG + Intergenic
1024013254 7:45288503-45288525 TTGGTTCAACCTAAAGAGGCAGG + Intergenic
1024898765 7:54293152-54293174 TTGGTTCAACTTGAAAAGGTGGG + Intergenic
1028017375 7:85733198-85733220 TTTGGTCAAGTTACTTAGGTAGG - Intergenic
1028955497 7:96684664-96684686 GTGGGTCTATTTACTGAGGTGGG + Intronic
1029157892 7:98530195-98530217 TTGGTTCAGCTTAAAGGGGTGGG + Intergenic
1030023302 7:105297158-105297180 ATGGGTCAATTTTATTAGGTTGG + Intronic
1031337686 7:120556355-120556377 CTGGGTCACCTTAATCTGGTAGG - Intronic
1031642307 7:124180308-124180330 TTGGGTCAGCTTATTAAGGGAGG + Intergenic
1034903653 7:154924653-154924675 TTGGGTCATCTTAATGAACAAGG + Intergenic
1035556459 8:570695-570717 TTGGTTCAGCCTAAAGAGGTGGG - Intergenic
1039462913 8:37761240-37761262 TTAATTCAACTTAATGAAGTGGG - Intergenic
1040855152 8:51941462-51941484 TTGGGGAAACATAATGAGTTTGG - Intergenic
1041523319 8:58778398-58778420 TTGGGTCTACTTAGTGAGGAGGG + Intergenic
1045603594 8:103747366-103747388 TTGGGTCATTTTAAGGAGTTTGG + Intronic
1047116865 8:121852653-121852675 TTAGGTCCACTTAATGTGTTAGG - Intergenic
1047382197 8:124373452-124373474 TAGGGACAGCTTAATGAAGTAGG - Intergenic
1051931906 9:22395986-22396008 TTGCATCAACCTAACGAGGTAGG + Intergenic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1061966464 9:134016905-134016927 TTGGTTCAGCCTAAAGAGGTGGG + Intergenic
1186730266 X:12402437-12402459 ATGGTGCAACTTACTGAGGTAGG - Intronic
1189290082 X:39878601-39878623 TTGGTTCTTCTTCATGAGGTTGG + Intergenic
1189950366 X:46223867-46223889 TGGGGTCTACTTGATGGGGTAGG + Intergenic
1190082850 X:47370428-47370450 TGGGGCCAAATTAATGAGCTTGG - Intergenic
1194077586 X:89415919-89415941 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1195707053 X:107744825-107744847 TTGGGTCAAGTTAGAGAGATGGG - Intronic
1199471649 X:148202296-148202318 TTGAGTCAAGTTATTGAGTTAGG + Intergenic
1199471718 X:148202942-148202964 TTGGGACAAATTAATGTGTTTGG + Intergenic
1200159449 X:153998429-153998451 TTGGCACAACTCAATGGGGTGGG - Intergenic
1200430235 Y:3071463-3071485 TGGGGTCTACTTGAGGAGGTAGG + Intergenic