ID: 917341875

View in Genome Browser
Species Human (GRCh38)
Location 1:173988067-173988089
Sequence CAATTTCACTAAAGGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917341875 Original CRISPR CAATTTCACTAAAGGGGTGT AGG (reversed) Intronic
900659179 1:3774351-3774373 CTATTTACCTAAGGGGGTGTGGG - Intronic
906148459 1:43573717-43573739 CCATTTCACAAGATGGGTGTGGG - Intronic
907650183 1:56287466-56287488 CAATATCACTAATGGGTTGTTGG - Intergenic
910736683 1:90465961-90465983 AAATTACCCTAAATGGGTGTGGG - Intergenic
913500019 1:119463671-119463693 CCATTTCACCAAAAAGGTGTAGG + Intergenic
917341875 1:173988067-173988089 CAATTTCACTAAAGGGGTGTAGG - Intronic
921678041 1:217998906-217998928 CAATCTCAGTAAGGGGGTCTGGG + Intergenic
921988676 1:221340422-221340444 CAATTTCAGAAAAGGAATGTGGG + Intergenic
1065861436 10:29875737-29875759 CAGTTTCAGTAGAGGGGTGAGGG - Intergenic
1068342997 10:55733224-55733246 CAATTTCACAAAAAGGGGGAGGG - Intergenic
1070406806 10:76104646-76104668 CAAATTCTTTACAGGGGTGTGGG - Intronic
1074587620 10:114783800-114783822 CAAGTTCAGTGAAGGAGTGTTGG - Intergenic
1079195142 11:18319683-18319705 CAATTTCTGTAAAGTGCTGTGGG + Intronic
1086055223 11:82638814-82638836 CATTTTCCCTAAAGGGTTGATGG - Intergenic
1086166323 11:83782933-83782955 CAACTTCACTAACTGGGTATAGG + Intronic
1086431110 11:86737966-86737988 CAATAACAATAAAGGGGTGGAGG - Intergenic
1086701613 11:89905813-89905835 CAATATCACAAGGGGGGTGTAGG - Intergenic
1086704555 11:89938712-89938734 CAATATCACAAGGGGGGTGTAGG + Intergenic
1087294634 11:96356716-96356738 TAATGATACTAAAGGGGTGTAGG - Intronic
1088581124 11:111317872-111317894 CACTTTCCCTAAAGGGGGATGGG + Intergenic
1095357076 12:41287800-41287822 CAAATTCACTGAAGGGGGTTGGG - Intronic
1097173537 12:57129905-57129927 CAGATTTACTAAAGGAGTGTGGG - Intronic
1097720396 12:63013590-63013612 CAATTTCTATAAAAGGGTGATGG + Intergenic
1098276150 12:68813455-68813477 CAAGTTCAATAAAGGGGATTTGG - Intronic
1099184894 12:79505492-79505514 CAGTTTCACTACAGGGGTAATGG - Intergenic
1101139633 12:101781969-101781991 CAATTCTACCAAAGAGGTGTAGG + Intronic
1104171412 12:126285190-126285212 CAATTTCCCTTAAGGGGTTAAGG + Intergenic
1109555147 13:63964226-63964248 CTATTTCCTTAAAGGTGTGTTGG + Intergenic
1110410465 13:75199127-75199149 CAGTTTCACTAAAGTGGTGGAGG + Intergenic
1110553260 13:76830258-76830280 CAAGTTCACTTCAAGGGTGTTGG + Intergenic
1114885526 14:26845040-26845062 TAATTTCAGGAAGGGGGTGTTGG + Intergenic
1115576036 14:34713343-34713365 CAACTTCACAAAAGATGTGTAGG + Exonic
1116020232 14:39451795-39451817 TAACTTCACTAAAGGGATGGGGG + Intergenic
1120376596 14:83716263-83716285 AAATTTGAATAAAGAGGTGTAGG - Intergenic
1120413260 14:84185258-84185280 CAACTTCACTGAAGGGGTCCAGG - Intergenic
1122175565 14:99915918-99915940 CATTTTCACGGAAGGGGTGCTGG + Intronic
1130324797 15:82871368-82871390 CCATTTCCCTACAGGGCTGTGGG + Intronic
1131951372 15:97684652-97684674 CAATACCACAAAAGGTGTGTTGG + Intergenic
1133828986 16:9304499-9304521 GCATGTCAGTAAAGGGGTGTTGG - Intergenic
1135251574 16:20904768-20904790 CAATTTCACTTAAAGGTTATTGG + Intronic
1141246946 16:82316783-82316805 CAAGTTCACCAAATGGGGGTGGG - Intergenic
1141523415 16:84596491-84596513 CAGTTTCACTGGAGAGGTGTTGG - Intronic
1144419965 17:15087559-15087581 CAGTTTCAATAAAGAGGTGAGGG - Intergenic
1149197240 17:54135876-54135898 CTATTTCAGTAAAGGGATCTAGG - Intergenic
1159316524 18:66781510-66781532 CAGAATCATTAAAGGGGTGTAGG + Intergenic
1159338835 18:67107752-67107774 TAATTTCATAAAAGGTGTGTAGG + Intergenic
925966204 2:9068798-9068820 GAATTTCACTGAAGGGCTGGAGG - Intergenic
930404319 2:50935532-50935554 CAATTTCACCAGACTGGTGTTGG - Intronic
937687553 2:124714982-124715004 CAATTTCACATAAGGGATGAGGG + Intronic
939493413 2:142902404-142902426 CCATTTTACTAAATGGGTATTGG + Intronic
939765060 2:146238246-146238268 TAATCTCACCAAAGGGGTGGGGG - Intergenic
940754554 2:157667105-157667127 CAATACCAGTAAAGGGGTGTGGG + Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
941486853 2:166092888-166092910 CAATTTCAAAAAAGGAGTGAGGG - Intronic
943741331 2:191412769-191412791 CAATTTCCCTAAAGACTTGTCGG - Intronic
947202982 2:227632477-227632499 CCTTTTCACTAAAGAGGTGAAGG - Intronic
1170383917 20:15795315-15795337 ATATCTGACTAAAGGGGTGTGGG + Intronic
1170638722 20:18132643-18132665 CGATATCACTGAAGGGGTGGAGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1177953764 21:27570853-27570875 TAATATCACTACAGTGGTGTGGG + Intergenic
949165619 3:937385-937407 CAATTACACTAAAGTGATCTTGG - Intergenic
949869092 3:8571613-8571635 CAATTTACATAAAGGGGAGTGGG - Intergenic
951401225 3:22233658-22233680 TAATTTCAGTGAAGTGGTGTGGG - Intronic
952676137 3:36032414-36032436 CAAGTGCACTAGAGGGATGTGGG + Intergenic
955140178 3:56260856-56260878 CCATGCCACTAAAGGGTTGTGGG - Intronic
956573526 3:70724948-70724970 TAAGTTCACTATAGGTGTGTGGG + Intergenic
964390284 3:156189497-156189519 GTGTTTCATTAAAGGGGTGTTGG + Intronic
965546629 3:169922970-169922992 CAATTTCAGTAGAGTCGTGTTGG + Intronic
966024452 3:175258962-175258984 CAATTTCAGTACAGGCGTGAAGG - Intronic
966301297 3:178482269-178482291 CAATTGGAGTCAAGGGGTGTGGG + Intronic
966560354 3:181312992-181313014 CAATTTCACTCAAAAGGAGTGGG + Intergenic
966627513 3:182034269-182034291 CAATTTAACTAAAGTATTGTAGG - Intergenic
969142117 4:5085590-5085612 CATTTTCACTAATGGCCTGTTGG - Intronic
972295169 4:37730695-37730717 CAATTTCACTGCAGGGGGTTGGG + Intergenic
973932534 4:55807427-55807449 CTCCTTCACTGAAGGGGTGTTGG - Intergenic
976572722 4:86632393-86632415 CAATTTCACAACAGGAGTGTGGG - Intronic
977968334 4:103182540-103182562 CAATTTCAGTAAAATAGTGTTGG + Intronic
980118964 4:128708293-128708315 CCATTCCATTAAAGGGATGTGGG - Intergenic
981540537 4:145842187-145842209 CAATTTTTTTAAAGGGGTTTAGG - Intronic
986046161 5:4040288-4040310 CCATTTCACAAAAGGGAGGTTGG - Intergenic
986218621 5:5745743-5745765 CAACTTCACTAAAGGGGATGGGG - Intergenic
986826287 5:11526353-11526375 CAATTTCACCATAGGCGAGTTGG - Intronic
986925229 5:12739809-12739831 TAATTTCACAAAAATGGTGTGGG + Intergenic
987758677 5:22130355-22130377 CTATTTCAGTAAGGGGGTGATGG + Intronic
988276705 5:29090271-29090293 CAACTTCACTAAAGAGGCTTAGG - Intergenic
989955928 5:50359755-50359777 TAATTTCACTGAAGGAGTGGAGG + Intergenic
989971236 5:50527070-50527092 TAATTTTCCTAAAGGGGTATGGG + Intergenic
992763885 5:79976821-79976843 CAAATACACTAAAGTGGTGATGG - Intronic
997138927 5:131357838-131357860 CAGTTTCAGTAAAGTAGTGTGGG - Intronic
997399354 5:133590678-133590700 CAAACTCACTAAAGGGGAGCAGG - Intronic
997476952 5:134148370-134148392 CATCTCCCCTAAAGGGGTGTGGG + Intronic
999124642 5:149238279-149238301 CAAATTAACTCAAGGGGTCTGGG - Intronic
1000638687 5:163674823-163674845 CAACTTCTCTGAAGGGGTGTGGG - Intergenic
1003853947 6:10253265-10253287 CAATTTCAACAAAGGGGAATAGG - Intergenic
1004953972 6:20706371-20706393 CAAATTCACCAAAGGGTTGGCGG - Intronic
1007114436 6:39333586-39333608 CACTTTGACTAATGTGGTGTTGG - Exonic
1009452960 6:63823193-63823215 CAATTTCACTAAATGCCTGTAGG - Intronic
1009538015 6:64915130-64915152 CAATTTCAGTAATGGGATATAGG - Intronic
1012815006 6:104012453-104012475 CAGTTTCACTAAAGACCTGTAGG + Intergenic
1013300943 6:108804448-108804470 CAAGATAAGTAAAGGGGTGTTGG + Intergenic
1014608470 6:123509565-123509587 CAAGTTCACTATATGGTTGTTGG - Intronic
1020722729 7:11768647-11768669 CAGTTTCATTAAAAAGGTGTCGG + Intronic
1021568199 7:22035556-22035578 CAATTTAATTAAAGGGGAATTGG + Intergenic
1024248256 7:47486825-47486847 CAGTTTCTCTAAAGCCGTGTGGG + Intronic
1024282182 7:47728254-47728276 CAATTTCATCAAAGGGCTGATGG + Intronic
1026213842 7:68330731-68330753 CCATTTCACTAAGGGGTTTTGGG - Intergenic
1030073352 7:105716310-105716332 AAATTTCAATAAAAGGGTGCAGG + Intronic
1030986946 7:116252788-116252810 CCATTTCAATAAAGGTGTCTAGG + Intronic
1033322444 7:140352202-140352224 CACATTCATTAAAGGTGTGTGGG + Intronic
1036932480 8:12969434-12969456 GAATTTTAGTACAGGGGTGTGGG - Intronic
1041372743 8:57180370-57180392 CATTTTCACATAAGGGCTGTTGG + Intergenic
1044374550 8:91454133-91454155 CAAATACTCTTAAGGGGTGTAGG - Intergenic
1044422442 8:92013247-92013269 GATTTTCACAAAAGGTGTGTTGG - Intronic
1050354002 9:4765668-4765690 CCATTTCTCTTAAGGGGTCTTGG - Intergenic
1050905857 9:11004613-11004635 CAATTTAGCAAAAGGGATGTGGG - Intergenic
1051148501 9:14055907-14055929 AAATTTCATAAAAGTGGTGTTGG - Intergenic
1056686556 9:88768436-88768458 CAATCTCATTGAAGGGGTGAAGG - Intergenic
1058727111 9:107814808-107814830 CACTTTCATTAATGGGGTTTGGG + Intergenic
1059200851 9:112414809-112414831 CAATACCACTAGAGGGGTTTTGG - Intronic
1060619422 9:125050259-125050281 CAATTTAAATAAGGGGGTGGAGG + Intronic
1190597892 X:52065256-52065278 CTGCTTCACTGAAGGGGTGTGGG + Intronic
1190610932 X:52188817-52188839 CTGCTTCACTGAAGGGGTGTGGG - Intronic
1193518977 X:82505835-82505857 CACTTTCCATAAAGGGGTTTGGG - Intergenic
1193957515 X:87880351-87880373 CAAGTTCACCATAGGTGTGTGGG + Intergenic
1197649781 X:129051967-129051989 CAATTTGAGGAAAGGGGTGATGG + Intergenic
1197957475 X:131967712-131967734 CAATTTAACTAAAGAAGTGAAGG + Intergenic
1198552553 X:137760059-137760081 TAATTTCAGAAAAGGTGTGTTGG + Intergenic