ID: 917343044

View in Genome Browser
Species Human (GRCh38)
Location 1:173999939-173999961
Sequence AGAGTTTCAAAGTACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917343044_917343048 26 Left 917343044 1:173999939-173999961 CCAGGCTGGTACTTTGAAACTCT 0: 1
1: 0
2: 1
3: 12
4: 228
Right 917343048 1:173999988-174000010 AGTTTATAGTAATTATGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 222
917343044_917343049 27 Left 917343044 1:173999939-173999961 CCAGGCTGGTACTTTGAAACTCT 0: 1
1: 0
2: 1
3: 12
4: 228
Right 917343049 1:173999989-174000011 GTTTATAGTAATTATGGCAAGGG 0: 1
1: 0
2: 2
3: 15
4: 197
917343044_917343047 21 Left 917343044 1:173999939-173999961 CCAGGCTGGTACTTTGAAACTCT 0: 1
1: 0
2: 1
3: 12
4: 228
Right 917343047 1:173999983-174000005 ATAAAAGTTTATAGTAATTATGG 0: 1
1: 0
2: 3
3: 49
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917343044 Original CRISPR AGAGTTTCAAAGTACCAGCC TGG (reversed) Intronic
900836105 1:5005375-5005397 AGAGTTGCAAGGTACCAGACTGG - Intergenic
901346587 1:8549634-8549656 AGAGTGTCAAAGTATCTCCCAGG + Intronic
901725200 1:11236343-11236365 AGAGTTTGACAAGACCAGCCTGG - Intronic
902882510 1:19381997-19382019 AGAGTCTCAAAGGGCCACCCAGG - Intronic
904925329 1:34043115-34043137 AGGGTTTCACAGTATTAGCCAGG + Intronic
906456867 1:46004861-46004883 GGAGTTCCAAAAGACCAGCCTGG + Intronic
906547246 1:46628450-46628472 AGAACTTGAAAGTGCCAGCCTGG + Intergenic
908135158 1:61124533-61124555 AGAGATTCAAATTATCAGCAAGG + Intronic
912058502 1:105634778-105634800 AGGGTTTCACAGTGTCAGCCAGG - Intergenic
913669827 1:121086709-121086731 AGAGTTTCAGAGTACAAGTGGGG - Intergenic
914021590 1:143874107-143874129 AGAGTTTCAGAGTACAAGTGGGG - Intergenic
914660078 1:149782058-149782080 AGAGTTTCAGAGTACAAGTGGGG - Intergenic
915725547 1:158014524-158014546 AGGATTTCAAAGCAGCAGCCAGG + Intronic
917343044 1:173999939-173999961 AGAGTTTCAAAGTACCAGCCTGG - Intronic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
919561544 1:199126143-199126165 AAAATTTCAAAGTTTCAGCCAGG - Intergenic
920155575 1:203947761-203947783 AGAATCACAAAATACCAGCCAGG - Intergenic
922327257 1:224539564-224539586 AGCGTTGTAAAGTCCCAGCCTGG - Intronic
924090693 1:240497943-240497965 AGAGTTTGCAAGTCCCAGCCAGG + Intronic
1066675256 10:37880851-37880873 AGAAATTCAAAGAACCAGCTCGG - Intergenic
1067304397 10:45047447-45047469 AGGGTTTCACTGTGCCAGCCAGG - Intergenic
1067692426 10:48510400-48510422 ACATTTTCCAAGTACCAGACAGG - Intronic
1067751038 10:48971301-48971323 AGAGTTTCACCGTATTAGCCAGG - Intronic
1073545954 10:104349053-104349075 AGAGTTTCAACGTGTTAGCCAGG - Intergenic
1074764974 10:116694033-116694055 AGAGTTTAAAATCACCTGCCTGG - Intronic
1076103936 10:127805110-127805132 AGCTTTTCCAAGCACCAGCCAGG - Intergenic
1077351500 11:2095193-2095215 AGAGTTTCAGAGGTGCAGCCAGG + Intergenic
1079344123 11:19637170-19637192 AAAGCTTCAAAGTACCTTCCTGG + Intronic
1079630481 11:22668049-22668071 ACAGTTTGGATGTACCAGCCTGG + Intronic
1079669881 11:23155206-23155228 TGAAGTTCAAAGTACCAACCTGG + Intergenic
1085065475 11:73491577-73491599 ATAGTTTCTAAGTAACAGACCGG + Intronic
1086462054 11:87015794-87015816 GGAGTTTCACCGTACTAGCCGGG + Intergenic
1086477347 11:87191432-87191454 AGAGTTTCACAGTGTTAGCCAGG + Intronic
1086549146 11:88033918-88033940 AGAGTTTCAACGTGTTAGCCAGG + Intergenic
1087097079 11:94329326-94329348 AGAGTTTCACCGTATTAGCCAGG + Intergenic
1087748044 11:101972231-101972253 AGAGTTTCACAGTGTTAGCCAGG - Intronic
1091497466 12:985000-985022 AGGGTTTCACAGTATTAGCCAGG + Intronic
1091661379 12:2386329-2386351 AGAGTTGAGAAGCACCAGCCAGG + Intronic
1092695781 12:11170249-11170271 AGAGTTTGGAAGTACAGGCCGGG + Intronic
1093236544 12:16615420-16615442 AGAGTTTCAAAGGACCAGGCAGG + Intergenic
1095255522 12:40031412-40031434 AGGGTTTCAAAATATCAGCCAGG + Intronic
1096067750 12:48754641-48754663 AGAGTTTCACTGTATTAGCCAGG + Intergenic
1097293818 12:57942207-57942229 CAAGTTTTAAAGTGCCAGCCAGG + Intronic
1099902942 12:88735158-88735180 AGGGTTTCACTGTATCAGCCAGG + Intergenic
1099919719 12:88942480-88942502 AGAGTTTCAAAGTCTCAGTATGG + Intergenic
1102626557 12:114239881-114239903 AGAAGTTCAAAGTGCCACCCAGG + Intergenic
1103752860 12:123178200-123178222 AGAGCTTAAAAGAACAAGCCAGG - Intronic
1104829438 12:131739734-131739756 AGGGTTTCACTGTACTAGCCAGG + Intronic
1105002499 12:132700065-132700087 AGAGTTTCACTGTGTCAGCCAGG + Intronic
1106486663 13:30178912-30178934 GGAATTTCAAAGAACCATCCTGG - Intergenic
1108929308 13:55795513-55795535 TGAGTGTCAAAGGACCACCCAGG + Intergenic
1109787975 13:67206451-67206473 AGACTTTAACAGTATCAGCCGGG - Intronic
1111104137 13:83623828-83623850 AGAATTTCCAAGGACCAGCCAGG + Intergenic
1112142268 13:96657813-96657835 AGTGTTTGAAATTACCACCCAGG + Intronic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1117011199 14:51472494-51472516 AGAGTTTCACCGTGCTAGCCAGG + Intergenic
1117473777 14:56073294-56073316 AGAGTTTGAAGGCACCAGGCTGG - Intergenic
1117755433 14:58970101-58970123 AGAGCTCCAAAGCCCCAGCCAGG - Intergenic
1118121298 14:62846991-62847013 AGAGTTTCACAGTGTTAGCCAGG + Intronic
1118429026 14:65697008-65697030 AGAGTTTGCAAGTAACAGACTGG - Intronic
1119411928 14:74437578-74437600 AAACATTCAAAGTACCTGCCAGG + Intergenic
1123413488 15:20078648-20078670 TGAGTTTGAAAGTGTCAGCCGGG + Intergenic
1123522830 15:21085760-21085782 TGAGTTTGAAAGTGTCAGCCGGG + Intergenic
1127135483 15:55918019-55918041 ATTGTTTCAAAGTACCAGCAGGG - Intronic
1127993237 15:64135949-64135971 AGCTTTTCAAAGACCCAGCCAGG - Intronic
1128274167 15:66338619-66338641 AGGGTTTCACCGTATCAGCCAGG - Intronic
1129304709 15:74651193-74651215 AGAATTTCAAATTACAAGTCTGG + Intronic
1130579708 15:85125013-85125035 ATAGTTTCATACTGCCAGCCTGG - Intronic
1131670167 15:94611356-94611378 AGAGTTACAGAGTCCCCGCCAGG + Intergenic
1131674306 15:94655372-94655394 AGAGTCTTAAAGTATCACCCAGG - Intergenic
1133452930 16:5918701-5918723 AGAGTTACAAAGTACCCACTAGG + Intergenic
1136472075 16:30487729-30487751 AGAGTTTCACTGTGTCAGCCAGG + Intronic
1139093205 16:63674425-63674447 AGAGTTTCAACGTGTTAGCCAGG + Intergenic
1139353005 16:66349307-66349329 AAAGTTACAAAGTGTCAGCCAGG + Intergenic
1139719158 16:68838910-68838932 AGAGGTTAAAATTTCCAGCCTGG - Intergenic
1142413578 16:89928715-89928737 AGGGTTTCACTGTGCCAGCCAGG + Intronic
1143451928 17:7041843-7041865 AGAGGATCAAAGAACCAGACAGG + Exonic
1143962514 17:10732261-10732283 TGACTTTGAAAGTCCCAGCCGGG - Intergenic
1144005123 17:11092792-11092814 AGAGTTTCACTGTGCTAGCCAGG - Intergenic
1144535961 17:16092296-16092318 AAAGATACAAAATACCAGCCAGG - Intronic
1144546063 17:16196989-16197011 AGAGTTTCATTGTATCACCCAGG - Intronic
1145349952 17:22072938-22072960 AGAGTTTCATTGTATCACCCAGG - Intergenic
1146029931 17:29357055-29357077 AGATTTTAAAATTACTAGCCAGG - Intergenic
1147335421 17:39724601-39724623 GAAGGCTCAAAGTACCAGCCTGG - Intronic
1147407963 17:40227065-40227087 AGAGTTTCACTGTGTCAGCCAGG + Intronic
1148916484 17:50984389-50984411 ATTATTTAAAAGTACCAGCCGGG + Intronic
1149114807 17:53080357-53080379 AGAGTTTGACATTTCCAGCCTGG + Intergenic
1152299667 17:79487716-79487738 AGGGTTTCACAGTGCTAGCCAGG - Intronic
1152611823 17:81318764-81318786 AGAGTTTCCCAGTGCCGGCCGGG + Intronic
1153777105 18:8463813-8463835 CAATGTTCAAAGTACCAGCCAGG + Intergenic
1154474738 18:14745338-14745360 AGAGTTTCACTCTACCATCCAGG - Intronic
1155678318 18:28457870-28457892 AAAGTTTCAAAGTGTCATCCCGG - Intergenic
1156331082 18:36123857-36123879 AGAGTTCTTAAGTACCAGTCAGG - Intronic
1158296774 18:56006310-56006332 AGTGTTTCACATTAACAGCCTGG + Intergenic
1159485054 18:69044916-69044938 AGAATCTCAAAGTATCAGCCAGG + Intronic
1159765492 18:72483092-72483114 AAAGTTCCAAAGCCCCAGCCTGG + Intergenic
1161398360 19:4056674-4056696 AGAGTTTCACTGTGTCAGCCAGG - Intronic
1161819504 19:6521032-6521054 AGAGTTGCAAGGTACAGGCCAGG - Intergenic
1163459212 19:17426253-17426275 AGAGTTTCACCGTGCTAGCCAGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166027953 19:40106096-40106118 AGACATTCAAACTACCAGTCAGG - Intergenic
925081951 2:1077361-1077383 AGAATTTTAAACTACCAGGCAGG - Intronic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
926732086 2:16043124-16043146 AGAGTTTAAAAATAACGGCCGGG - Intergenic
926792242 2:16585728-16585750 AAATATTCAAAGTACCAGACTGG + Intronic
927166102 2:20323253-20323275 AGAGTTTCACAGTGTTAGCCAGG - Intronic
927768901 2:25841000-25841022 AGAGTATAAGACTACCAGCCAGG + Intronic
930079818 2:47436578-47436600 AAAGTTACAAATTCCCAGCCTGG - Intronic
931416382 2:62085510-62085532 AAAGTTTCAAACTATAAGCCAGG - Intronic
934084397 2:88497922-88497944 GAAGTTTCAAAGGACTAGCCTGG + Intergenic
935524497 2:104148890-104148912 AGAGTTTCTTTGTACAAGCCTGG + Intergenic
937394042 2:121519036-121519058 AGACTTTCTAAGTAGCTGCCTGG - Intronic
938563486 2:132495661-132495683 ACAGTTTCAAATTTCCTGCCAGG + Intronic
939430082 2:142093058-142093080 AGAATGTGAAAGTACCAGACAGG - Intronic
940147461 2:150561630-150561652 AGAGTTTCACAGTGTTAGCCAGG - Intergenic
940250350 2:151668961-151668983 AGAGTTGCAAAGAACCAGAAAGG + Intronic
943169578 2:184380252-184380274 ATAGTTTCAAAGCAACAGACAGG + Intergenic
947369076 2:229426246-229426268 AGGGTTTCACAGTATTAGCCAGG - Intronic
948260970 2:236604172-236604194 ATTGTTTGAAAGTACCAGCTTGG - Intergenic
1169892855 20:10472421-10472443 AGAGTTTCACAGTGTTAGCCAGG + Intronic
1171021592 20:21588953-21588975 ATAGTTTCAGAAAACCAGCCAGG - Intergenic
1171328027 20:24312975-24312997 AGAGTTCCAGAGTTCCAGGCAGG + Intergenic
1172831434 20:37838590-37838612 TAAGTTTAAAAGAACCAGCCAGG + Intronic
1173061109 20:39662004-39662026 GGAGTGTCAAAGTACCAGTGTGG - Intergenic
1177124265 21:17176302-17176324 AGAGTTTCATTGTATCACCCAGG - Intergenic
1177637175 21:23802432-23802454 AGAGTTTCAAAGGACTAGAAAGG - Intergenic
1181307327 22:21924168-21924190 AGATTTTCTAAGTACCAGGAAGG + Intronic
1181425745 22:22837386-22837408 AGGGTTTCACAGTATTAGCCAGG + Intronic
1182820740 22:33214019-33214041 AGCGTTTCACCGTACTAGCCAGG + Intronic
1184626265 22:45733437-45733459 AAAGTTACAAAGTTTCAGCCAGG + Intronic
949266392 3:2161481-2161503 AGAGGTACAAGGAACCAGCCTGG + Intronic
953196200 3:40736097-40736119 AGAGTATCAAAGTACAGTCCAGG + Intergenic
954083955 3:48229375-48229397 AGAGTTTCATCGTATTAGCCAGG + Intergenic
955330511 3:58043342-58043364 AGAATGCCAAATTACCAGCCTGG - Intronic
955983650 3:64551400-64551422 AGGGTTTCACAGTATTAGCCAGG + Intronic
956012072 3:64842682-64842704 AGAGTTTCACCATGCCAGCCAGG + Intergenic
958913162 3:100017962-100017984 AGAGTTTCAAAGTCTTTGCCTGG - Intronic
959188826 3:103083314-103083336 AGAGTTTCACCGTGCTAGCCAGG + Intergenic
959929967 3:111969686-111969708 AGCGTGTCAAAGGACGAGCCTGG - Exonic
960449315 3:117786963-117786985 AAAGTTCCAAAGAACAAGCCAGG - Intergenic
960534188 3:118798717-118798739 AGAGCTTCAATGTGGCAGCCAGG - Intergenic
960664562 3:120096136-120096158 AGTGTTTCAAAGCAAGAGCCAGG - Intergenic
962287549 3:134100474-134100496 AGAGTTTCACAGTGTTAGCCAGG + Intronic
965030604 3:163361510-163361532 AGGGTTTCACCGTATCAGCCAGG - Intergenic
965313719 3:167164194-167164216 AGAATTTCAAAGCAGCATCCTGG - Intergenic
967010659 3:185430168-185430190 AGAGTTTCACTGTATCAACCAGG - Intronic
967722020 3:192826009-192826031 ACAGTTTCCCAGCACCAGCCTGG - Intronic
970711364 4:18867183-18867205 AGAATTTCAAAGAAACGGCCAGG - Intergenic
971039528 4:22736046-22736068 AGAGTTTTCAAGAACCAGACTGG + Intergenic
973186142 4:47331280-47331302 ACAGTTTCAAAGAAGCAGGCTGG - Intronic
974694354 4:65345963-65345985 AGAGTTTCACCGTATTAGCCAGG + Intronic
976086839 4:81415527-81415549 AGGGTTTCAAAGTGTTAGCCAGG - Intergenic
976877112 4:89866703-89866725 GGAGTTTCACCGTACTAGCCAGG + Intergenic
977403513 4:96564978-96565000 AGAGATCCAAAGCACCATCCTGG + Intergenic
977525972 4:98145312-98145334 AGAGTTTCTGAGTACCAGCTAGG + Intergenic
979801258 4:124912415-124912437 AGAGTTTCACAGTGTTAGCCAGG + Intergenic
980800785 4:137746918-137746940 AGAGTTTCACTGTATCACCCAGG + Intergenic
982431533 4:155327269-155327291 AGAGTTTCAACATACAAACCTGG + Intergenic
983507174 4:168566322-168566344 AGAGTCTCACAGTATCACCCAGG + Intronic
983697701 4:170553052-170553074 AGAGTTTCATAGCCACAGCCAGG - Intergenic
985087894 4:186332687-186332709 GGAGTTTGAAACGACCAGCCTGG - Intergenic
985239828 4:187918132-187918154 AGAGTTTCACACTGCCACCCAGG - Intergenic
986803420 5:11284844-11284866 AGAGAGGCAAAGTTCCAGCCTGG - Intronic
987919620 5:24262690-24262712 AGAGTTTCACTGTATTAGCCAGG - Intergenic
988103566 5:26712902-26712924 GGAGTTTCAAGATACCAGTCAGG - Intergenic
988501487 5:31787562-31787584 AGAGTCTCAAAATAGCTGCCAGG + Intronic
989542146 5:42629965-42629987 AGATTGTCAAAGGACCAGCGGGG - Intronic
991141779 5:63252675-63252697 AAAGTTTCAAAGTACAAATCTGG - Intergenic
991698497 5:69296073-69296095 AGAGTTTCACCGTGCTAGCCAGG + Intronic
995158326 5:108943186-108943208 AGAGTTTCATGGTACCAGGCTGG - Intronic
995256050 5:110048186-110048208 AGAGTTGCAAAATACCAAGCAGG + Intergenic
996582999 5:125052479-125052501 AGGGTTTCACAGTATTAGCCAGG + Intergenic
997609815 5:135208001-135208023 ACAGTTTCAAAGTGCAAGGCTGG + Intronic
999221184 5:149979132-149979154 ACAGTTTCATATTATCAGCCAGG + Intronic
999332167 5:150682336-150682358 AGGTTTTAAAAGTACCAGTCAGG - Intergenic
999933240 5:156456542-156456564 AGAGTTTAGAAGTCTCAGCCTGG + Intronic
1001519515 5:172381236-172381258 AGGGCTGAAAAGTACCAGCCAGG - Intronic
1002878477 6:1231945-1231967 AGAGTTAGAAAGTGCCAGCAAGG + Intergenic
1004915492 6:20328247-20328269 GGAGTTTGAAACCACCAGCCCGG - Intergenic
1006279173 6:33033727-33033749 AGAGGTTGAAAGTACAAGGCAGG - Intergenic
1006974276 6:38083298-38083320 ATAGTTTCAAAGTAACATCCAGG + Intronic
1007583107 6:42971174-42971196 AGAGTTTCATAATACTAACCTGG - Intronic
1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG + Exonic
1007592531 6:43031211-43031233 AGGGTTTCACTGTACTAGCCAGG - Intronic
1007734394 6:43971701-43971723 AGCTTTTCAAAGTACAAACCTGG - Intergenic
1007770310 6:44186708-44186730 AGAGTCTCAAAGGACCTGCTAGG - Intergenic
1010413740 6:75589990-75590012 AGACTTTCAAATTACAAACCAGG - Intergenic
1013432333 6:110066299-110066321 AGAGTTTCCAGGTGCCAGCCAGG + Intergenic
1014420971 6:121245291-121245313 AGATATTCACAGCACCAGCCTGG + Intronic
1014589972 6:123252779-123252801 AGATATTCAAAGAATCAGCCAGG - Intronic
1014764601 6:125392268-125392290 AGGGTTTCACCGTATCAGCCAGG - Intergenic
1015747940 6:136530565-136530587 AGAGTGGCAAAGAACCAGCTGGG - Intronic
1017278577 6:152598582-152598604 AGAGTTTCAAAATAGCATCATGG + Intronic
1018281674 6:162192797-162192819 AGAATTTCAAACTAGCAGCATGG + Intronic
1020050766 7:5080172-5080194 AGGGTTTCAATGTGTCAGCCAGG - Intergenic
1022923548 7:35038212-35038234 AGAGTATTAAAATAGCAGCCTGG + Intronic
1025042182 7:55656367-55656389 AGAGTTTCAACGTATTAGCCAGG - Intergenic
1025921748 7:65919862-65919884 AGAGTTTCACTGTGTCAGCCAGG - Intronic
1026070009 7:67110373-67110395 AGAGTTGCAAACTGCCTGCCTGG + Intronic
1026272226 7:68846401-68846423 GGAGTTTGAAACCACCAGCCTGG - Intergenic
1026706899 7:72701890-72701912 AGAGTTGCAAACTGCCTGCCTGG - Intronic
1027784940 7:82569021-82569043 AGAGTTTCAGATTTCCAGCTGGG - Intergenic
1028225325 7:88244516-88244538 AGACTTTCCAAGTACCTGCTTGG - Intergenic
1028351235 7:89851958-89851980 AGAGTTATAAAGTAGCAGACAGG - Intergenic
1028399850 7:90413099-90413121 AGAGGCTCACAGTACCTGCCAGG - Exonic
1028992434 7:97063525-97063547 AGACCTTCAAAGTCCCAGACAGG - Intergenic
1029843081 7:103386372-103386394 AGAGTTTCATCGTGTCAGCCAGG - Intronic
1030329058 7:108253604-108253626 TGAGTTTCAAAGTGCCAAGCTGG + Intronic
1032836310 7:135678146-135678168 AGGGTTTCAACGTCCCACCCTGG - Intronic
1033722832 7:144079762-144079784 AGAGGTTCATAGCACCAGCAAGG - Intergenic
1034005745 7:147470136-147470158 AGACTTTTAAAGGATCAGCCTGG + Intronic
1035652341 8:1277611-1277633 GGAGTATCGAAGTATCAGCCAGG + Intergenic
1035856690 8:2983377-2983399 AGAGTTTCACTGTATTAGCCAGG + Intronic
1036188384 8:6646127-6646149 ATAATTACAAAGTATCAGCCAGG + Intergenic
1038962177 8:32533696-32533718 AAAATTTCAATGTACCTGCCAGG + Intronic
1039228384 8:35415645-35415667 AGAAATTCAAAGTAGCTGCCTGG - Intronic
1039708507 8:40031921-40031943 TGAATTTCAAAGTAACAGCAAGG - Intergenic
1042063710 8:64849678-64849700 AGAGTTTAAGACCACCAGCCTGG - Intergenic
1044787034 8:95805409-95805431 ACAGTTTCAAAGATCCAACCAGG + Intergenic
1046909170 8:119607124-119607146 AGAGATTGAAAGTTCCAGACAGG - Intronic
1047533346 8:125697139-125697161 AGAGTTTCAAAGTATTCGGCTGG - Intergenic
1050824336 9:9926147-9926169 AGAATTTAGAAGTACAAGCCTGG - Intronic
1051025540 9:12606331-12606353 AGACTTTCAAAATAGCAGCATGG + Intergenic
1053549118 9:39056922-39056944 AGGGTTTCAAAGTGTTAGCCAGG + Intergenic
1055441285 9:76338882-76338904 AGAACTTCAAAGTATCAGCCTGG - Intronic
1056188123 9:84156728-84156750 AGAGTCTCACACTACCACCCAGG - Intergenic
1057629010 9:96704669-96704691 AGAGCTTCAAAATACAAGCTAGG + Intergenic
1058765200 9:108175767-108175789 GGAGTTTCACAGTGTCAGCCAGG + Intergenic
1060504851 9:124190019-124190041 GGAGTTTCACCGTACTAGCCAGG - Intergenic
1060991414 9:127851583-127851605 AGAAAGTCAAAGTCCCAGCCAGG + Intronic
1060996889 9:127879172-127879194 AAAGTTTTAAAGTGCCAGCAGGG + Intergenic
1186356127 X:8792379-8792401 AGAGTTTAATAGTACAAGCAAGG + Intronic
1186794936 X:13037230-13037252 AGAGTTTAATAGTACAAGCAAGG + Exonic
1188750351 X:33897563-33897585 AGAGTTTTAAAGAATTAGCCAGG + Intergenic
1191029291 X:55950703-55950725 AGAGGTTCAAAGTATCACCAGGG - Intergenic
1193386035 X:80872444-80872466 AGAATTTCAAAGGACTGGCCGGG - Intergenic
1196718593 X:118832919-118832941 AGAGTTTCAAATCCCCAGGCCGG + Intergenic
1197025256 X:121740213-121740235 GGAGTATGAAAGCACCAGCCTGG + Intergenic
1198487805 X:137105957-137105979 AGGCTTTCAAGGTATCAGCCAGG + Intergenic
1199815597 X:151394395-151394417 GGAGTGTAAAAGTGCCAGCCTGG + Intergenic
1201379329 Y:13356346-13356368 AGAGTTTCAACGTGTTAGCCAGG + Intronic
1201893899 Y:18973236-18973258 GGAGTTTCACAGTATTAGCCAGG + Intergenic