ID: 917352279

View in Genome Browser
Species Human (GRCh38)
Location 1:174090624-174090646
Sequence ACTTTAACCCAAGAGATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917352279_917352280 13 Left 917352279 1:174090624-174090646 CCACAAATCTCTTGGGTTAAAGT No data
Right 917352280 1:174090660-174090682 TTCCTCTCTGCAGCTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917352279 Original CRISPR ACTTTAACCCAAGAGATTTG TGG (reversed) Intergenic