ID: 917355393

View in Genome Browser
Species Human (GRCh38)
Location 1:174121819-174121841
Sequence TGTGCATAAGCATGCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917355388_917355393 19 Left 917355388 1:174121777-174121799 CCTTTTTTTTCTGTGTGCGGGTG 0: 1
1: 0
2: 3
3: 44
4: 420
Right 917355393 1:174121819-174121841 TGTGCATAAGCATGCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917355393 Original CRISPR TGTGCATAAGCATGCACTGT GGG Intergenic