ID: 917359311

View in Genome Browser
Species Human (GRCh38)
Location 1:174159306-174159328
Sequence CTGCGTGGCCGCGGTTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917359311_917359314 12 Left 917359311 1:174159306-174159328 CCGGCGCAACCGCGGCCACGCAG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 917359314 1:174159341-174159363 GCGTGTGCGCCGCCGCCGCCCGG 0: 1
1: 0
2: 2
3: 13
4: 194
917359311_917359317 21 Left 917359311 1:174159306-174159328 CCGGCGCAACCGCGGCCACGCAG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 917359317 1:174159350-174159372 CCGCCGCCGCCCGGCAGAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 113
917359311_917359315 20 Left 917359311 1:174159306-174159328 CCGGCGCAACCGCGGCCACGCAG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 917359315 1:174159349-174159371 GCCGCCGCCGCCCGGCAGAGTGG 0: 1
1: 0
2: 3
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917359311 Original CRISPR CTGCGTGGCCGCGGTTGCGC CGG (reversed) Intergenic
900340267 1:2185236-2185258 CTGCGTCGCGGCGGATCCGCGGG + Exonic
900494433 1:2970088-2970110 CTGGGTGGCCGGTGGTGCGCCGG - Intergenic
909629762 1:77759493-77759515 CTGGGTGGCGGCGGGTTCGCGGG - Intronic
909647579 1:77934655-77934677 CTGGGTGGCCCAGGTTGCGTGGG + Intronic
914428228 1:147598861-147598883 CTGTGTGGCCCCGGTTGCTGCGG - Intronic
917346549 1:174034078-174034100 CTGCCTGGGCGCGGTGGCTCAGG + Intergenic
917359311 1:174159306-174159328 CTGCGTGGCCGCGGTTGCGCCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
921946584 1:220889971-220889993 CTGCGTGGCAGCCCCTGCGCTGG + Intergenic
1072770689 10:98134898-98134920 CTGCGGGCCCGCGGTTGAGAGGG + Intronic
1072891698 10:99330049-99330071 CTGCGTGGCTGCGGGCGCTCGGG + Exonic
1077038475 11:506920-506942 AGGCGGGGCCGAGGTTGCGCTGG - Intronic
1101466919 12:104958352-104958374 CGGCGCGGCTGCGCTTGCGCGGG - Intronic
1104923318 12:132302662-132302684 CTGCGTGGAAGCGGCTGCCCTGG - Intronic
1113491369 13:110694560-110694582 CTGGGAGGCGGAGGTTGCGCTGG + Intronic
1121716261 14:96078226-96078248 CTGTGTTGCCACGGTTGCGATGG - Intronic
1122355332 14:101119802-101119824 CTGCGAGCCCGTGGTTGAGCGGG + Intergenic
1122615150 14:103012364-103012386 GTGCGTGGCTGCAGTTGCTCAGG - Intronic
1132685060 16:1158791-1158813 CTGCGGGGCCGGGGGTGCGGCGG - Intronic
1133188265 16:4115712-4115734 CCGCGTGGCCGCCGTGGCTCCGG + Exonic
1137404192 16:48176954-48176976 CTTCGTGGCCGCGGATGGTCAGG + Exonic
1137721178 16:50628364-50628386 CTGCCTGGCTGGGGCTGCGCTGG + Intronic
1143077347 17:4355565-4355587 CTGGGAGGCCGAGGTTGCGGTGG + Intronic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1148652590 17:49260487-49260509 AGGCGTGGCCGGGGTTGGGCTGG - Intergenic
1152262031 17:79272525-79272547 CTGCGTGGCCCCGCGTGGGCAGG - Intronic
1160824922 19:1074996-1075018 CTGCGAGGCCGCGCATGCGCAGG - Intronic
1160843663 19:1157313-1157335 CTGCGTGGCAGAGGCTGCGTTGG - Intronic
1161078870 19:2300614-2300636 CCGCGTGGCCGGGGTTACGCTGG - Intronic
1163321488 19:16577352-16577374 CTGGGTGGCCGAGGTCACGCTGG + Exonic
1164594665 19:29525521-29525543 CTGGGTGGCGGCGGCAGCGCCGG - Intergenic
1165363709 19:35351584-35351606 CTATGTGGCCGCCTTTGCGCTGG + Exonic
1166931416 19:46303774-46303796 GTGCTGGGCCGCGGCTGCGCAGG - Intronic
1168414548 19:56160105-56160127 CTGCCCGGCCGTGGATGCGCTGG - Exonic
929659915 2:43773998-43774020 CGTCGCGGCCGCGGTTGCGTGGG - Intergenic
929983162 2:46699400-46699422 CTGCCTGGCCGCAGGTGCCCTGG + Intronic
935591846 2:104852338-104852360 CTGCCTGGCTGCGGCTGGGCAGG + Intergenic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
944743703 2:202635501-202635523 CTGCGTGGCCACCGTGGGGCTGG - Exonic
946327635 2:218992985-218993007 TTGCCTGGCCGCGGCTGGGCTGG - Intronic
1172408144 20:34704380-34704402 CGGCGGGGCCGCGGTCGCTCCGG - Exonic
1175833753 20:61980836-61980858 CTGCAAGGCCGCGGTGGGGCGGG + Intronic
1176155390 20:63617589-63617611 CTCCGTGGCCGCGGCTGCCGGGG - Intronic
1179561579 21:42219186-42219208 CTGCGGGGCCGAGGCTGCGCTGG - Exonic
1183260981 22:36795692-36795714 CTGCGTGGCCGCAGATGCCTTGG + Intergenic
950610680 3:14124832-14124854 TGGCCTGGCCGCGGTTGCGAGGG - Exonic
965597055 3:170419959-170419981 CTGCGGGGCTGCGGTGACGCCGG + Intronic
969239156 4:5888095-5888117 CTGCGTCGCCGCGGGTGGGGCGG - Intronic
969415535 4:7055516-7055538 CCGCGTGCCCGGGGCTGCGCTGG - Exonic
972162535 4:36244340-36244362 CTGCCTGGCGGCGGCCGCGCGGG + Exonic
978777047 4:112515259-112515281 CGGCGTGGCTGCGGGTGCGGAGG - Exonic
996862634 5:128083634-128083656 CTGCGGGACCGCGGGTGGGCGGG + Intergenic
999268818 5:150284545-150284567 CTGTGTGGGGGCGGCTGCGCGGG + Intronic
1017648688 6:156562246-156562268 CTGCCTGGCAGCGGGTGCGAGGG + Intergenic
1018923716 6:168192976-168192998 CTGGGTGCCCGCGGCCGCGCTGG + Intergenic
1019411253 7:907788-907810 CTGCGTGGCCAGGGTCGAGCAGG + Intronic
1023254815 7:38302394-38302416 CAGCGTGGCCGTGGCTGCCCTGG - Intergenic
1033333726 7:140435319-140435341 CTGGGTGGCTGCGGCTGTGCTGG + Intergenic
1034908550 7:154973008-154973030 CTGCCTGGACGCGGATGTGCAGG + Intronic
1034957195 7:155342337-155342359 CTGCGTGGCTGTGGTTTCCCCGG + Intergenic
1039885929 8:41653931-41653953 CTGCCTGGCCGGGGGTGCACCGG + Intronic
1040495321 8:47960714-47960736 CTGCGCGGCAGCGTTTTCGCGGG - Intronic
1045112015 8:98945180-98945202 CTGCGCTGCCGCGGCTGCCCCGG - Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1048046795 8:130780554-130780576 CTCCCTGGCCGCGGTTGTCCTGG - Exonic
1051174170 9:14347014-14347036 CTCCCTGGCCGCGATTTCGCTGG - Intronic
1056548687 9:87634307-87634329 CTCTGTGGCCTCGGCTGCGCTGG + Intronic
1056732607 9:89178639-89178661 CTGCGCGGCCGCCGCTGTGCTGG - Exonic
1061204102 9:129153102-129153124 CTGAGTGGCCACTGTTGCCCTGG + Intergenic
1061212179 9:129200149-129200171 CTGCGTGCCCGCCACTGCGCTGG - Intergenic
1197693071 X:129523218-129523240 CTCCGTGGCCGCGGTGGCTTCGG + Exonic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic