ID: 917361130

View in Genome Browser
Species Human (GRCh38)
Location 1:174177301-174177323
Sequence ATCCTTCGCCTACTTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3619
Summary {0: 4, 1: 7, 2: 90, 3: 376, 4: 3142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917361128_917361130 14 Left 917361128 1:174177264-174177286 CCGCATAAATGTCTTCTTTTGAG 0: 1580
1: 1463
2: 1351
3: 2048
4: 4205
Right 917361130 1:174177301-174177323 ATCCTTCGCCTACTTTTGATGGG 0: 4
1: 7
2: 90
3: 376
4: 3142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917361130 Original CRISPR ATCCTTCGCCTACTTTTGAT GGG Intronic
Too many off-targets to display for this crispr