ID: 917361440

View in Genome Browser
Species Human (GRCh38)
Location 1:174180904-174180926
Sequence TAAAGCATGAAACAAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917361440_917361443 15 Left 917361440 1:174180904-174180926 CCTGGTACTTGTTTCATGCTTTA 0: 1
1: 0
2: 2
3: 9
4: 202
Right 917361443 1:174180942-174180964 TTAAGATCAATATGTGAAGTGGG 0: 1
1: 0
2: 2
3: 21
4: 215
917361440_917361442 14 Left 917361440 1:174180904-174180926 CCTGGTACTTGTTTCATGCTTTA 0: 1
1: 0
2: 2
3: 9
4: 202
Right 917361442 1:174180941-174180963 TTTAAGATCAATATGTGAAGTGG 0: 1
1: 0
2: 0
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917361440 Original CRISPR TAAAGCATGAAACAAGTACC AGG (reversed) Intronic
900078552 1:837352-837374 TAAAGCTTAAAACAGTTACCCGG - Intergenic
901134195 1:6982593-6982615 TAGATCATGAGACAAGTACTTGG - Intronic
901787260 1:11632899-11632921 TAGTGCATGAAAGAAGCACCAGG + Intergenic
902347596 1:15829800-15829822 TACAGCATGTTACAATTACCTGG - Intergenic
902452108 1:16503011-16503033 TAAAGCAAGAATCTAGTTCCAGG - Intergenic
902500837 1:16910640-16910662 TAAAGCAAGAATCTAGTTCCAGG + Intronic
905170235 1:36105583-36105605 TAAAGCATGAGGCCAGTGCCTGG - Intronic
905253997 1:36668396-36668418 TAAAGCCTGAGACAAGGACCTGG + Intergenic
906180527 1:43814574-43814596 TAAACCATGAAACTGGAACCTGG - Intronic
906268776 1:44457455-44457477 TGAAGCATGAATGAAGTAACTGG + Intronic
906618465 1:47253143-47253165 TAAAGCATTAATAGAGTACCTGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
914265526 1:146035235-146035257 TACTGCAGGAAAGAAGTACCGGG + Intergenic
915224726 1:154404169-154404191 AAAAGAAAGAAACAAGCACCTGG - Intergenic
915850429 1:159315930-159315952 GAAAGAAAGAAACAACTACCTGG + Intergenic
917315180 1:173717320-173717342 TAAAGCAAGAAAAAAGGAGCAGG - Intronic
917361440 1:174180904-174180926 TAAAGCATGAAACAAGTACCAGG - Intronic
918712465 1:187748469-187748491 AAAAGCATGACACAGGTATCTGG - Intergenic
919263030 1:195222562-195222584 GAAAGCATGAAACACAGACCCGG - Intergenic
919643116 1:200064896-200064918 TTAAATATGAAACAAGGACCAGG - Intronic
923439584 1:234003690-234003712 GACAGCATGAAACCAGTTCCAGG + Intronic
1066596332 10:37054320-37054342 TGAATAATGAAACAAGTACAAGG - Intergenic
1068396849 10:56473256-56473278 TAAACCATGAAATAAATACAAGG - Intergenic
1068409007 10:56630180-56630202 TAAAGCATTACACCAGTACAGGG + Intergenic
1074126427 10:110532042-110532064 TAAAGTATGAAACAAGTCTTTGG + Intergenic
1074279805 10:112040207-112040229 TAAAGTATAAAACAAGAATCAGG - Intergenic
1077575772 11:3382237-3382259 TATAGCAGAAAACAAATACCTGG - Intergenic
1077814682 11:5675387-5675409 TAGAGCCTGAGACAAGGACCTGG + Intronic
1078965823 11:16340884-16340906 TAGATCATGAAACAACTACCAGG - Intronic
1081524120 11:43912488-43912510 TAAAACAAGAAACAGGTAGCAGG + Intronic
1084704089 11:70805913-70805935 GATAGCATCAAACAAGTCCCTGG - Intronic
1084791307 11:71476869-71476891 TAATGCACGAAACAACTGCCTGG - Intronic
1085003221 11:73060594-73060616 CAAAGCATGAAATAATTACATGG - Intronic
1085877191 11:80423032-80423054 CTAAGCATGAAATGAGTACCAGG - Intergenic
1087563564 11:99822622-99822644 GAGAGCAGGAAATAAGTACCAGG + Intronic
1087810558 11:102605550-102605572 CAAAACAAGAAGCAAGTACCTGG - Intronic
1088619159 11:111664313-111664335 GAGAGCATGAAATAAGAACCAGG + Intronic
1090476463 11:127026284-127026306 GAAAGAAAGAAACAAGAACCAGG + Intergenic
1091538393 12:1435516-1435538 TCAAGAATGAAAACAGTACCAGG - Intronic
1091560032 12:1605320-1605342 GAAGGCATGAAACAGGTATCAGG - Intronic
1092675953 12:10920054-10920076 AAAAGCATCAAAAAAGTAGCTGG - Intronic
1097458173 12:59826813-59826835 TAAAGCATAAAACAAGCAGATGG - Intergenic
1101421252 12:104553154-104553176 TAAAGCCTGAGCAAAGTACCTGG + Intronic
1101826633 12:108225501-108225523 AGAAGCATGAAAAAATTACCAGG + Intronic
1102784581 12:115594178-115594200 TTGAGCATGAAACAAGGACTTGG + Intergenic
1102967731 12:117141142-117141164 GAAAGAATGAAACAAGTTGCTGG - Intergenic
1106749735 13:32750200-32750222 TGAAGCATCACACAAGTAGCAGG - Intronic
1107370337 13:39738507-39738529 ACAAGTATGAAACAAGTAGCAGG + Intronic
1108805089 13:54144986-54145008 AAAAGCATGAAGCATGTTCCTGG - Intergenic
1110761832 13:79239271-79239293 TAAAGCATTTAGCAATTACCTGG - Intergenic
1114873548 14:26687421-26687443 CAATGCATCAAACAAGCACCTGG - Intergenic
1115744908 14:36426789-36426811 TAAATAATTAAACAAGTATCAGG + Intergenic
1119176176 14:72568998-72569020 TAAAAAATGAGACAAGTCCCTGG + Intergenic
1119228692 14:72963342-72963364 TAAAACATGAAAGAAGGGCCAGG + Intergenic
1119702468 14:76764646-76764668 TAAAGCCCCAAACCAGTACCTGG + Intronic
1120791551 14:88588392-88588414 CAAAGTATCAAACAAGTACAAGG - Intronic
1121393490 14:93596842-93596864 TATAGCATGGAAGAAATACCTGG + Intronic
1121927642 14:97943395-97943417 AAAAGCATCAAACATGAACCTGG - Intronic
1123388950 15:19850157-19850179 TAAAGTATAAAACAAGTGCTGGG - Intergenic
1125861815 15:43006293-43006315 TAAAGCACTTAACAAGTGCCTGG + Intronic
1126065647 15:44824466-44824488 GAAAGCGTGAATCAAGTGCCAGG - Intergenic
1126094188 15:45076101-45076123 GAAAGCGTGAATCAAGTGCCAGG + Exonic
1126720662 15:51575059-51575081 AAAAGCAAGAAACAAGTACCAGG + Intronic
1129983811 15:79898136-79898158 TAAAGCATTAATTAAGTGCCCGG + Intronic
1130919580 15:88332991-88333013 GAAAGCATGAGACAAGTATTGGG - Intergenic
1133570575 16:7036225-7036247 TAAATCATGTAACAACTACAAGG - Intronic
1135082124 16:19445401-19445423 TCAAGCATAAAAAAAGTGCCAGG - Intronic
1135966074 16:27036215-27036237 TAAAGTCTGAAACCATTACCTGG + Intergenic
1137456366 16:48621048-48621070 TAAACCATAAAATAACTACCTGG + Intergenic
1137680258 16:50336803-50336825 TAAACCTTGAAACAAGTCCCAGG + Intronic
1138841049 16:60506734-60506756 TAAAGAATGTAAAAAATACCTGG - Intergenic
1140963120 16:79936486-79936508 TAAAGCATGAGACCATAACCAGG - Intergenic
1143673950 17:8416984-8417006 TACATCATGAAACAAGAACACGG - Intronic
1144397601 17:14860240-14860262 TAAAGCATGGAACATGCACGGGG - Intergenic
1145323516 17:21780975-21780997 CAAAACATTAAAAAAGTACCTGG + Intergenic
1147205344 17:38833383-38833405 TAAAACATGAAAGAAGGGCCAGG - Intergenic
1148345874 17:46903545-46903567 TCAATCAGGATACAAGTACCTGG - Intergenic
1149381147 17:56095270-56095292 TAAAGCATTCAACAAGCAGCTGG - Intergenic
1150318256 17:64187986-64188008 GACAGCAAGAAACAAGCACCAGG - Intronic
1151034158 17:70779233-70779255 TAAAGAAAGAAACAACAACCAGG + Intergenic
1151123606 17:71820562-71820584 TATTACATGAAAGAAGTACCTGG + Intergenic
1152061999 17:78083911-78083933 TAAAGAATGAAATAATTAACTGG - Intronic
1154094862 18:11403578-11403600 AAAAGCATGAATAGAGTACCAGG + Intergenic
1156387265 18:36616916-36616938 TGAATCATGAAAAAAGGACCTGG - Intronic
928446162 2:31335396-31335418 TAAAGAATGAAACAAATTCAAGG - Exonic
930455137 2:51598756-51598778 TAAGGCACGAAACAAGAACAAGG - Intergenic
931750690 2:65327367-65327389 TAAAGCAAGACACAAGTGGCAGG + Intronic
932075482 2:68658921-68658943 TGAAGCATGAAACAAGTTCCAGG + Intergenic
932290148 2:70570345-70570367 TAAATCATTAAACATGTTCCAGG - Intergenic
932786655 2:74610741-74610763 TAAAATCTGGAACAAGTACCAGG - Intronic
933996425 2:87673374-87673396 TAAAGCATGAATAAAGCATCAGG - Intergenic
934556869 2:95291711-95291733 CAAAGCATGAAACATTTGCCAGG + Intergenic
935767182 2:106380566-106380588 TAATGCATCCAACAACTACCAGG + Intergenic
935892334 2:107692146-107692168 TAAAGCAAGAAACAAAACCCAGG + Intergenic
936135850 2:109893073-109893095 TAAACTATGAAACTAGTACAAGG - Intergenic
936208847 2:110478412-110478434 TAAACTATGAAACTAGTACAAGG + Intergenic
936297428 2:111277536-111277558 TAAAGCATGAATAAAGCATCAGG + Intergenic
936411665 2:112263641-112263663 TCAAGCATTAAACAAATACTAGG + Intergenic
940702608 2:157064452-157064474 GTAAGCATGAAACATATACCAGG - Intergenic
942183590 2:173403302-173403324 TACCGCATGAAATAAATACCTGG - Intergenic
942882632 2:180880423-180880445 TAAAGCAGGAAATAAGCAACAGG + Intergenic
943374972 2:187065464-187065486 TAAAGCTTGAAAAAATTTCCTGG - Intergenic
943409322 2:187526551-187526573 AAAAGCATGATACAACTAGCAGG + Intronic
943837500 2:192532018-192532040 TAAAGGCTCAAACAAGTACAAGG - Intergenic
943837502 2:192532067-192532089 TAAAGGCTGAAACAAGTACAAGG - Intergenic
944300918 2:198123923-198123945 TATTCCATGAAACCAGTACCTGG + Intronic
945831460 2:214791843-214791865 TAAAGCAGCAAAAAAGTTCCTGG + Intronic
946812304 2:223538890-223538912 TAAATCATGAAACCCGTGCCAGG + Intergenic
947412529 2:229856114-229856136 TGTAGCATAAAATAAGTACCAGG - Intronic
947684090 2:232066135-232066157 TAAAGCATGAAAAAACTAAAAGG - Intronic
1170591888 20:17777603-17777625 TAAAGCATGAAGCAATGCCCTGG + Intergenic
1170633507 20:18085054-18085076 TAAAAGATGAAACAAGGGCCGGG + Intergenic
1170746522 20:19104088-19104110 TAAATACTGAAAAAAGTACCTGG - Intergenic
1171324457 20:24278925-24278947 TAAAACATGAAACAGGAAACAGG - Intergenic
1172159732 20:32858636-32858658 TAATACATAAAACAAGTAGCGGG - Intergenic
1172637407 20:36419282-36419304 TAAAGCATGAGAAAATTAGCTGG - Intronic
1172982301 20:38952701-38952723 TAAACCATAAAACCAATACCTGG - Exonic
1176347311 21:5761487-5761509 GAAAGCAGGAAATAATTACCGGG - Intergenic
1176354125 21:5882071-5882093 GAAAGCAGGAAATAATTACCGGG - Intergenic
1176497516 21:7562968-7562990 GAAAGCAGGAAATAATTACCGGG + Intergenic
1176541632 21:8159557-8159579 GAAAGCAGGAAATAATTACCGGG - Intergenic
1176560583 21:8342602-8342624 GAAAGCAGGAAATAATTACCGGG - Intergenic
1176932982 21:14835546-14835568 TAAAGCATGAAAAAAATAAATGG - Intergenic
1178934483 21:36849961-36849983 TAAACCATGAGATAAGTACAAGG - Intronic
1203246571 22_KI270733v1_random:75976-75998 GAAAGCAGGAAATAATTACCGGG - Intergenic
951611720 3:24497141-24497163 TAAAGCATGAAATAAATAAAGGG + Intergenic
954856851 3:53651431-53651453 TAAATAATGAAACAAGTGTCTGG + Intronic
955131334 3:56172045-56172067 TAAAGCCTTAACCAAGTATCAGG + Intronic
955299901 3:57768101-57768123 TAAAGCATGAAAAATGTACATGG - Intronic
955432846 3:58867324-58867346 TAAAGCATTAGACAAATACGTGG - Intronic
956412782 3:68995656-68995678 AAAAGCATGCAACAGGTACAAGG + Intronic
956680738 3:71777507-71777529 AAAAAAATAAAACAAGTACCAGG + Intronic
956823566 3:72975878-72975900 TAAAGGATGAAGCATGTATCTGG + Exonic
956954938 3:74326792-74326814 TAAAGTATGAAACAAATAAAAGG - Intronic
960899962 3:122544325-122544347 GAAAGCATTAAACAAATGCCAGG - Intronic
963787162 3:149546688-149546710 TAAAGCATAAAACAAAAACATGG + Intronic
964786947 3:160407250-160407272 TAAAGTTTGAAACACGAACCAGG + Intronic
971569304 4:28189712-28189734 TAAAGCATGAAAAAACTTCTAGG - Intergenic
972575033 4:40343718-40343740 TAAAACATGAAAAAATTACAGGG - Intronic
973331634 4:48915320-48915342 TAAAGCATGAAACAGGCATCTGG + Intergenic
974422985 4:61702174-61702196 GAAAGCATGAAAAAAGGAACTGG - Intronic
975180714 4:71340889-71340911 TTAAGCATTACACAAATACCTGG + Intronic
975420348 4:74157697-74157719 TAAAGCAGGAAAGAAGTAATAGG - Intronic
975642457 4:76513662-76513684 TTAAGCAGGAAACAAGAACTGGG + Intronic
976114035 4:81707658-81707680 AAATGCATAAAACAAGTCCCAGG + Intronic
976410353 4:84706391-84706413 TAAAGTATGTACAAAGTACCAGG + Intronic
976992492 4:91384597-91384619 TAAACAATGAAACAAGTTCTGGG + Intronic
978823234 4:112990441-112990463 TAAAACAGGAAAGAAGTGCCTGG - Intronic
982411440 4:155081835-155081857 GACAGCCTGAAACAAGCACCTGG - Intergenic
983454683 4:167948266-167948288 TAAAGCATCTCACAAATACCAGG + Intergenic
983521552 4:168714932-168714954 TCAAGAATGAAACAAAAACCTGG + Intronic
984193603 4:176633215-176633237 TAAAGCTTGAGACAAGTCTCAGG - Intergenic
985984220 5:3500824-3500846 TAAAACATCAGACAAATACCAGG + Intergenic
986362310 5:6991407-6991429 TAAAGCATGGAAGCAGAACCAGG - Intergenic
989488526 5:42021855-42021877 AAAAGCATGAATCAAATAGCAGG + Intergenic
990400069 5:55429272-55429294 TCAAGCAGAAAGCAAGTACCAGG - Intronic
993167541 5:84376833-84376855 CAAAACATGAAACAAGAACTTGG + Intronic
993315401 5:86398447-86398469 AAAAGCAGGAAAAAAGGACCAGG + Intergenic
994100750 5:95889924-95889946 TAATGTATGTACCAAGTACCAGG + Intronic
994193554 5:96896594-96896616 TAAAAAGTGAAACAAGTAGCAGG - Intronic
994722841 5:103400714-103400736 TAAAGTCTGAGACAAGGACCTGG + Intergenic
999189712 5:149738046-149738068 TAAAGCATGTAACACATGCCTGG + Intronic
999704725 5:154261849-154261871 TAAAGCATCCACCAAGTGCCAGG - Intronic
1007970949 6:46051695-46051717 TAAAGCACTAAACAAATACAAGG - Intronic
1008734220 6:54522324-54522346 TAAAGTATCCAACAAGTACCAGG + Intergenic
1009284384 6:61797500-61797522 TAAAGCACTTAGCAAGTACCAGG + Intronic
1010067744 6:71705045-71705067 TAAAGCATGAAAAAAATAAAAGG + Intergenic
1010832526 6:80548289-80548311 TAGAGCATGAAACAGGAAACTGG + Intergenic
1011018680 6:82786941-82786963 GGAAGCATAATACAAGTACCAGG - Intergenic
1012276265 6:97278942-97278964 TAAAGCATGTAACAATTACGTGG + Intronic
1012839078 6:104306657-104306679 CAAAGCATGAGACAAGGACTTGG - Intergenic
1013767824 6:113594950-113594972 CAGTGCATGAAGCAAGTACCTGG + Intergenic
1014214774 6:118742653-118742675 GAAAGCATGAAACAAGAAGGAGG - Intergenic
1017393081 6:153962230-153962252 TTAAGCATGTAAGAAGTACGTGG + Intergenic
1018128008 6:160700703-160700725 TAATGCATCCAACAACTACCAGG + Intergenic
1021128398 7:16880750-16880772 TAAAGACTGAAACAAATACAGGG + Intronic
1021314195 7:19125953-19125975 TAAAACATGTACCAAGTACCAGG - Intergenic
1024248035 7:47485198-47485220 GAAAGGATGAGACAAGAACCAGG + Intronic
1026592379 7:71708029-71708051 TAGAGCATAAAGCAAGTACTAGG + Intronic
1027473761 7:78604695-78604717 TGAAGCAGGAAACAGGCACCCGG + Intronic
1028559929 7:92163507-92163529 TACAGCATAAAATAAGTACGTGG + Exonic
1029148508 7:98463900-98463922 TAAAGCTTGAAAAATGTCCCTGG + Intergenic
1029252286 7:99245381-99245403 TAAAGCATCCACCAAGTACTTGG - Intergenic
1030205312 7:106946741-106946763 TAAAGCATCAAATATGTGCCAGG - Intergenic
1030770579 7:113470045-113470067 TAAAGCATAAAAAAAGAACATGG - Intergenic
1033028337 7:137800000-137800022 TAAAACAGGAAGCAAATACCAGG + Intronic
1038615146 8:29086955-29086977 TAAAGAAATACACAAGTACCCGG - Intronic
1038622890 8:29161372-29161394 CACTGCATGAAACAAGTTCCAGG + Intronic
1040451811 8:47555349-47555371 TACAGTATGCAACAAGTACTAGG - Intronic
1040913052 8:52540991-52541013 TAAAACAAGAAAAAAGTAGCTGG + Intronic
1041996846 8:64072406-64072428 TAAAGCATACAAGAAGTACGTGG + Intergenic
1042708348 8:71686842-71686864 TAAAGCATGGAAAAATTACATGG - Intergenic
1043290966 8:78600588-78600610 TTAAGCATGCAACAAGAACTTGG - Intronic
1043517136 8:81005218-81005240 TGAAGCAGAAAACAATTACCTGG - Intronic
1046574185 8:116004877-116004899 TAAAGCCTGAAACAACTGCAAGG + Intergenic
1047056032 8:121165994-121166016 CAAAGCATAAAACAGATACCAGG - Intergenic
1047168074 8:122462894-122462916 TTCAGCATTTAACAAGTACCTGG + Intergenic
1048292769 8:133192998-133193020 TAAATCATGAAACAAGCATGGGG - Intronic
1050491144 9:6189126-6189148 TAATGTATGTAAAAAGTACCTGG + Intergenic
1051707721 9:19898268-19898290 TTAAGCATGATACACATACCTGG - Intergenic
1052398060 9:27965315-27965337 TAAAGCATGAGAGAAGTATAAGG - Intronic
1053583504 9:39431903-39431925 TCAAACATGAAAAAATTACCAGG - Intergenic
1054105084 9:60990646-60990668 TCAAACATGAAAAAATTACCAGG - Intergenic
1057376905 9:94533177-94533199 GAAAGCATGAAACAAGAAGAGGG + Intergenic
1061544787 9:131298442-131298464 TAAAGCAAGGAACAAGGACGGGG - Intronic
1203462905 Un_GL000220v1:59038-59060 GAAAGCAGGAAATAATTACCGGG - Intergenic
1186325668 X:8474246-8474268 AAAAGCATGAAGCAAGTCCGTGG + Intergenic
1187988254 X:24838830-24838852 TGAAACAAGAAACAAGTATCTGG - Intronic
1188539045 X:31229008-31229030 TGAAACATGAAACAAGTAATAGG + Intronic
1188729495 X:33629841-33629863 TAAATCATGAGACAAGTGCGGGG - Intergenic
1189109344 X:38271102-38271124 AAAAGCAGGAAACAAAAACCAGG + Intronic
1193954080 X:87836851-87836873 TAAATTATGAAAAAAGAACCAGG - Intergenic
1196310345 X:114156825-114156847 AAAAGAATGAAACAATTAGCTGG - Intergenic
1201436223 Y:13961426-13961448 AAAAGCATGAAGCAAGTCCATGG - Intergenic