ID: 917362604

View in Genome Browser
Species Human (GRCh38)
Location 1:174193552-174193574
Sequence CAATATTAGTTTAAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917362604_917362606 1 Left 917362604 1:174193552-174193574 CCTGTCTCCTTAAACTAATATTG 0: 1
1: 0
2: 2
3: 17
4: 171
Right 917362606 1:174193576-174193598 TTCTCTGACCTACTCATTTCAGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917362604 Original CRISPR CAATATTAGTTTAAGGAGAC AGG (reversed) Intronic
903602824 1:24554932-24554954 CCATTTTATTTTATGGAGACTGG - Intergenic
906079469 1:43075018-43075040 CTATATTACATTAAGGAGAAAGG - Intergenic
909139348 1:71844087-71844109 TAAAATTAGGTTAAGGGGACAGG + Intronic
909402728 1:75252440-75252462 CAATATTGGCTTATGTAGACAGG - Intronic
909481622 1:76132987-76133009 CACTATTAGTTTTGGGTGACTGG - Intronic
911875834 1:103161769-103161791 CAATATTTGTTTAAATAGAAAGG + Intergenic
911959281 1:104279748-104279770 AATTATTACTATAAGGAGACAGG - Intergenic
913167179 1:116199215-116199237 CAATATTCGCTTATGGAGAAAGG - Intergenic
915439181 1:155933986-155934008 CAATAATTGTTTAAGGAGAGGGG - Intronic
915820395 1:159017123-159017145 CTATCGCAGTTTAAGGAGACTGG + Intronic
917362604 1:174193552-174193574 CAATATTAGTTTAAGGAGACAGG - Intronic
923235183 1:232026013-232026035 GAATATTCCTTTAAGGACACAGG - Intronic
924149492 1:241113993-241114015 AAATATTAGTTTAATTACACTGG + Intronic
924651672 1:245934330-245934352 AAATATTAGTTCTAGGAGTCGGG - Intronic
1063949769 10:11211271-11211293 CAATTTTTGTTTTAAGAGACAGG - Intronic
1064579459 10:16779082-16779104 CATGATGTGTTTAAGGAGACGGG - Intronic
1067184270 10:44013894-44013916 GAGTATTAGTTCCAGGAGACAGG - Intergenic
1068049863 10:51936053-51936075 CAATATTTGTTCAAGGAAACTGG + Intronic
1068800105 10:61131087-61131109 AAATATTTGTTTCAGGAGCCAGG - Intergenic
1069008557 10:63345888-63345910 CAGTACTAATTAAAGGAGACAGG + Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071206547 10:83286252-83286274 GAATATTTGCTTAAGGAGAATGG + Intergenic
1073019657 10:100432400-100432422 AATTATTATTTTAAAGAGACAGG + Intergenic
1073163880 10:101426506-101426528 GAATTTTAGTTTAAGGGGATGGG + Intronic
1074130522 10:110569080-110569102 CTATATTGGCTTAAGGAGACAGG + Intronic
1078508911 11:11970971-11970993 CAATGTTAGTTTCAGGAAATAGG + Intronic
1080302047 11:30795526-30795548 AAATATTAGTTTCAGGAGACTGG + Intergenic
1080735334 11:35008565-35008587 CAATATTAGATGAAGCAAACGGG + Intronic
1080752584 11:35164652-35164674 CAATCCTACTCTAAGGAGACTGG - Intronic
1083244644 11:61416919-61416941 TAGTATTAGTTTAAGGAGAGAGG - Intronic
1084993480 11:72952135-72952157 CAATATAAGTTAAAGTACACAGG - Intronic
1086863837 11:91956449-91956471 CAATATTAGTTCAAAGATATGGG - Intergenic
1087291021 11:96320647-96320669 CATTATTACTATAAGAAGACAGG + Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1091087343 11:132734819-132734841 CTAAATAAGTTTAAAGAGACTGG + Intronic
1092808724 12:12251873-12251895 CAATATTTTTTTTAAGAGACAGG + Intronic
1092835135 12:12480486-12480508 CAATATTCTTTTGAGGAGGCAGG + Intronic
1092843555 12:12564617-12564639 CAATATTGGTTAAAAGAGTCAGG + Intergenic
1093124220 12:15308469-15308491 GAATATTAGTTTCCAGAGACTGG - Intronic
1094030461 12:26006371-26006393 CAATATTCAAGTAAGGAGACTGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1097382713 12:58914513-58914535 CAAAATTAGTTTAGGGAGACTGG + Intronic
1099048495 12:77754218-77754240 CAATATCAGCTTGAGGAGAGTGG - Intergenic
1099099354 12:78418696-78418718 CAATTTTGGGTTAAGGAGATTGG + Intergenic
1099144373 12:79020916-79020938 CAATAATACTTTAATGAGATAGG + Intronic
1099718444 12:86329369-86329391 TAATACTAGTTTAAGGAGTTGGG - Intronic
1099968636 12:89477658-89477680 CAATTGTGGTTTAAGGAGGCAGG - Intronic
1100003763 12:89868425-89868447 AAAAATTAATTTAAGGAGAATGG + Intergenic
1101566131 12:105907383-105907405 CAACATTTATTTAAGGTGACAGG - Intergenic
1102190407 12:110983517-110983539 CAATATCAGCTTAAGGAAAACGG - Intergenic
1103529232 12:121588941-121588963 GAATATTTGTTTCAGGAGCCTGG - Intergenic
1104654755 12:130565894-130565916 CAATATTATTTTAAAGACAATGG - Intronic
1107248144 13:38322512-38322534 CCATACTATTTAAAGGAGACAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109123918 13:58494015-58494037 AAATATTAGCTTAAGGACAAAGG - Intergenic
1110039799 13:70739019-70739041 AAATTTTATTTTAAGGAGAATGG - Intergenic
1110572626 13:77022939-77022961 CAAAATTAGTTTAATAAAACAGG + Intronic
1110580606 13:77119718-77119740 TAATATTTTTTTAAGGAAACAGG + Intronic
1111757121 13:92412575-92412597 CAATAAAAATTTATGGAGACAGG - Intronic
1113019504 13:105868327-105868349 CAATATTAGTTTTAGGAGGTAGG + Intergenic
1114781619 14:25544781-25544803 CAATATTACTAACAGGAGACAGG - Intergenic
1117094511 14:52283643-52283665 ATATTTTAGTTTCAGGAGACAGG - Intergenic
1117610146 14:57474787-57474809 CAAAATTAATTTAGGGAGAGAGG + Intronic
1117996285 14:61481157-61481179 TCATATTAGTTTTAGGAGACTGG + Intronic
1120533525 14:85663951-85663973 CAAGATTAGTTTCAGCAGTCTGG - Intergenic
1124793141 15:32749138-32749160 GAAGATTAATTAAAGGAGACTGG - Intergenic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127597122 15:60496646-60496668 CAAAATTATTTTTAAGAGACTGG - Intronic
1132054280 15:98637393-98637415 CTATTTTATTTTAAAGAGACAGG + Intergenic
1133339805 16:5028805-5028827 CAATATTGGCTGAATGAGACAGG + Intronic
1133474346 16:6105967-6105989 CAATATTAGTGTAAAGAGCTGGG - Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1140964640 16:79953379-79953401 CAATTTGAGTTTAAAGAGATAGG + Intergenic
1142841846 17:2638438-2638460 CAATATTAGTTTAGGCAGTTTGG + Intronic
1143285740 17:5787942-5787964 GACTATTAGTTTATAGAGACAGG + Intronic
1148981452 17:51579256-51579278 CAATGGTAGTTTGAGGAGAATGG - Intergenic
1150640254 17:66944881-66944903 CAAAATTCATTTAAGGAGAAGGG - Intergenic
1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1157150742 18:45215168-45215190 CAATTTTAGTTTAAAGATACAGG - Intronic
1157508073 18:48245665-48245687 CAATTTTAGATTCAGGAAACAGG + Intronic
1157827942 18:50829812-50829834 AAATATTTGTTTAATGACACAGG - Intergenic
1163014931 19:14448944-14448966 CATTATTAGTTTTTTGAGACAGG + Intronic
1165069166 19:33245734-33245756 CAAAATTAATTTAGGGAAACTGG - Intergenic
1165795789 19:38518425-38518447 AAATATTTGTGTAAGGAAACAGG + Intronic
925432842 2:3811122-3811144 CAATGTTAGTTTGATGAGAAGGG + Intronic
925665127 2:6245249-6245271 TAAAATTACTTTAAGTAGACTGG + Intergenic
926389434 2:12373049-12373071 CAATATTATTATAAGGATACTGG - Intergenic
927334071 2:21900109-21900131 GAATATAAATTTAAGGAGAAAGG + Intergenic
929175771 2:38974258-38974280 GTATATTAGTTTAAGAACACTGG - Exonic
929301885 2:40313572-40313594 CAATTTTTTTTTAATGAGACAGG + Intronic
929685721 2:44032456-44032478 CAAGAATATTTAAAGGAGACTGG - Intergenic
930620955 2:53643195-53643217 CAATATTAGTCTATGGGGAAGGG - Intronic
930746652 2:54890845-54890867 CAATATTAGGATAAGAAGAAAGG + Intronic
931167525 2:59764073-59764095 CAATGTGAGTCTATGGAGACAGG - Intergenic
931777325 2:65551824-65551846 GGATATCAGGTTAAGGAGACTGG - Intergenic
935846481 2:107171328-107171350 CAAGAGGAGCTTAAGGAGACAGG - Intergenic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
938041887 2:128082912-128082934 CAAAATTAATTTACTGAGACTGG - Intergenic
939472085 2:142635612-142635634 CAGTATTATTTTAAGCAGATTGG - Intergenic
940584219 2:155623819-155623841 CAAAAGGAGTCTAAGGAGACAGG + Intergenic
940995286 2:160142919-160142941 GAATCTTTGTTTAAGAAGACAGG - Intronic
941447929 2:165625273-165625295 CAACATTTGGGTAAGGAGACAGG + Intronic
942582678 2:177436513-177436535 CCATTTCAGATTAAGGAGACTGG - Intronic
942699459 2:178687967-178687989 AAATATTCATTTAATGAGACTGG + Intronic
944342289 2:198616167-198616189 CACTTTTAGTTTTGGGAGACGGG - Intergenic
945786447 2:214245044-214245066 CAATAGTAATTCAAGGACACTGG - Intronic
946632365 2:221684004-221684026 AAGTAGTTGTTTAAGGAGACAGG + Intergenic
947907385 2:233775343-233775365 CAGTATTTTTGTAAGGAGACAGG + Intergenic
948181924 2:235989079-235989101 CATTATTATTTGAAGGACACAGG - Intronic
1172846048 20:37930570-37930592 CAATATTTGTTTGGGGAGACGGG + Intronic
1175784369 20:61703298-61703320 TCATCCTAGTTTAAGGAGACGGG + Intronic
1177868680 21:26544024-26544046 CAATATTAGATAAGGGAGATTGG + Intronic
1182196620 22:28525323-28525345 TTATATTATTTTATGGAGACAGG + Intronic
952613413 3:35239361-35239383 CACTGTAAGTTAAAGGAGACAGG - Intergenic
953416796 3:42725963-42725985 CAAAATTATTTAAAGGAGAAAGG + Intronic
955799883 3:62675210-62675232 CAAGATTAGTTTCAGCAAACTGG - Intronic
956577264 3:70765919-70765941 CAATATTACTTTAAGTACAAAGG + Intergenic
956987037 3:74712560-74712582 CAAAACTAGTTTATGGAGAAAGG - Intergenic
957283397 3:78183580-78183602 CAACATGAGTTTAAGAAGCCAGG + Intergenic
957914226 3:86665950-86665972 CATTATTAGTCCAAGGAGAGAGG - Intergenic
958434679 3:94081873-94081895 CAATATTTGTGTATGTAGACAGG - Intronic
958676282 3:97272866-97272888 TATTATTAATTTAAGAAGACAGG - Intronic
959305694 3:104662992-104663014 CAAGTTTAGATAAAGGAGACTGG + Intergenic
961535175 3:127566236-127566258 AAAAATTATTTTAAGAAGACTGG + Intergenic
963216395 3:142753467-142753489 CAAAATTAGTAAAAAGAGACCGG + Intronic
963388015 3:144621019-144621041 CATTATTACTTTAAGGAATCAGG - Intergenic
965351748 3:167620716-167620738 CAATATTATTTAAAGGATGCAGG + Intronic
966337576 3:178886601-178886623 CAATGGTAGTTTAATGAGAATGG - Intergenic
971932347 4:33101422-33101444 CAATCTAAGTGTAAGGAAACTGG + Intergenic
972386636 4:38573259-38573281 CATTGTCAGTTTAATGAGACAGG - Intergenic
973283843 4:48392849-48392871 GAATATTAGTTTCATGAGAGTGG + Intronic
974326411 4:60419833-60419855 GAATATTATTTGAAGGAGAGTGG - Intergenic
974606545 4:64159252-64159274 CAATTTTCGTTTAAGGACAATGG + Intergenic
978611216 4:110542631-110542653 AAATATTAGCTCAAGGAGGCAGG - Intronic
978821956 4:112977276-112977298 CAATATTATTTAAAGAAGAAAGG - Intronic
979412570 4:120396395-120396417 CAATATTATTTTAAACAGCCAGG - Intergenic
979995614 4:127427199-127427221 CAACAGTAGTTAAAAGAGACAGG + Intergenic
981830108 4:148989670-148989692 CATTATTAATTTAAGGTGATGGG + Intergenic
983986720 4:174068410-174068432 CAGAATTAGTTTAAAGACACAGG + Intergenic
984409382 4:179376561-179376583 CAATATTATTTTAATTTGACAGG + Intergenic
987624605 5:20381794-20381816 CAATATTAACTAAAGGAGAATGG + Intronic
991225920 5:64272230-64272252 CTATTTTAGTTTGAGGAGTCAGG + Intronic
992117767 5:73558147-73558169 CAATTTTATTTTTATGAGACAGG + Intronic
994776542 5:104041800-104041822 CAGTATGAGTATAAAGAGACTGG + Intergenic
995258704 5:110076658-110076680 CAAATTTGGTTTAAGAAGACAGG - Intergenic
996095961 5:119399551-119399573 CGATTTTTTTTTAAGGAGACTGG - Intronic
998707241 5:144777201-144777223 GAATTTTAGTTTGAGGACACTGG + Intergenic
1001205132 5:169755408-169755430 CAATATTATTTTATGAAGAATGG + Intronic
1002689995 5:181044055-181044077 CAATTTTAGCTCTAGGAGACAGG + Intronic
1004510544 6:16280783-16280805 CATTATTAGGTAATGGAGACAGG - Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1007977802 6:46119426-46119448 TAAAAGTAGTTTAAGCAGACTGG + Intergenic
1011761720 6:90574482-90574504 CAACATTAGTTTAAGAACACAGG + Intronic
1011907913 6:92395296-92395318 CAAGAGTAGCTGAAGGAGACAGG - Intergenic
1012783921 6:103599229-103599251 CAATATTTTTTTAAAGAGAAGGG + Intergenic
1013421273 6:109969472-109969494 CAATATTACATTGAGGACACGGG - Intergenic
1014280357 6:119436315-119436337 CGATATTAGTATTGGGAGACAGG - Intergenic
1016250157 6:142031285-142031307 GAATATGAGTTTCATGAGACCGG - Intergenic
1016752810 6:147650076-147650098 CAATACTAGTTCAAGGTGCCTGG - Intronic
1017136700 6:151153410-151153432 CAGTCCTAGTTTCAGGAGACTGG - Intergenic
1026009557 7:66626272-66626294 CAAAAGTAGTTTAAGCAGTCAGG - Intergenic
1026420731 7:70234622-70234644 CAAGCTCAGTTTAAGGAGATAGG - Intronic
1030593209 7:111506185-111506207 TATTATTATTTTAAAGAGACAGG - Intronic
1030832607 7:114244385-114244407 CAAGAGGAGCTTAAGGAGACAGG - Intronic
1032354615 7:131198817-131198839 TAATATTATTTTTAGGTGACGGG - Intronic
1032742563 7:134753517-134753539 AAATGTTAGTTTAATTAGACTGG + Intronic
1033897868 7:146096563-146096585 CAATATTATTTAAAGAAGAAAGG + Intergenic
1034737712 7:153444425-153444447 CATTATTGGTGTAAGGTGACGGG + Intergenic
1037130307 8:15400631-15400653 CAAAATGAGTTTAAGGAAACTGG - Intergenic
1041785597 8:61629439-61629461 AACTATGAGTTTAAGGAGAAAGG + Intronic
1043676479 8:82962344-82962366 CAATATTAGTGAAAGGAGAAGGG + Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1047690876 8:127353343-127353365 AAATATTAGTTTTAAGTGACAGG + Intergenic
1050061288 9:1712274-1712296 AAAGATGAGTTTAAGGAGGCAGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1051391057 9:16564316-16564338 CAATCTTAATGTAAGGAGAAAGG + Intronic
1057232664 9:93334109-93334131 AAATATTAGTTTAAAGGGAGGGG + Intronic
1057640808 9:96819193-96819215 CACTATGAGTTTAATGATACTGG - Exonic
1059696539 9:116735327-116735349 CAATATGAATTTAAAAAGACAGG + Intronic
1060098596 9:120816585-120816607 CAAAATTATTTTAAAGTGACTGG - Exonic
1060452487 9:123756269-123756291 CAATATGGGTTTAAGGGTACTGG - Intronic
1187099431 X:16177781-16177803 CAAGACTATTTTAATGAGACAGG + Intergenic
1189393968 X:40603492-40603514 TTCCATTAGTTTAAGGAGACAGG + Intronic
1190122614 X:47674677-47674699 TAATATTATTTTAAGGAAAGAGG - Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1197047591 X:122017646-122017668 AAACATTATTTTAAAGAGACAGG + Intergenic
1199013592 X:142785675-142785697 TCATATTATTTTAAGCAGACAGG + Intergenic
1199081638 X:143583400-143583422 GAATATAAGTTTATGGAGATAGG - Intergenic
1202062829 Y:20905339-20905361 TCATATTAATATAAGGAGACAGG + Intergenic