ID: 917362647

View in Genome Browser
Species Human (GRCh38)
Location 1:174194082-174194104
Sequence GGTCAGTGTTGACCCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917362647_917362649 -10 Left 917362647 1:174194082-174194104 CCAGCATGGGGTCAACACTGACC 0: 1
1: 0
2: 2
3: 9
4: 97
Right 917362649 1:174194095-174194117 AACACTGACCTGCTTGGCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917362647 Original CRISPR GGTCAGTGTTGACCCCATGC TGG (reversed) Intronic
900229987 1:1551821-1551843 GGCCTGTGCTCACCCCATGCAGG + Intronic
900882624 1:5392945-5392967 GGTCAGGGTGGATCCCATGCTGG + Intergenic
901442687 1:9288185-9288207 AGTTAGTGTTGATCCCATGAGGG - Intergenic
902841392 1:19076267-19076289 GGTCACAGTTGACCCCAGGGAGG - Intronic
905347871 1:37323574-37323596 TCTCCGTGTGGACCCCATGCAGG - Intergenic
905682364 1:39883317-39883339 CGTCAGCGCTGACTCCATGCAGG - Exonic
911656448 1:100449355-100449377 AGTCAGTGTGGAGCCCATGAAGG - Intronic
917362647 1:174194082-174194104 GGTCAGTGTTGACCCCATGCTGG - Intronic
919824497 1:201493814-201493836 GATAAGTGTTCACCCCATTCAGG - Intronic
922619169 1:226980000-226980022 GGACAGTGGTGACCCCAGGCTGG + Intronic
923781804 1:237031611-237031633 GAGCAGTCTTGACTCCATGCTGG + Intergenic
1063875790 10:10476828-10476850 TATCAGTGTTGGCCCCATTCTGG + Intergenic
1070486898 10:76940271-76940293 GGTCAGTTCTGACACCATGTGGG + Intronic
1072899532 10:99394841-99394863 GGTCAGTTTTAAGCCGATGCTGG + Intergenic
1073290759 10:102412125-102412147 GGTGGGTGTTGACCCCTTGGAGG - Exonic
1076668117 10:132104420-132104442 GCTGAGTGTTCATCCCATGCTGG + Intergenic
1076791260 10:132777939-132777961 GCTCAGAGGTGACCCAATGCTGG - Intronic
1078422175 11:11221450-11221472 GGTCACTCTTGTCGCCATGCTGG - Intergenic
1083687194 11:64383615-64383637 GGTCTGGGTTGACCCCAGGCAGG - Intergenic
1085515662 11:77110484-77110506 AGCCAGTGTTGAGCCCTTGCTGG + Intronic
1085769095 11:79309326-79309348 GGTCAGTGTTTTTCCCATACAGG + Intronic
1085819207 11:79774048-79774070 GTTCAGGGTTCACCCCATGTGGG + Intergenic
1098827777 12:75319315-75319337 GATCAGTGTTGTCCCCTTGGAGG + Intronic
1100744084 12:97626287-97626309 GGCCAGTGTCTATCCCATGCTGG + Intergenic
1105813262 13:24012342-24012364 GGTCAAGGTTGCCCCCAGGCAGG + Intronic
1107014562 13:35697636-35697658 GGTCAGTGTTAACCCTTTGAAGG + Intergenic
1120188640 14:81420026-81420048 GGTCAGAGTTCACACCATGTTGG + Intronic
1121338833 14:93093130-93093152 GATGGGTGTTGAGCCCATGCAGG - Intronic
1123160582 14:106274878-106274900 TGTCAGTGTCAACCCCATGAGGG - Intergenic
1123208335 14:106735484-106735506 TGTCAGTGTCCACCCCATGAGGG - Intergenic
1125479780 15:40072192-40072214 GGTCAGTGTTGGCTTCAGGCGGG - Intergenic
1127634737 15:60858494-60858516 GGTCAGTGATGAGCTCAGGCGGG + Intronic
1128756730 15:70188317-70188339 GGTCACTGGTTACCCCAGGCAGG + Intergenic
1129563285 15:76593537-76593559 GGTGTTTGTTGACCCCTTGCTGG - Intronic
1131713336 15:95080009-95080031 GGTCAAAGTTTACCCCATGAGGG - Intergenic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1133455982 16:5942992-5943014 GGTCAGTGCAGACCCCTTGGGGG - Intergenic
1143947881 17:10610063-10610085 GACCAGTGTTGACCCAATCCTGG - Intergenic
1148766655 17:50043591-50043613 GGGCAGTGTTGACGCCATGCTGG + Intergenic
1150592262 17:66573928-66573950 GGTCTGTGTTAAACCCAGGCTGG - Intronic
1150611624 17:66738121-66738143 GCTAAGTGTTGGCCCCATGATGG - Intronic
1152365814 17:79855709-79855731 GTTCAGGGTTGACCCTCTGCTGG + Intergenic
1152591268 17:81213808-81213830 GGACAGTGTGGACCCCAGACAGG + Intronic
1157417022 18:47512211-47512233 GGACAGTGTTGACTGCAGGCTGG - Intergenic
1159684602 18:71402520-71402542 CCTCAGTGTTGACATCATGCGGG + Intergenic
1160408325 18:78658346-78658368 AGTCAGTGTTGACCAGGTGCTGG - Intergenic
1160554665 18:79717572-79717594 AGTCAGGGTTGACCACGTGCAGG - Exonic
1160616575 18:80134861-80134883 GGACAGTGTTTGGCCCATGCAGG - Intronic
1160819676 19:1052231-1052253 GGGCAGTGTGGACACCAGGCAGG + Exonic
1161030107 19:2054068-2054090 GGTGAATGTTGAACCCATGTCGG - Intergenic
1161161711 19:2765359-2765381 GGTCTGTGTGGACACCAGGCCGG - Intronic
1161619666 19:5291438-5291460 CGTCAGTGTGTCCCCCATGCTGG + Intronic
1162787642 19:13045681-13045703 GCACTGTGTTGACCCCATGGCGG + Intronic
1162800498 19:13107724-13107746 GGGCAGGGCTGACCTCATGCAGG - Intronic
1163123251 19:15230971-15230993 GGTCAGTGGTGCCCCCATGTCGG - Exonic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1165108936 19:33490039-33490061 TGTCCGTGTTGACGCCACGCTGG + Exonic
930471276 2:51817680-51817702 GGTCAGTGTTGTGCCTATGGGGG - Intergenic
932558984 2:72850763-72850785 TGTCAGTGTGGACCCCATCCCGG - Intergenic
935363031 2:102263787-102263809 AGCCAGTGTAGACCCCAGGCAGG - Intergenic
940844527 2:158625203-158625225 GGTCAGTGGGGACCCCACTCTGG - Exonic
944330917 2:198465400-198465422 TTGCAGTGTTGACTCCATGCTGG + Intronic
945443056 2:209903352-209903374 GGACAGTGTGGACTCCCTGCAGG + Intronic
946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG + Intergenic
1169144687 20:3244641-3244663 GGTCCTTGTTGACCCTCTGCAGG - Intergenic
1170541826 20:17396841-17396863 GGTCAGTTTTGTCACCATGGGGG + Intronic
1171021189 20:21585690-21585712 GGTCAGTGTTTACCAGGTGCTGG - Intergenic
1171390632 20:24799469-24799491 GGTCAGCGTGGGTCCCATGCTGG - Intergenic
1174850888 20:53993543-53993565 GTTCAGTTTTGACCACATTCTGG + Intronic
1176189301 20:63800378-63800400 GGTGAGAGTTGACAGCATGCTGG + Intronic
1180334833 22:11568511-11568533 GGTCAGTTTTGTGCCCTTGCTGG + Intergenic
1182362165 22:29753032-29753054 GCTCAGTGCTGTCCCCAGGCTGG - Intronic
1183058254 22:35319991-35320013 TGTCAGTGCTGACCCCATCCAGG - Intronic
1183408685 22:37642606-37642628 CGTCTGTGCTCACCCCATGCTGG - Exonic
954147875 3:48643187-48643209 GGTCAGTGAGGAGCCCATGCGGG + Intronic
954446532 3:50549840-50549862 GTTCAGTCTTTATCCCATGCTGG + Intergenic
963780113 3:149478695-149478717 GGCCAGGGTCGACCACATGCTGG + Intronic
966528350 3:180944645-180944667 GGCCATTATTGACTCCATGCTGG + Intronic
969636504 4:8372490-8372512 GGGCAGTGTTGACCCCATGGAGG - Intronic
977513880 4:97995696-97995718 GGTGTGTGGTAACCCCATGCAGG - Intronic
977800104 4:101217914-101217936 GGCCTGTGTCTACCCCATGCAGG - Intronic
978030510 4:103936594-103936616 GGTGAGAGGTGACACCATGCTGG + Intergenic
979977151 4:127210951-127210973 GGTTAGAGTTGACTCAATGCTGG - Intergenic
995132001 5:108640682-108640704 GGAGAATGTGGACCCCATGCCGG + Intergenic
995245189 5:109927355-109927377 GGTCAGTGTTCTCCTCATGGAGG + Intergenic
997696452 5:135864869-135864891 GGTCATTCTTGGCCCCATGTGGG + Intronic
1001086733 5:168705592-168705614 GGAAAGTGTTGAGCCCAGGCAGG - Intronic
1001815645 5:174667183-174667205 GGTCAGTATAGACCCTATACTGG + Intergenic
1003183416 6:3810837-3810859 GGGCAGTGTTCACACCATGGAGG - Intergenic
1003556309 6:7142591-7142613 GGTCAGGCTTGACCCCCAGCAGG + Intronic
1007182400 6:39939078-39939100 GGTCAGTGTTGCCCTCACTCTGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1028196389 7:87912470-87912492 GGGTAGTGTTGACCACATGGTGG + Intergenic
1034266589 7:149783942-149783964 CCGCAGTGTTGACCGCATGCTGG - Intergenic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1041661530 8:60406069-60406091 GGTCAGTGCTGACTCCACCCTGG + Intergenic
1047322069 8:123796087-123796109 CTTCAGTGTTGAACACATGCGGG - Intronic
1048955380 8:139531702-139531724 GGTCAGATATGAGCCCATGCAGG + Intergenic
1049264746 8:141661594-141661616 GGTCAGTGCTGCCCCCGTGCTGG - Intergenic
1059495843 9:114708789-114708811 GGGCACTGCTGATCCCATGCAGG + Intergenic
1059713691 9:116893624-116893646 GGTGAGTGCTCACTCCATGCAGG - Intronic
1059752923 9:117265531-117265553 GGTCAGTGTTGAGGGCATGTGGG + Intronic
1060887054 9:127161667-127161689 GGAGAGTGTTGACCCCATAGGGG + Intronic
1061938494 9:133871700-133871722 GGTCAGTGGTGCCTCCATGGTGG - Intronic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1192159289 X:68770792-68770814 GGTCATTGTTTTTCCCATGCAGG - Intergenic
1199739304 X:150717982-150718004 TGTCAGTGTTCACCCAATCCAGG - Intronic
1201736530 Y:17268776-17268798 GATCAGTGTTTTCCCCATACTGG - Intergenic