ID: 917363778

View in Genome Browser
Species Human (GRCh38)
Location 1:174205938-174205960
Sequence GGATGGGGACAATTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917363778 Original CRISPR GGATGGGGACAATTGGAGCT AGG Intronic
900108214 1:994878-994900 GGGTAGGGACAGGTGGAGCTGGG - Intergenic
900132165 1:1091799-1091821 GGGTGGGGCCAAATGGAGATGGG + Intronic
900523516 1:3117350-3117372 GGATGGGGCCAATTGGAACCAGG + Intronic
900670923 1:3854285-3854307 GGATGGAGATGACTGGAGCTGGG - Intronic
900815926 1:4845664-4845686 GGATGGGGCCATATTGAGCTTGG + Intergenic
900849137 1:5128345-5128367 TGATGGGCACAATTGCAGCCAGG - Intergenic
901634998 1:10666419-10666441 GGATAGGGACAAGTGGCCCTAGG - Intronic
902650930 1:17837105-17837127 GGATGGGGACAGTGGGGGTTTGG + Intergenic
903406568 1:23102299-23102321 GGATGGGGCCACTTGGAACTGGG - Intronic
906026129 1:42675688-42675710 GGAGGGGGACAATAGTATCTGGG + Intronic
906246332 1:44277174-44277196 AGATGGGCACAAATGGAGGTAGG - Intronic
906781297 1:48575428-48575450 GAATGGGGTCAGTTGGAGATAGG - Intronic
907307192 1:53519985-53520007 GGATGGGGACATGCAGAGCTGGG - Intronic
909711498 1:78655091-78655113 TGCTGGGTCCAATTGGAGCTGGG + Exonic
915091967 1:153432805-153432827 CGATGGGGTTAATTGGAGCCAGG + Intergenic
915123017 1:153643790-153643812 GGGTGGTGAGACTTGGAGCTGGG + Intronic
916053589 1:161052555-161052577 GGAGGGGCATAATTGGAGGTTGG + Intronic
917363778 1:174205938-174205960 GGATGGGGACAATTGGAGCTAGG + Intronic
917638382 1:176958829-176958851 GGATGGGGACGGTGGGAGGTTGG - Intronic
919566925 1:199200380-199200402 GAATGGGGAGAATTGGAGTGGGG - Intergenic
920784384 1:209026807-209026829 GAAGGGGGAAAAATGGAGCTGGG - Intergenic
922717193 1:227883894-227883916 GGATGGGCACACAGGGAGCTAGG - Intergenic
923683029 1:236134533-236134555 GAATGGTGAGAATTTGAGCTTGG + Intergenic
923746422 1:236704805-236704827 GGATAGGCATAATTGAAGCTTGG + Intronic
1063999238 10:11649606-11649628 AGTTGGGGACACTTGGACCTGGG - Intergenic
1064709809 10:18111667-18111689 AGATGGGGACAAAAGGAGGTGGG + Intergenic
1064749647 10:18514383-18514405 GCAGGTGGACAATGGGAGCTTGG - Intronic
1068026398 10:51650812-51650834 AGATGGGGACAGTTGGAGGTAGG - Intronic
1068498353 10:57813982-57814004 GGATGGGAACAATAGGCCCTGGG - Intergenic
1069650925 10:70047718-70047740 GGCTGGGGAGAAGTGGAGATAGG + Intergenic
1071260916 10:83918314-83918336 GGAAGGGCACCACTGGAGCTGGG - Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074941194 10:118237215-118237237 GGGTGGGGAGAGTTGGAGATGGG - Intergenic
1074998961 10:118781367-118781389 GCATGGGAACACTTGGAACTGGG + Intergenic
1075207785 10:120462023-120462045 TGCTGGGGACAGTTGGAGCAAGG + Intronic
1076854402 10:133108871-133108893 AGCTGGGGCCAAGTGGAGCTGGG - Intronic
1076982317 11:211178-211200 GGCTGGGGACAGATGGAGGTAGG - Exonic
1077117421 11:891441-891463 GGAAGTGGGCAGTTGGAGCTGGG - Intronic
1077341861 11:2029785-2029807 GGATGGGGGCATTGGGGGCTTGG + Intergenic
1077868638 11:6243138-6243160 GGAGGGGGACAAGTGGGGATAGG - Intronic
1079117219 11:17647502-17647524 GGAAGAGGACATTGGGAGCTGGG + Intergenic
1081113802 11:39172475-39172497 GAATGGAGACAGTTGGAGATAGG - Intergenic
1081485010 11:43520817-43520839 GGATGGGGAAAATGAAAGCTGGG - Intergenic
1081787385 11:45757009-45757031 GGGTGGGGACAAGAGGAGGTGGG - Intergenic
1084608132 11:70184339-70184361 GGCTGGGGAGAACTGGAGCACGG + Intronic
1089310891 11:117557440-117557462 GGTTGGGTACAGTGGGAGCTGGG + Intronic
1089940799 11:122414820-122414842 GGATGGGGCCAAATTGAGCTTGG - Intergenic
1090234120 11:125133900-125133922 GGATGGGGAAAATAAGAACTCGG - Intergenic
1202824847 11_KI270721v1_random:84974-84996 GGATGGGGGCATTGGGGGCTTGG + Intergenic
1091795131 12:3293745-3293767 GTAGGGGGACAGTTGCAGCTGGG + Intergenic
1094004863 12:25738685-25738707 GGATGAGGAAAATGGAAGCTGGG - Intergenic
1097971980 12:65643139-65643161 GGATGGGGGCAGTTGGAATTGGG - Intergenic
1098592631 12:72231777-72231799 TGGTGGGGACAACTGGAGTTAGG + Intronic
1100982457 12:100172556-100172578 GAATGGGGACTATGGGATCTAGG - Intergenic
1101849737 12:108392596-108392618 GGAGGGGGAGAAGTGCAGCTGGG + Intergenic
1104843249 12:131834529-131834551 GGAGGGGGACACCTGGAGCGGGG + Intronic
1107009668 13:35655998-35656020 GGATGGGGACATTTGGTGACTGG - Intronic
1107561617 13:41562024-41562046 GGCTGGGGGCATTTGCAGCTTGG - Intergenic
1108154867 13:47574992-47575014 GGGTGGGGAGACTTGCAGCTAGG + Intergenic
1110616179 13:77544591-77544613 GCATTGGGACAAGAGGAGCTGGG + Intronic
1111080094 13:83293975-83293997 AGATGGGAACAATAGAAGCTGGG - Intergenic
1112283634 13:98084607-98084629 GGATAGGAAAAAGTGGAGCTGGG - Intergenic
1117488825 14:56225848-56225870 GAATGGGGACTAGTGGAGCAAGG - Intronic
1118050263 14:62018785-62018807 GGATGGGGACAGGTGGAGAGTGG - Intronic
1120442711 14:84560092-84560114 GGATGGTAACAATTGGAGGATGG - Intergenic
1121616583 14:95317995-95318017 GAATAGGGACAATTTGAGATGGG - Intronic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1126825282 15:52542102-52542124 GGATGGGGAAAAATGGAGGTGGG + Intergenic
1128229335 15:66023958-66023980 GGATGGGGACAGCTAGGGCTGGG + Intronic
1129229708 15:74190338-74190360 AGATGGGGAGAATGGAAGCTTGG - Intronic
1129838402 15:78727968-78727990 GAATGGGGACTATGGGACCTAGG + Intergenic
1130022323 15:80241848-80241870 GGATGGGAAGAATTGGACTTTGG - Intergenic
1130219489 15:82007263-82007285 GGATGTAGACATTTGAAGCTTGG - Intergenic
1134058656 16:11185867-11185889 GGATGGGGAGCATTGGTGCAGGG - Intergenic
1134134298 16:11669037-11669059 GGACGGGGACCAGGGGAGCTAGG - Intronic
1135039097 16:19104220-19104242 AGATGGGGCCAAATGGATCTGGG - Intergenic
1136142199 16:28294719-28294741 GGGTGGGGGCACTTGGTGCTGGG - Intronic
1137367976 16:47877304-47877326 GGAGGGGAACAATTGCATCTTGG - Intergenic
1140392829 16:74602797-74602819 GGGTGGGAACAGTTGAAGCTGGG + Intronic
1144750813 17:17647031-17647053 GGGTAGGGATAATTGGAGGTGGG + Intergenic
1146200530 17:30853718-30853740 GGGTGGGGAGAATGGGAGGTTGG - Intronic
1146688295 17:34856531-34856553 GGGTGGGGAAAATGGGAGGTGGG + Intergenic
1148104534 17:45112351-45112373 GGCTGAGGACAAGAGGAGCTGGG + Exonic
1148630707 17:49106187-49106209 AGCTGGGCACAGTTGGAGCTGGG + Intergenic
1148870621 17:50656976-50656998 GGATGGGGAGAAATGGAGGCAGG + Intronic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1150750636 17:67858769-67858791 GGAATGGGAGAATTGGAGCATGG - Intronic
1150793122 17:68215762-68215784 GGAATGGGAGAATTGGAGCATGG - Intergenic
1150908263 17:69361691-69361713 CAATGGGCAAAATTGGAGCTGGG - Intergenic
1151942354 17:77300738-77300760 GGATGGGGGCGGTTTGAGCTGGG - Intronic
1151942368 17:77300781-77300803 GGATGGGGGCGCTTTGAGCTGGG - Intronic
1151942376 17:77300803-77300825 GGATGGGGGCACTTTGAGCCTGG - Intronic
1151942397 17:77300868-77300890 GGATGGGGGCGGTTTGAGCTGGG - Intronic
1152097123 17:78278795-78278817 GGGTGGGGGCAGGTGGAGCTGGG - Intergenic
1152241577 17:79163920-79163942 GGCTGGGGCCAATTGGAGGGTGG + Intronic
1152994703 18:395813-395835 GGATGGGGGGAATTGGGGATTGG - Intronic
1158087005 18:53662919-53662941 GGATGGGTACAATTAGAGAATGG - Intergenic
1158119426 18:54031971-54031993 GCCTGGTGAGAATTGGAGCTTGG - Intergenic
1162558532 19:11402404-11402426 TGCTGGGGGCAAGTGGAGCTGGG + Intronic
1163674159 19:18646994-18647016 GGATGGGGGCAGGTGGAACTGGG + Intronic
1165994853 19:39836791-39836813 GGAGGGGGACCAGTGGAGGTGGG - Intronic
1166089346 19:40498008-40498030 GGATGGAGACACTTGAAGATGGG - Intronic
1168060386 19:53888848-53888870 GGATGGGAACTATGGGAGGTTGG + Intronic
1168298368 19:55388970-55388992 GGATGGGGACACCTGGAGGACGG - Intronic
925099968 2:1235811-1235833 AGATGGGGAAAATTGGAGGATGG + Intronic
925452925 2:3986102-3986124 GGATGGTGAGTTTTGGAGCTAGG + Intergenic
926188851 2:10712339-10712361 GGGTGGGGACAAGGGGAGTTAGG + Intergenic
926604334 2:14882096-14882118 GGATGGGGAGAATCGGGTCTGGG - Intergenic
926752188 2:16206661-16206683 CCATGGAGACATTTGGAGCTGGG + Intergenic
927398672 2:22685696-22685718 AGAAGGGGAGAAATGGAGCTGGG - Intergenic
929779225 2:44947038-44947060 GGATGGGGACAAAAGGAAATCGG - Intergenic
930568689 2:53056672-53056694 AGATGGGAACAATAGGAACTAGG + Intergenic
932076155 2:68664894-68664916 TGATGGTGACATTTGGAGGTTGG + Intergenic
935062044 2:99616809-99616831 GGCTGGGGGCAAGGGGAGCTTGG - Intronic
935493372 2:103747766-103747788 GGCTGGTGATAATTGGAGCTGGG - Intergenic
937953363 2:127405277-127405299 GGAAGGGGAGAATGGAAGCTGGG + Intergenic
939733263 2:145811593-145811615 GGATGGAGACATTTGCAGTTAGG - Intergenic
941707063 2:168670372-168670394 GGATGGGGATAATTAGACCTAGG - Intronic
942831909 2:180246794-180246816 GGATGGGGACCATTAGAGTAAGG - Intergenic
946024682 2:216664717-216664739 GGATGGGGAGATGTGGAGCGTGG + Intergenic
946907295 2:224429407-224429429 GAAGGGGGACAAAAGGAGCTGGG - Intergenic
948992562 2:241562190-241562212 AGATGGGGTCAAGTGGAGGTGGG + Intronic
1168975512 20:1962685-1962707 GGATGGCCACATTTGGTGCTCGG - Intergenic
1170510605 20:17072600-17072622 GGATGAGGACTATTGGATATTGG - Intergenic
1170824109 20:19778723-19778745 GGCTGGGGACATTTGGAGGAAGG + Intergenic
1171013203 20:21519738-21519760 AGGTGAGGGCAATTGGAGCTGGG - Intergenic
1173024971 20:39299084-39299106 GGATGGAGACAGGAGGAGCTGGG + Intergenic
1175688443 20:61048159-61048181 GGATGTGGAAAATTGTAGCCAGG - Intergenic
1176193529 20:63825470-63825492 GCATGGGGACAACTGGCCCTGGG - Intronic
1178199791 21:30390689-30390711 GGATGGGGACATTGTGAGCCAGG - Intronic
1181050642 22:20236775-20236797 GGGTGGGGACATTTGGAGGGAGG + Intergenic
1182555757 22:31127543-31127565 GGGTGGGGCCAAATAGAGCTTGG + Intronic
1183036124 22:35142260-35142282 GGTTGGGGGCATATGGAGCTTGG - Intergenic
1183235793 22:36616467-36616489 GAATGGGAACAATTGGAGACAGG - Intronic
1183629056 22:39022244-39022266 AGCTGGGGACAGTTGGAGCAGGG - Intronic
1183910656 22:41076376-41076398 GGATGTGGACACTAGGAGGTGGG + Intergenic
1184381836 22:44149592-44149614 GGAGAGGGAGCATTGGAGCTGGG - Intronic
950611841 3:14132107-14132129 GGCTGGGGTCACCTGGAGCTGGG + Intronic
953989705 3:47475072-47475094 GTATGGCGACAGTCGGAGCTAGG - Intronic
954664611 3:52245356-52245378 AGATGGGGACAAAATGAGCTGGG - Intergenic
957019438 3:75108438-75108460 GGAAGGGGACACTTGAAACTGGG + Intergenic
958807103 3:98824332-98824354 GGACAGGGATAATGGGAGCTTGG + Intronic
958917656 3:100067436-100067458 GAATGGGAATAATTGGAGCCAGG - Intronic
960964372 3:123094651-123094673 GGATGGGCAGAAGTGGTGCTGGG + Intronic
961724179 3:128915206-128915228 GGATCGAGACAGGTGGAGCTGGG - Exonic
961724783 3:128920540-128920562 GGATGGGTTTAATTGCAGCTTGG + Intronic
961815181 3:129546407-129546429 AGATGGTGACTGTTGGAGCTGGG - Intronic
962149982 3:132882414-132882436 TGATGGGTACAATTGGAGTCTGG - Intergenic
962859506 3:139386512-139386534 GAAAGTGGAAAATTGGAGCTGGG - Intronic
963284344 3:143418500-143418522 AGATGGGAACAAGTGAAGCTGGG + Intronic
964884709 3:161468346-161468368 GGATGGGGACAAAGGGAGGAAGG + Intergenic
965478826 3:169191161-169191183 GGAGGGGGACAAGTGGAGAGAGG - Intronic
965875840 3:173318679-173318701 TGATGGGAACAATTGGCACTGGG - Intergenic
966050930 3:175617412-175617434 TGATGGGGACAACTGGAGGGTGG - Intronic
966804844 3:183798943-183798965 AGCTGGGGACAACTGGAGTTGGG - Exonic
966904794 3:184514149-184514171 GGATGGTGCCAATTCTAGCTGGG - Intronic
967134573 3:186502577-186502599 CAATGGGGCCAACTGGAGCTGGG + Intergenic
968354348 3:198092377-198092399 AGATGGGGACAACTGACGCTGGG - Intergenic
968599313 4:1501675-1501697 GGATGGGGACCCTTGGGGCCTGG - Intergenic
969571121 4:8009067-8009089 GGATGGGGAGGATGGAAGCTTGG - Exonic
970201689 4:13615607-13615629 GGATTGGGACAATTTAAGGTTGG - Intronic
971022780 4:22555011-22555033 GGCTGGGGTGAATTGGAGCAGGG - Intergenic
975028035 4:69576496-69576518 GAAGGGTGACAATTGGAGCACGG + Intergenic
975820937 4:78269837-78269859 GAATGGGGAAAATTGAAGCTTGG + Intronic
979101858 4:116627236-116627258 AGATGGGAACAATAGGTGCTGGG - Intergenic
983249117 4:165325513-165325535 GGATGGGGAGCTCTGGAGCTGGG + Intergenic
983760363 4:171397803-171397825 GCCTGGGGACATGTGGAGCTAGG + Intergenic
985520876 5:373542-373564 GGATGGGGAGGAAGGGAGCTGGG - Intronic
989030334 5:37111994-37112016 AGATGGGAACAAGTGGAGGTGGG + Intronic
989531660 5:42514567-42514589 AGATGTGGACAATTGGGGCAGGG + Intronic
990139330 5:52684642-52684664 GGTTCAGGACAATTGGACCTAGG + Intergenic
990910440 5:60846234-60846256 GGATGGAGACTTTTGGAGGTGGG + Intergenic
991254839 5:64602484-64602506 GGATGGGGACAAAGGCTGCTGGG - Intronic
995344979 5:111103014-111103036 GGATAGGCAAAAGTGGAGCTAGG - Intronic
1002852425 6:1008273-1008295 GGATGCCGACATTTGGAGCTGGG + Intergenic
1003748908 6:9033823-9033845 GGATACGGATAATTAGAGCTTGG - Intergenic
1006816384 6:36853248-36853270 GGATGGGGATTATTGAAGATAGG - Intergenic
1011113173 6:83860319-83860341 GGATGGGGACTTCTGGAGTTGGG + Intronic
1014618469 6:123634570-123634592 GGAGGAAGACAATTGTAGCTAGG + Intronic
1019397377 7:828909-828931 GGATGCTGAGAATAGGAGCTGGG - Intronic
1019802593 7:3099314-3099336 GGTTGGGGACCATTGGATTTTGG + Intergenic
1024817978 7:53293744-53293766 GGATGGGGAGAAGAGGAGCCTGG - Intergenic
1029562070 7:101309145-101309167 GGATGAGGACAGTTGCAGTTGGG - Intergenic
1029734724 7:102459285-102459307 GGATGGTGACAATGGGAGGTGGG + Intronic
1029746093 7:102516594-102516616 GGAGGGGGAAAAGTGGAGCCTGG - Intronic
1029764031 7:102615573-102615595 GGAGGGGGAAAAGTGGAGCCTGG - Intronic
1030351575 7:108494385-108494407 GGATGGGAACAATTGATGCTGGG - Intronic
1033672011 7:143502165-143502187 GGAAGGAGAGAATTGGGGCTGGG + Intergenic
1035950182 8:4011317-4011339 GAATGGGGGCAATTGGAGCACGG - Intronic
1037950735 8:23017491-23017513 GGATGGGGACAACAGCAGCAGGG - Exonic
1044170871 8:89050122-89050144 GCCTGAGGACAATAGGAGCTAGG + Intergenic
1051513759 9:17907055-17907077 GGCTGGGGACAAGTGGCGCGGGG + Intergenic
1055761717 9:79616196-79616218 GGATGATGACAGTTGGATCTGGG + Intronic
1056988556 9:91388201-91388223 GGATGGGGAGAATAGGAGGGAGG + Intergenic
1058828976 9:108798596-108798618 GGATGGCTACAATTGGAGGATGG + Intergenic
1059945390 9:119404125-119404147 GGATGGGGTGAATAGGAGCAGGG + Intergenic
1062029269 9:134354802-134354824 GGACGAGGACAATTGCAGCCTGG - Intronic
1185914136 X:4016611-4016633 AGATGGGGAGGTTTGGAGCTGGG + Intergenic
1186446448 X:9634239-9634261 GGCTGGGGACTGGTGGAGCTGGG - Intronic
1187740112 X:22346539-22346561 GGATAGGGAGAATTGGAGGACGG - Intergenic
1188070544 X:25713092-25713114 GGTTGGAGACAGTTGAAGCTGGG + Intergenic
1188081217 X:25843233-25843255 GGATGGGAACAATTGACACTGGG + Intergenic
1191199576 X:57764860-57764882 ACATGGAGAAAATTGGAGCTGGG - Intergenic
1192611958 X:72575663-72575685 GGGTGGGGAAATTGGGAGCTTGG - Intergenic
1195731197 X:107969305-107969327 GGATGGATAGAAATGGAGCTAGG + Intergenic
1199084347 X:143611457-143611479 GGATGGTGAGAAATGGTGCTAGG - Intergenic
1199934093 X:152554080-152554102 GGAGGTGGACAGTTGGAGCCGGG - Intergenic
1201281371 Y:12345343-12345365 GGCTCGGGACAGTTGGAGCTTGG - Intergenic