ID: 917369167

View in Genome Browser
Species Human (GRCh38)
Location 1:174270164-174270186
Sequence TTCTCTAAGGTCATGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917369164_917369167 -6 Left 917369164 1:174270147-174270169 CCAGGGGGTTAGGTGCTTTCTCT 0: 1
1: 0
2: 0
3: 10
4: 168
Right 917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 166
917369163_917369167 -5 Left 917369163 1:174270146-174270168 CCCAGGGGGTTAGGTGCTTTCTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 166
917369157_917369167 22 Left 917369157 1:174270119-174270141 CCTGTTTGCTAGAAGAGGGAGCA 0: 1
1: 0
2: 1
3: 7
4: 136
Right 917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 166
917369154_917369167 27 Left 917369154 1:174270114-174270136 CCTTTCCTGTTTGCTAGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 225
Right 917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917369167 Original CRISPR TTCTCTAAGGTCATGCTGGT TGG Intronic
900549431 1:3246717-3246739 TTTGCCAAGGCCATGCTGGTGGG + Intronic
901567317 1:10128843-10128865 TTCTCTAATGTTAGGATGGTTGG + Intronic
901610801 1:10496381-10496403 TTCCTTGAGGTCATGGTGGTGGG + Intronic
904090094 1:27938969-27938991 ATCTCCAAGGCCATGCTGGTAGG + Intronic
905425821 1:37883560-37883582 TTCTCTAATGACATGGTTGTTGG - Intronic
906564015 1:46783740-46783762 TGCTCTATTTTCATGCTGGTTGG + Intronic
906964537 1:50443605-50443627 TTCTTCAAAGTCATACTGGTAGG - Intronic
908364816 1:63410074-63410096 TTCTCTAGGGTCTTGCAGGGTGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
912234144 1:107830569-107830591 TTTTATAGGGTCATGCTGGAGGG - Intronic
912259715 1:108098256-108098278 TTGTGTAAGGGCATGCTGGGGGG + Intergenic
913229754 1:116731947-116731969 TTCTCAAAGGCAGTGCTGGTGGG - Intergenic
915064077 1:153210398-153210420 TTCTCAAAGGGCAGGCTGGTGGG - Intergenic
915270987 1:154753405-154753427 TTCTTTGAGGTCATGCTGTTTGG - Intronic
917269268 1:173255822-173255844 TTCTCTGAGGTCTTGGAGGTGGG - Intergenic
917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG + Intronic
917816617 1:178716808-178716830 TTGTCCAAGGTCATGCTGCTAGG - Intergenic
920373566 1:205494304-205494326 TTCTCTAATGACAAGCTGGTGGG - Intergenic
920589385 1:207202371-207202393 TTCTACAGGGTCATGCTGGAGGG + Intergenic
923623827 1:235598190-235598212 AACTCTAAGGTCATGGAGGTGGG - Intronic
924670007 1:246114525-246114547 TTTTCTAGGGCCATGCTGGAGGG - Intronic
1063206450 10:3836087-3836109 CTCTCTTAGGGCATCCTGGTTGG + Intergenic
1065203716 10:23338525-23338547 TTCTGTAAGTTCATGCTCGGTGG - Intronic
1065646076 10:27835133-27835155 TCCTCCAAGGGCCTGCTGGTGGG - Intronic
1069361477 10:67647699-67647721 TTCCCTGAGGTCATGCTGCCTGG + Intronic
1069548963 10:69349235-69349257 TTCTCCAAGGTCACACAGGTTGG - Intronic
1073324302 10:102633690-102633712 TCCTCTAAGGTCAAGGGGGTGGG + Intergenic
1073460749 10:103664476-103664498 TTCTCTAAGGTCACACAGCTGGG + Intronic
1073481832 10:103790862-103790884 ATCTCTAAGGGCTTCCTGGTTGG + Intronic
1074288417 10:112120068-112120090 TACTCTCAGGCCATGTTGGTTGG + Intergenic
1074955734 10:118387102-118387124 TTACCTAAGATCATCCTGGTGGG - Intergenic
1075131783 10:119746389-119746411 TCATCTAAGGTCAAGGTGGTAGG + Intronic
1075199658 10:120392028-120392050 TTCTCTTAGGTGTTGCTGCTTGG + Intergenic
1075433695 10:122414824-122414846 ATCTCTCAGGTGTTGCTGGTGGG + Intronic
1077002949 11:333995-334017 TTCTCTTGGCTCATGCTGGCTGG - Intergenic
1078038957 11:7839439-7839461 TTCTATTAGATCATGATGGTAGG + Intergenic
1085027248 11:73243425-73243447 TTACCTACGGACATGCTGGTGGG - Intergenic
1085064072 11:73475947-73475969 TACTCTGAGGTCATACTAGTTGG + Intronic
1085637738 11:78171440-78171462 TTCTCTAAAGTCAAGCTGCTTGG + Exonic
1086286835 11:85261188-85261210 TTTTATAGGGTCATGCTGGAGGG + Intronic
1086803297 11:91205287-91205309 TTCTCTGAGGTCTTGGTTGTGGG + Intergenic
1088715042 11:112541777-112541799 TTTTATAGGGTCATGCTGGAGGG - Intergenic
1092225400 12:6745131-6745153 TTCTCTCAGCCCATTCTGGTTGG - Intergenic
1092253856 12:6915824-6915846 TTCTCTATGGACATGATGGCTGG - Exonic
1092919172 12:13215275-13215297 GTTTGTAAGGTCATGCTGGTGGG + Exonic
1096104394 12:48988131-48988153 TTCTCTCAGGACTTGCTGGAAGG + Intergenic
1097971724 12:65640077-65640099 ATCTTTAAAGTCATGCTGTTGGG - Intergenic
1098605924 12:72389667-72389689 TTATATAAGGTCATGAGGGTGGG - Intronic
1099033174 12:77554426-77554448 CTCTCTTGGGTCATGCTGGCTGG - Intergenic
1099525692 12:83717197-83717219 TTCTCTAATGGCATGATGTTGGG - Intergenic
1103929946 12:124444816-124444838 TTGTCTAAGGTCACCCAGGTAGG + Intronic
1104539179 12:129646341-129646363 CTGTCTAAGGCAATGCTGGTAGG + Intronic
1104576928 12:129974449-129974471 TTCTCTGATGTCATTCTGGTTGG - Intergenic
1104716358 12:131018901-131018923 TTCTGTGAGGTCCTGCAGGTGGG + Intronic
1107456516 13:40560471-40560493 TTCTCCAAGATCATCCTGTTCGG + Exonic
1108060862 13:46531776-46531798 TTGTTTAAGGTAAAGCTGGTGGG - Intergenic
1110098724 13:71567711-71567733 TTGTCTATGGTCACACTGGTTGG + Intronic
1114014802 14:18418045-18418067 TTCTCTAAGGTGAAGCTTGGTGG + Intergenic
1114460777 14:22884910-22884932 ATCTTCAAGGTCATGCTAGTGGG + Exonic
1120720299 14:87883009-87883031 TTCTATGAGGTCATGATGGTGGG + Intronic
1127391537 15:58508793-58508815 TTCACCAAGGTCAGGTTGGTTGG - Intronic
1127722751 15:61719033-61719055 TTCTCTAAGGGCAGTCTGGTTGG + Intergenic
1128086639 15:64891330-64891352 TACTCTAAAGGCATGCTGGGAGG + Intronic
1128394728 15:67212484-67212506 TTGTCTAAGGTCATACAGGTAGG - Intronic
1130862370 15:87902470-87902492 TTCTCTAAGATCATGGTCTTGGG + Intronic
1132045722 15:98561525-98561547 CTCTCTGGGGTCATCCTGGTGGG - Intergenic
1132878328 16:2149932-2149954 TTGTCCTAGGTCATGCTGGTGGG + Exonic
1133819269 16:9222160-9222182 TTCTCTGAGGTCATGCAGCAGGG + Intergenic
1135172987 16:20202975-20202997 TTGCCCAAGGTCATGCTGCTGGG + Intergenic
1136925698 16:34371575-34371597 ATGTCTAAGGTCAGGCTGGCTGG + Intergenic
1136978876 16:35040231-35040253 ATGTCTAAGGTCAGGCTGGCTGG - Intergenic
1140890282 16:79279152-79279174 TTCTCTAAGGTCACGCACATAGG + Intergenic
1142673529 17:1499001-1499023 TGCTCTGTGGTCATGCTGGCTGG - Intronic
1145289676 17:21533404-21533426 TTTTCTAAGGTTGTGCTGGACGG - Exonic
1145936153 17:28716029-28716051 ATCTCCAAGGTCATTGTGGTGGG - Exonic
1147770462 17:42864495-42864517 TTCCCTAAGGCCTTGCTGGGCGG + Intergenic
1150635084 17:66907456-66907478 TTATTTAAGGTCATGCTCCTGGG + Intergenic
1151966029 17:77432164-77432186 TTGGCTAAGGTCATGCTGCCAGG - Intronic
1158782785 18:60670764-60670786 TTTTATAGGGTCATGCTGGAAGG - Intergenic
1160719829 19:592233-592255 CTGTCGAAGGTCATGCTGGAGGG - Intronic
1168260875 19:55193771-55193793 TTCTCAGAGGTCCTGCTGGCTGG + Intronic
928600139 2:32896563-32896585 TTCTCTAACTGCATGATGGTAGG + Intergenic
929824283 2:45298319-45298341 TTCACTAAAGACCTGCTGGTTGG + Intergenic
931046751 2:58362587-58362609 TTGTCTAAGGTCATTCAGCTGGG + Intergenic
931626774 2:64263198-64263220 TTCCCTAAGTCCATGCTGGAGGG - Intergenic
933992986 2:87647028-87647050 CTCACCAAGTTCATGCTGGTAGG - Intergenic
936300870 2:111303851-111303873 CTCACCAAGTTCATGCTGGTAGG + Intergenic
939763796 2:146220287-146220309 ATTTCTAAGGTCATGTTGGCTGG - Intergenic
942506448 2:176646431-176646453 CTCTGTCAGGTCAAGCTGGTCGG - Intergenic
944022461 2:195123438-195123460 TTCTCTGCGGTCTTCCTGGTCGG - Intergenic
945046378 2:205785454-205785476 TTCTCTTAGGGCATGAGGGTGGG - Intronic
946252774 2:218423696-218423718 TTCTCTAGGGGCAGGCTGGAAGG + Intronic
947712812 2:232325710-232325732 TTCTGGAAGGTGATGCTGGCTGG + Intronic
947732497 2:232439153-232439175 TTCTGGAAGGTGATGCTGGCTGG + Intergenic
948862894 2:240761442-240761464 CTCTGGAAGGTCAGGCTGGTCGG + Intronic
1170372988 20:15669763-15669785 TTTTCTTAGGTCTTCCTGGTTGG - Intronic
1171722877 20:28582554-28582576 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1171787478 20:29481990-29482012 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1171860474 20:30397391-30397413 TTCTATTAGGGCATGCTGGCTGG - Intronic
1178152822 21:29815264-29815286 TTCCCTAAAGTCATGCAGTTAGG - Intronic
1178185859 21:30219504-30219526 TTCTCTCAGGACAAGATGGTTGG - Intergenic
1179473616 21:41629158-41629180 TTTTATAGGGTCATGCTGGAGGG + Intergenic
1180296430 22:10941228-10941250 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1180439301 22:15348818-15348840 TTCTCTAAGGTGAAGCTTGGTGG + Intergenic
951152168 3:19303729-19303751 TTCTGAAAGGTCATCCTGGCAGG - Intronic
951341055 3:21487454-21487476 TTATCTAACATCATGATGGTAGG + Intronic
952206407 3:31185166-31185188 TTGTCTGAGGTCATGTTGCTAGG + Intergenic
952211607 3:31233836-31233858 TTGTCTCAGGTCATGCTATTGGG - Intergenic
953544833 3:43856796-43856818 TTCTCTAAGGGCGTCCTGGCTGG + Intergenic
955095700 3:55795747-55795769 TTATCCAAGGTCATGCAGCTAGG - Intronic
955208080 3:56915779-56915801 TTTTAGAAGTTCATGCTGGTTGG - Intronic
959746863 3:109785769-109785791 TTTTAAAAGGTCATGCTGCTTGG + Intergenic
963641469 3:147865689-147865711 TTTTATAAGGTCATGCTGGAGGG - Intergenic
965678755 3:171229062-171229084 TTGCCTAAGGTCATGCAGCTAGG - Intronic
965694156 3:171389743-171389765 TCCCCTAAGTACATGCTGGTAGG - Intronic
965858514 3:173118699-173118721 TTCTCCAAGGTCACATTGGTTGG + Intronic
966444532 3:179986993-179987015 GTCTCTGAGGTCATGTTGCTTGG + Intronic
966447557 3:180020021-180020043 TTGTCTAAGGTCACACAGGTAGG + Intronic
973690542 4:53424741-53424763 TCCTCAAAGGTCTTGCTGGAAGG + Intronic
974173578 4:58295907-58295929 TTCTCTCAGTTCAAGCTGGCAGG + Intergenic
974245449 4:59310009-59310031 TCATCTCAGGTCATGCTGCTTGG - Intergenic
976187923 4:82461332-82461354 GTCTCTAAGGTAATGCTTGAAGG + Intergenic
981495384 4:145385849-145385871 TTCTCTGACATCATGCTGGTGGG + Intergenic
984091361 4:175378960-175378982 TTCTCTGATGCCATTCTGGTTGG - Intergenic
986411700 5:7487715-7487737 TTGTCTGAGGTCATGGTGCTGGG + Intronic
991079007 5:62574803-62574825 TCTTCTAAAGTCATGCTGGGGGG + Intronic
991425423 5:66487314-66487336 TTCTCTTAAGTCATTTTGGTGGG - Intergenic
992179223 5:74180508-74180530 TTCTCTAAGGTTAGGCTGGCTGG - Intergenic
992733459 5:79695176-79695198 TTCTCTTAAGTCATGTTGGTAGG - Intronic
994417370 5:99489386-99489408 TTCTTTAATGTCATTCTGTTGGG + Intergenic
994462592 5:100085780-100085802 TTCTTTAATGTCATTCTGTTGGG - Intergenic
995071382 5:107925766-107925788 TTATCTCAGGACATACTGGTAGG - Intronic
995246461 5:109940785-109940807 GTCTCTAAGGTCATGGAGCTAGG - Intergenic
998739097 5:145178350-145178372 TTCTATAACATCATGATGGTAGG + Intergenic
998827077 5:146113358-146113380 TGTTTAAAGGTCATGCTGGTCGG - Exonic
998991422 5:147821924-147821946 TTCTCCCAGTTCAGGCTGGTCGG + Intergenic
999687233 5:154114158-154114180 CTTGCTAAGGTCATGCAGGTAGG - Intronic
1000695466 5:164375783-164375805 TTTTCCAAGGTCATACTAGTAGG - Intergenic
1001205711 5:169761136-169761158 TTTTCTAAGGTTATGCAGCTAGG - Intronic
1003770366 6:9292255-9292277 TTGTCTAATGTGCTGCTGGTGGG + Intergenic
1003865568 6:10359464-10359486 TTGTCTAAAGTCATGCAGCTAGG + Intergenic
1004482418 6:16033454-16033476 TTTTATAAGGTCATGCTGGTGGG - Intergenic
1005424200 6:25684144-25684166 TTTGCTATGGTCCTGCTGGTAGG + Intronic
1006798418 6:36744949-36744971 TTCCCTAAGGTCAAGGAGGTAGG + Intronic
1007244958 6:40454500-40454522 TTTTATAGGGTCATGCTGGAGGG + Intronic
1011623467 6:89264368-89264390 TTGTCTAAGTCCATGCTGCTGGG - Intronic
1016844054 6:148553839-148553861 TTCTCTGAGGTCATGTGGGAGGG - Intergenic
1019212053 6:170414619-170414641 TTTCCTAAGGTCATGCGGGAGGG - Intergenic
1019226791 6:170518328-170518350 TTCTCTTAGCACTTGCTGGTTGG - Intergenic
1019422278 7:956305-956327 TTCTCCAAGCTCATGCTGTGTGG - Intronic
1022564470 7:31383964-31383986 TTCTCTAATTTCATCATGGTGGG - Intergenic
1023073724 7:36462840-36462862 TCCTCTGACATCATGCTGGTGGG + Intergenic
1023199479 7:37680190-37680212 TTCCCTTAGTTCATGTTGGTGGG + Intergenic
1024020028 7:45360239-45360261 TTCTCTAAGGTCAAGCAGCAAGG - Intergenic
1024136969 7:46419172-46419194 TTCTCTATGGTAATGTTGCTTGG + Intergenic
1024607381 7:51033596-51033618 TTTCCTTAAGTCATGCTGGTTGG - Intronic
1027194468 7:76020200-76020222 TTCCCTAAGCTCATCCTGTTGGG - Intronic
1031085441 7:117297798-117297820 TACTCTCAGGACATGCTGGCTGG - Exonic
1033719979 7:144049010-144049032 TTCTCTCAGGGGCTGCTGGTGGG + Intergenic
1035956654 8:4088039-4088061 TTGTCAAAGGTCATGGTGCTGGG - Intronic
1036521034 8:9491837-9491859 TTCTCTAGGGCAATGCTGCTTGG + Intergenic
1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG + Intronic
1041820910 8:62031953-62031975 TTTTATAAGGTCATGCTGGAAGG + Intergenic
1043164805 8:76890440-76890462 TTTTCTAAATTCCTGCTGGTTGG - Intergenic
1044181279 8:89198379-89198401 TAATCTAAGTTCATACTGGTGGG - Intergenic
1045306106 8:100957665-100957687 TTTTCTAAGGTCATTCTGAGAGG - Intergenic
1047261547 8:123265698-123265720 ATCTCTCAGGTCATGATTGTAGG - Intronic
1047440942 8:124877997-124878019 GTCTCTAAGGCCCTGCTGGCAGG + Intergenic
1051026230 9:12615062-12615084 TTGTCTAAGGTCATGGAGCTAGG - Intergenic
1051367896 9:16334175-16334197 TTCCCTAGGGTCAGGCTGGTGGG - Intergenic
1053747662 9:41216553-41216575 TTCTATTAGGGCATGCTGGCTGG - Intergenic
1054338726 9:63833971-63833993 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1054479622 9:65648819-65648841 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1056132533 9:83600368-83600390 TTCACCAAGGCCATGATGGTGGG - Intergenic
1061496537 9:130978013-130978035 CTTTCTGAGGTCATGCTGCTTGG - Intergenic
1202783796 9_KI270718v1_random:27324-27346 TTCTATTAGGGCATGCTGGCTGG - Intergenic
1203448074 Un_GL000219v1:79473-79495 TTCTATTAGGGCATGCTGGCTGG + Intergenic
1187986455 X:24817952-24817974 TTTTTTTAGGTGATGCTGGTAGG + Intronic
1188009674 X:25042522-25042544 GTCTTTAAGGTCCTGGTGGTTGG + Intergenic
1190929809 X:54937842-54937864 TTGCCTAAGGTCATACTGGTGGG - Intronic
1191871597 X:65751021-65751043 TTTTATAAGGTCATGCTGGAGGG - Intergenic
1194435557 X:93865141-93865163 TTCTCTATTGTCCTGCTGGCTGG - Intergenic
1194670038 X:96720600-96720622 TTCTCATTGGTCATGCTGGCAGG + Intronic
1198447588 X:136733763-136733785 TTATCTCAGGTCATGCAGCTAGG + Intronic
1198599966 X:138271805-138271827 TTGTCCAAGGTCATGCAGCTAGG - Intergenic
1198659403 X:138951117-138951139 TTGCCTAAGGTCACGCTGCTGGG + Intronic
1199684904 X:150257296-150257318 TTCTCTGAGATGATGGTGGTGGG - Intergenic
1202025694 Y:20520368-20520390 ATCTCTAAGGTCAGGCTTCTGGG + Intergenic