ID: 917371462

View in Genome Browser
Species Human (GRCh38)
Location 1:174298293-174298315
Sequence GCTGCTTGCACTCATGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 24, 3: 57, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917371459_917371462 -6 Left 917371459 1:174298276-174298298 CCACCATGAGTACCAAAGCTGCT 0: 1
1: 2
2: 9
3: 13
4: 147
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371454_917371462 22 Left 917371454 1:174298248-174298270 CCCCGAGTTCTGGTGACCTTGGC 0: 2
1: 3
2: 20
3: 39
4: 212
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371456_917371462 20 Left 917371456 1:174298250-174298272 CCGAGTTCTGGTGACCTTGGCAG 0: 1
1: 8
2: 20
3: 40
4: 184
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371455_917371462 21 Left 917371455 1:174298249-174298271 CCCGAGTTCTGGTGACCTTGGCA 0: 1
1: 6
2: 33
3: 68
4: 216
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371460_917371462 -9 Left 917371460 1:174298279-174298301 CCATGAGTACCAAAGCTGCTTGC 0: 1
1: 2
2: 13
3: 26
4: 140
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371458_917371462 6 Left 917371458 1:174298264-174298286 CCTTGGCAGGTGCCACCATGAGT 0: 6
1: 3
2: 30
3: 31
4: 185
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162
917371452_917371462 30 Left 917371452 1:174298240-174298262 CCTTGCATCCCCGAGTTCTGGTG 0: 1
1: 5
2: 16
3: 26
4: 148
Right 917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG 0: 1
1: 1
2: 24
3: 57
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917371462 Original CRISPR GCTGCTTGCACTCATGAAGC AGG Intronic
901656442 1:10772383-10772405 TCTGCTTCCTCTCCTGAAGCTGG - Intronic
902422723 1:16294173-16294195 GGTTTTTGCACTCATGAGGCAGG - Intronic
909863540 1:80637539-80637561 GCGACTTGCATCCATGAAGCAGG - Intergenic
911441874 1:97937154-97937176 GCTTCTTGTACTCATGCAGATGG - Intergenic
912111243 1:106345563-106345585 GCAGCTTGCACCCATGAAACAGG + Intergenic
912696698 1:111847601-111847623 GCTGCTTGCCCTCAGGAATGGGG - Intronic
913256825 1:116961415-116961437 GCTGCTTGCAGTCATGGACGGGG + Exonic
914747689 1:150511750-150511772 GCTGCTGGCACTGATCCAGCTGG + Exonic
915057658 1:153150080-153150102 GCTGCTTGCACTGCTGCTGCTGG + Exonic
915656554 1:157365621-157365643 GAGCCTTGCACCCATGAAGCAGG + Intergenic
915824126 1:159057168-159057190 GCGGCTTGTACCCATGAAGCAGG + Intergenic
916577092 1:166077228-166077250 GCTGCTTTCAGCCATGATGCTGG - Intronic
917076889 1:171214958-171214980 GTGGCTTGCACCCATGAAGCAGG + Intergenic
917209800 1:172620163-172620185 ACGGCTTGTACCCATGAAGCAGG - Intergenic
917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG + Intronic
917444231 1:175093219-175093241 GTTGCTTGAACACATGAAGCAGG + Intronic
918400854 1:184161551-184161573 GCTGGCTGTACACATGAAGCAGG - Intergenic
920530791 1:206700858-206700880 GCTGCTTGCTCTGGGGAAGCTGG + Intronic
921188106 1:212686785-212686807 GCTGCTTGCCCCGATGAAGCCGG - Exonic
922170191 1:223148017-223148039 CGTGCTTGCTCTCATGAAGCTGG + Intergenic
922567863 1:226612592-226612614 GTGGCTTGCACCCATGAAGCAGG + Intergenic
922712087 1:227841941-227841963 GCTGCTTCCACTCATGGGGAAGG + Intronic
922981434 1:229830281-229830303 GCTCCTTGCACTAATGTAGGAGG - Intergenic
923913991 1:238482252-238482274 GCGGCTTGCACCCATGAAGCTGG + Intergenic
1065151450 10:22826827-22826849 GCGGCTTGCACCCATGAAGCAGG + Intergenic
1066564366 10:36705459-36705481 GCTGCATGCATTCAGGATGCAGG + Intergenic
1066710697 10:38230614-38230636 GCAGCTTGCACCCATGAAGCAGG - Intergenic
1066979315 10:42396886-42396908 GCAGCTTGCACCTGTGAAGCAGG + Intergenic
1069779451 10:70945648-70945670 GCTGCTGGAACTCATGGTGCAGG - Intergenic
1070702618 10:78614534-78614556 CCAGCTTGCAGTCAGGAAGCAGG - Intergenic
1071012417 10:80953838-80953860 GCGGCCTGCACCCATGAAGTGGG + Intergenic
1071814660 10:89220242-89220264 GCTGCTGGCAGTCACTAAGCTGG + Intronic
1071926467 10:90415460-90415482 GCAGCTTGCACACATGAAGCAGG - Intergenic
1073574601 10:104612051-104612073 GTGGCTTGCACTCATGAAGCAGG - Intergenic
1073753227 10:106553517-106553539 GCTGCTGGAACTCATTAAGAAGG + Intergenic
1074874980 10:117606722-117606744 GCAGGCTGCACTCATGCAGCAGG + Intergenic
1076913674 10:133406749-133406771 ACTGCTTGAACCCAGGAAGCAGG - Intronic
1077379187 11:2220727-2220749 GCTGCTTCCACTCATGGTGGAGG + Intergenic
1078400950 11:11026468-11026490 GGTCCTTGGACTCTTGAAGCAGG - Intergenic
1079476877 11:20840485-20840507 GGTGTTTTCACTCATAAAGCTGG + Intronic
1080941403 11:36922218-36922240 GCGACTTGCACCCATGAAGCAGG + Intergenic
1081191162 11:40104441-40104463 GCGGCTTGCACCCATGAAGCAGG - Intergenic
1081786322 11:45750391-45750413 CCTGCTTGCAGCCATGCAGCAGG - Intergenic
1082659647 11:55894683-55894705 AGCGCTTGCACCCATGAAGCAGG - Intergenic
1084643890 11:70443175-70443197 GCTGCTTCCACTCATGGGGGAGG + Intergenic
1084879978 11:72163946-72163968 GCAGCTTGCACCCATGAAGCAGG + Intergenic
1088141224 11:106618822-106618844 TCTGCTTTCTCTGATGAAGCTGG + Intergenic
1090257130 11:125292662-125292684 GCAGCTTTCACTCACGAGGCTGG + Intronic
1090396875 11:126424915-126424937 GCTGCTTGCCCGCAGGACGCAGG + Exonic
1090858944 11:130635972-130635994 GCTGCTTGCACTTAAGAACTGGG - Intergenic
1091560648 12:1610349-1610371 GCTGCTTTCACTGCTGAAGTAGG + Intronic
1091608271 12:1977399-1977421 GCTGCTTGGAGTGATCAAGCAGG - Intronic
1092585778 12:9899638-9899660 GCGGCTTTCACCCCTGAAGCAGG + Intronic
1093370011 12:18354947-18354969 GCAGCCTGCACCCATGAAGCAGG + Intronic
1094692415 12:32782917-32782939 GATGCCAGCACTCAGGAAGCTGG + Intergenic
1097499868 12:60388663-60388685 GTGGCTTGCACCCATAAAGCAGG + Intergenic
1098288320 12:68931657-68931679 ATTGCTTGAACTCAGGAAGCCGG + Intronic
1098805583 12:75016938-75016960 GCGGCTTGCACCCATGAATCAGG + Intergenic
1099534664 12:83828780-83828802 GCGACTTGCACCCGTGAAGCAGG + Intergenic
1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG + Intronic
1104715477 12:131013377-131013399 GCTGCTTGCATTCATGAGGAGGG - Intronic
1108041189 13:46340679-46340701 GCTGCTTCCACTCATGGTGGAGG + Intergenic
1109380534 13:61553175-61553197 ACTGCCTGCACTCCTGATGCAGG + Intergenic
1109388844 13:61667536-61667558 ATGGCCTGCACTCATGAAGCAGG + Intergenic
1109469531 13:62787671-62787693 GCTGCTTGAAATCTTGAAACAGG - Intergenic
1109515327 13:63436401-63436423 GGTTCTGGCATTCATGAAGCTGG + Intergenic
1109561322 13:64053371-64053393 GTGGCTTGCACCCATGAAGCAGG + Intergenic
1109745362 13:66617173-66617195 GTGGCTTGCACCCATGAATCAGG - Intronic
1110091505 13:71454546-71454568 CCTGCTTGATCTGATGAAGCAGG + Intronic
1110990644 13:82038923-82038945 GCGACTTGCACCCATGAAGCAGG + Intergenic
1113612651 13:111658380-111658402 GCTGCCTGCACAAAGGAAGCTGG - Intronic
1116389989 14:44380349-44380371 GTGGCTTGCACCCATGAAGCAGG + Intergenic
1118434892 14:65761802-65761824 GCTGCTTGCACTACCAAAGCAGG + Intergenic
1120314287 14:82871983-82872005 GCAGTTTGCACCCATGAAGCAGG - Intergenic
1121396358 14:93626935-93626957 GCTGCTTGGAGTGCTGAAGCAGG + Intronic
1122062096 14:99143009-99143031 GCTGCTATCTCTCAAGAAGCTGG + Intergenic
1122094680 14:99362397-99362419 GATCCTTGCCCTCATGGAGCAGG - Intergenic
1124111516 15:26794275-26794297 GCTGCTTACATTTATGAACCTGG - Intronic
1127404772 15:58631116-58631138 GCTGCTTCCACTTATGATGGAGG - Intronic
1127735601 15:61835777-61835799 TCTGCTGGCAATCCTGAAGCAGG - Intergenic
1130146931 15:81281497-81281519 GATGTTTGCACAGATGAAGCCGG - Intronic
1132211865 15:100029860-100029882 TCTGATAGCACTCATGATGCTGG - Intronic
1134924782 16:18149875-18149897 ATTGCTTGAACTCATGAGGCAGG - Intergenic
1135077228 16:19403894-19403916 GCAGTTTGCACCCATGAAGCAGG + Intergenic
1138297109 16:55896424-55896446 GCTGCTTCCACTCATGGAGAAGG - Intronic
1138665678 16:58565852-58565874 ACTGCTTGAACCCAGGAAGCAGG + Intronic
1140025420 16:71285634-71285656 ACTGCTTTCACTAATAAAGCGGG - Exonic
1143965585 17:10754557-10754579 TCTGCGTGCACTCAGAAAGCTGG + Intergenic
1144305582 17:13966769-13966791 GCGGCTTGCACCGATGAAGCAGG + Intergenic
1146039171 17:29434571-29434593 GTGGCTTGCACCCATGAAACAGG + Intronic
1153778979 18:8477940-8477962 GCTGCTTCCACTGCTGAACCTGG - Intergenic
1155784594 18:29880651-29880673 GCAGCTTGCACCCATGAAGCAGG + Intergenic
1155786868 18:29913207-29913229 GTGGCTTGCACCCATGAAGCAGG - Intergenic
1158641323 18:59206541-59206563 GCGGCTTGCACCCATGAAGCAGG - Intergenic
1159370249 18:67519150-67519172 GCTCCTTCCACACATGAAGATGG + Intergenic
1161644577 19:5445089-5445111 ACTGCTTGAACTCAGGAGGCAGG + Intergenic
1164861238 19:31563875-31563897 CCTGCTTGCACTCAGGAGGGAGG + Intergenic
1168477110 19:56684350-56684372 GCACCTTGCACTGTTGAAGCAGG + Intergenic
926830562 2:16957751-16957773 GCTGCCTGCACTCCTGACCCAGG + Intergenic
930176624 2:48307527-48307549 TCTGCTTTGGCTCATGAAGCTGG - Intergenic
930417167 2:51103516-51103538 GCTGGTTGCGTTCAGGAAGCTGG - Intergenic
931153178 2:59597823-59597845 TCTGCTTCTACTCTTGAAGCAGG + Intergenic
931903008 2:66810979-66811001 GCTGATTCCTCTCATGAATCTGG + Intergenic
932095026 2:68839703-68839725 GCTGCTTGCAACCTGGAAGCAGG - Intergenic
933131001 2:78673874-78673896 GCGGCTTGCACCCATGAAGCAGG + Intergenic
935838620 2:107082751-107082773 GCTGCTTGAAATCCTGCAGCAGG + Intergenic
935958430 2:108400806-108400828 GTGGCTTGCACCCATGAAGTAGG - Intergenic
936840014 2:116757881-116757903 GCAGTGTGCACCCATGAAGCAGG - Intergenic
937727705 2:125186799-125186821 GCGGTTTGTACCCATGAAGCAGG + Intergenic
938050039 2:128161077-128161099 GCTGCCTGCACTCAGCAAGCTGG - Intronic
939948346 2:148437811-148437833 GATGATTGCAGTCATAAAGCTGG - Intronic
941241221 2:163040720-163040742 GCACCTTGCTCTCATAAAGCTGG + Intergenic
942839298 2:180340324-180340346 GCGGCTTGCACCTATGAAGCAGG - Intergenic
943292637 2:186093901-186093923 GCTGCTTCCACTCATCAAGAGGG + Intergenic
943420010 2:187658395-187658417 GCAGCTTGCACCCATGAATCAGG - Intergenic
946297273 2:218795017-218795039 GCGGCCTGAACCCATGAAGCAGG + Intronic
946394820 2:219438000-219438022 GTTCCTGGCACTCCTGAAGCCGG + Intronic
1168921438 20:1539738-1539760 GCTGCTTCTCCTCAAGAAGCAGG - Intronic
1170222162 20:13952487-13952509 GTAGCTTGCACCCATGAAGCAGG - Intronic
1172914887 20:38436143-38436165 GCTGCTTGCACTCCAGAACATGG - Intergenic
1174160523 20:48547149-48547171 GCTGCTTGCACTCATGGCATGGG - Intergenic
1175287539 20:57847192-57847214 GCTGCTTCCACTCATGATGGAGG + Intergenic
1175887300 20:62299507-62299529 ACTGCTTGAACTCAGGAGGCGGG + Intergenic
1177438354 21:21085274-21085296 GATGCATGCACTCAGGAACCTGG + Intronic
1178619614 21:34162093-34162115 GCGACTTGCACCCATGAAGCAGG + Intergenic
1182309630 22:29395405-29395427 GCTGCCTGCCCTCAGCAAGCAGG - Intronic
1185203346 22:49522005-49522027 TCTCCTTGCAGTCATGGAGCTGG - Intronic
949465670 3:4340631-4340653 GGAGCTTGCACTAATGAAGATGG + Intronic
952193299 3:31046616-31046638 GCAGCTTGCACCCATGAAGCAGG - Intergenic
952637140 3:35545894-35545916 GTGGCTTGCACCCATGAAGCAGG + Intergenic
954092082 3:48293065-48293087 TCTGCCAGCATTCATGAAGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955613264 3:60779972-60779994 GCAACTTGCACCCATGAAGCAGG - Intronic
955678500 3:61475137-61475159 GCTGCGTGCCCTCCTGCAGCTGG - Intergenic
955708455 3:61753677-61753699 ATTGCTTGAACTCAGGAAGCAGG - Intronic
956218194 3:66872148-66872170 GAAGCTTACAATCATGAAGCTGG + Intergenic
957508333 3:81155131-81155153 GCAGCTTGGACCCATGAAGACGG - Intergenic
957952567 3:87145004-87145026 GCGGCTTGAACCCATGAAGCAGG - Intergenic
958467078 3:94471995-94472017 GCGGCCTGCACTCATGAAACAGG + Intergenic
958744252 3:98113768-98113790 CCGGCTTGCACTCATGAAGCAGG - Intergenic
959254388 3:103991291-103991313 GCGGCATGCACCCATAAAGCAGG + Intergenic
959431589 3:106260738-106260760 GCAGCTTGCACCCATGAAGCAGG - Intergenic
960514448 3:118588292-118588314 GCTGCTTCCACTCATGGTGGAGG - Intergenic
963761326 3:149289371-149289393 CCGGCATGCACCCATGAAGCAGG - Intergenic
964304300 3:155324746-155324768 GAGGCCTGCACCCATGAAGCAGG - Intergenic
964980262 3:162669570-162669592 GTGGCTTGCACCCATGAAGCAGG - Intergenic
965103487 3:164332637-164332659 GCAGCTTGCACCCATGAAGCAGG + Intergenic
965300569 3:167000986-167001008 GCGGCTTGCACCCATGAAGCAGG + Intergenic
966520537 3:180869394-180869416 GTGGCTTGCACCCAGGAAGCAGG + Intronic
966523671 3:180899072-180899094 GCGACTTCCACCCATGAAGCAGG - Intronic
968275716 3:197438699-197438721 GCTGCTGTCAATGATGAAGCTGG + Intergenic
970412735 4:15825284-15825306 GCTGTTTCCACTCATGGAGAAGG + Intronic
976345290 4:83993263-83993285 GCAGCTTGCACCCATGACACAGG - Intergenic
976969763 4:91090953-91090975 GCAGCTTCCACTCATGCAGGAGG + Intronic
977449501 4:97176819-97176841 GCTGCTTTCACTCATGGAAGAGG + Intergenic
979189532 4:117839293-117839315 TCTGTTTCCACTCTTGAAGCAGG - Intergenic
979500728 4:121436948-121436970 GTGACTTGCACCCATGAAGCAGG - Intergenic
980012226 4:127609579-127609601 TCTGCTGGCATTCATGAAACTGG - Intergenic
980495737 4:133586220-133586242 ACAGCCTGCACTCGTGAAGCAGG - Intergenic
980722883 4:136720474-136720496 GCGGCTTGCACCCACGAAGCAGG - Intergenic
981255891 4:142660194-142660216 GCAGCTTGTACCCATGAAGTGGG - Intronic
982055706 4:151546950-151546972 GCTGCTGGAACTGATGAAGTGGG - Intronic
983321576 4:166202345-166202367 GTGGCTTGCACCCATGAAGCAGG - Intergenic
985525508 5:399386-399408 GGTGTTTGCACTCAGAAAGCGGG + Intronic
986213704 5:5698554-5698576 GTGGCTTGCACCCATGAAGCAGG - Intergenic
988106593 5:26757875-26757897 ATTGCTTGAACTCATGAGGCAGG + Intergenic
988899676 5:35718584-35718606 GCACCTTGCACCCATGAAGCAGG + Intronic
989212047 5:38866154-38866176 AGTGCCTGCACACATGAAGCGGG - Intronic
990597904 5:57329681-57329703 GCTGCATGCAGTCATGGTGCTGG + Intergenic
991014302 5:61915091-61915113 GCGACTTGCACCCATGAAGCAGG - Intergenic
992597002 5:78357308-78357330 GCTGCTTCCACTCATGCAGAAGG - Intergenic
992653533 5:78885645-78885667 GCTGCCAACACTCGTGAAGCTGG - Exonic
992792436 5:80225579-80225601 GCTCATTGCACTCATCCAGCAGG - Intronic
994505749 5:100641367-100641389 GCAGCTTGCACCCATAAAACCGG - Intergenic
995393547 5:111664149-111664171 GCAGCTTGTACCCATGAAGCAGG + Intronic
995830025 5:116344935-116344957 GCAACTTGCACCCATGAAACGGG + Intronic
996575355 5:124972256-124972278 GTGGCTTGCACCCATGAAGCAGG - Intergenic
997197234 5:131988264-131988286 GCTGCCTGCACTCATGACCTGGG - Intronic
998626181 5:143848441-143848463 CCTGCTTGCTTTCATGAAGCAGG - Intergenic
999190595 5:149744054-149744076 GCTGCCTGCACTCATGAGGAAGG + Intronic
1000993569 5:167935724-167935746 GCTGCTGGCATTCATGACACAGG + Intronic
1003186788 6:3839162-3839184 GCTGCTTCCACTCAAGCAGAAGG + Intergenic
1004433802 6:15570329-15570351 GATTCTTGCCCTCAAGAAGCTGG - Intronic
1006393816 6:33773980-33774002 GCTGCTGCCACTCAGGTAGCCGG - Intronic
1007215117 6:40231023-40231045 GCTGCTTCCACTCATGCAGAAGG + Intergenic
1009626744 6:66145326-66145348 GTGGCCTGCACTCATAAAGCAGG + Intergenic
1010249463 6:73693243-73693265 GCTGCTTCCACTCATGTGGAAGG + Intergenic
1010453610 6:76030219-76030241 GCAGCTTACACCCATCAAGCAGG - Intronic
1010669887 6:78674878-78674900 GTGGCTTGCACCTATGAAGCAGG + Intergenic
1014057122 6:117028950-117028972 GCTCCCTCCACCCATGAAGCTGG - Intergenic
1015858975 6:137656011-137656033 GCAGCTTACACTCATGAAGAAGG - Intergenic
1016162071 6:140894505-140894527 GTGGCTTGCACTCATGAAGCAGG + Intergenic
1018432753 6:163735843-163735865 GCTGCTTGCAGTCACGCAGCTGG - Intergenic
1019468596 7:1204819-1204841 GCTGCTTGCAGTCAGGGAGCGGG + Intergenic
1020677191 7:11196716-11196738 GCAACTTGCACCCATGAAGCAGG - Intergenic
1021420557 7:20441238-20441260 GTGGCTTGCACCCATGAATCAGG - Intergenic
1022322248 7:29298080-29298102 GCGGCTTTCACCTATGAAGCAGG + Intronic
1023718926 7:43073089-43073111 GCGGCTTGCACCCATGAAGCAGG + Intergenic
1024433987 7:49327321-49327343 GCTGCTTTCACTCTTGATGGAGG + Intergenic
1024677562 7:51650747-51650769 GCTGCTTCCACTCATGATGGAGG - Intergenic
1027199977 7:76057803-76057825 GCTTCTGGCACTCATCATGCTGG + Intronic
1029644922 7:101848326-101848348 GCTGCTCACACCCAGGAAGCTGG - Intronic
1031835051 7:126672219-126672241 GTGACTTGCACCCATGAAGCAGG - Intronic
1032917949 7:136512280-136512302 GCAGCCTGCACCCATGAAGCAGG + Intergenic
1033870888 7:145752174-145752196 GATGTATGCACCCATGAAGCAGG + Intergenic
1038938145 8:32275319-32275341 AATGCTTGCTCTCATGAACCTGG + Intronic
1040758375 8:50808336-50808358 GCAGCTTGCACCCATGAAGCAGG - Intergenic
1040990728 8:53347067-53347089 GCGGCTTTCACCCATGAAGCAGG - Intergenic
1041033057 8:53757433-53757455 TCTGCTTGCACACATGAGGAAGG - Intronic
1042415116 8:68509852-68509874 GTGACTTGCACCCATGAAGCAGG + Intronic
1044812821 8:96081715-96081737 ATTGCTTGAACTCAGGAAGCAGG - Intergenic
1045681403 8:104664613-104664635 CCTGCTTGGACTCATAGAGCTGG - Intronic
1046113153 8:109751330-109751352 CCTGCTTCCAAACATGAAGCAGG - Intergenic
1050508709 9:6372207-6372229 GCAGCTTGCACCCATGAAGCAGG + Intergenic
1050674226 9:8033807-8033829 GCAGCTTCCACCCCTGAAGCTGG + Intergenic
1052617040 9:30854663-30854685 GCAGCTTGCACTCATGAAGCAGG - Intergenic
1055375801 9:75647537-75647559 GCAGCCTGCACTCATGAAGCAGG + Intergenic
1058869659 9:109191045-109191067 GCTGCTTGCATTTCTGATGCTGG + Intronic
1060242700 9:121918137-121918159 GCTGCTGGAATTCATGGAGCAGG + Intronic
1060495127 9:124112893-124112915 CATGCTTGCCCTCATGAACCAGG - Intergenic
1061092286 9:128433479-128433501 CATGCTTGCACTCAGGCAGCTGG + Intronic
1062213787 9:135378280-135378302 GCTGCTGGCACACATGGGGCGGG - Intergenic
1062424458 9:136499594-136499616 ACAGCTGGCACTCAGGAAGCCGG + Intronic
1185796884 X:2972969-2972991 GTGGCTTGCACCCATGAAGCCGG + Intergenic
1187037008 X:15550853-15550875 GCTGCTTTCTCTCAGGAAGCTGG - Intronic
1187708505 X:22030674-22030696 GTTGCTTGAACTCAGGAGGCGGG - Intergenic
1188763202 X:34057476-34057498 GTGGCTTGCACCTATGAAGCAGG - Intergenic
1189006285 X:36998899-36998921 GCGGCTTGCACCCATGAAGCAGG - Intergenic
1189042309 X:37554906-37554928 GCGGCTTGCACCCATGAAGCAGG + Intronic
1189414809 X:40804382-40804404 GCAACATGCACCCATGAAGCAGG + Intergenic
1190491069 X:50983207-50983229 GCGGCTTGCACCAATGAAGCGGG - Intergenic
1190548957 X:51558924-51558946 GCAGCTTGCACCTATGAAGCAGG + Intergenic
1192681148 X:73255075-73255097 GTGGCTTGCACCCATGAAGCAGG + Intergenic
1193481686 X:82035431-82035453 GCAGCTTGCACCCATGAAGCAGG - Intergenic
1193945115 X:87724787-87724809 GCAACTTGCACCCATGAAGCAGG + Intergenic
1194027462 X:88770583-88770605 GCAGCTTGTACCCATGAAGCAGG - Intergenic
1194066402 X:89267220-89267242 GAGACTTGCACCCATGAAGCAGG + Intergenic
1194402744 X:93458626-93458648 GCAGCTTGCACCCATGAGGCAGG + Intergenic
1194745810 X:97627270-97627292 GCTGATTGCATTTATGATGCAGG + Intergenic
1195594940 X:106677226-106677248 GCTGCTTGCACTTCTGGTGCAGG - Intronic
1197365793 X:125563319-125563341 GCAGCTTGCACCCATGAAGCAGG + Intergenic
1198823956 X:140679471-140679493 GCTGTTTGCACATATCAAGCTGG - Intergenic
1200305565 X:155022943-155022965 GCTGCTGCCACTCAGGAAGAGGG - Intronic
1200720571 Y:6601341-6601363 GAGACTTGCACCCATGAAGCAGG + Intergenic
1201680276 Y:16638009-16638031 GCTGCTTCCAATCATGCAGGAGG + Intergenic