ID: 917373210

View in Genome Browser
Species Human (GRCh38)
Location 1:174317941-174317963
Sequence AGGGAGAACACAGCAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 6, 2: 30, 3: 70, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917373210_917373225 26 Left 917373210 1:174317941-174317963 CCCACAGTTGCTGTGTTCTCCCT 0: 1
1: 6
2: 30
3: 70
4: 351
Right 917373225 1:174317990-174318012 CACCATGTCACTGATGCCAGGGG 0: 1
1: 0
2: 7
3: 24
4: 179
917373210_917373222 24 Left 917373210 1:174317941-174317963 CCCACAGTTGCTGTGTTCTCCCT 0: 1
1: 6
2: 30
3: 70
4: 351
Right 917373222 1:174317988-174318010 CCCACCATGTCACTGATGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 201
917373210_917373224 25 Left 917373210 1:174317941-174317963 CCCACAGTTGCTGTGTTCTCCCT 0: 1
1: 6
2: 30
3: 70
4: 351
Right 917373224 1:174317989-174318011 CCACCATGTCACTGATGCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917373210 Original CRISPR AGGGAGAACACAGCAACTGT GGG (reversed) Intronic
900080675 1:854956-854978 ATGGAGCACCCAGCAAGTGTAGG + Intergenic
900376651 1:2357788-2357810 AGGGAGAAGACAGCAGGTCTTGG + Intronic
900938844 1:5784790-5784812 AGGGGGACCAGGGCAACTGTTGG - Intergenic
902924815 1:19689097-19689119 AGGGAGAAGACAGGTCCTGTGGG + Intronic
903829523 1:26166096-26166118 AGGGAGAACCCAGCATTAGTGGG - Intergenic
906101626 1:43267587-43267609 GGGGAGAACACAGAGGCTGTGGG - Intronic
906854477 1:49289832-49289854 AGGAAGAACACAGTAAATATAGG + Intronic
908718376 1:67095584-67095606 TGGGAGAAAACAGCAAGAGTAGG + Intronic
910066005 1:83151510-83151532 AGGGAGATCACTGCAAGTGAAGG - Intergenic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
912239260 1:107887795-107887817 AAGGAGATCAAAGCACCTGTGGG - Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913049865 1:115108123-115108145 AGGAAGAACATTGCAAATGTGGG - Intergenic
913324357 1:117613791-117613813 AGTGAGAAAAGACCAACTGTGGG + Intronic
915069907 1:153258173-153258195 AGGGAGAAGACAGGATCTGTTGG - Intergenic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
918037946 1:180893860-180893882 AGGGAGGAGACAGTAACTATGGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919348385 1:196416599-196416621 AGGTAGAACTCAACAGCTGTTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921209389 1:212879912-212879934 AGAGAGCAAACAGCAACAGTTGG - Intronic
921335945 1:214086468-214086490 AGAGAGAACTCAGAAACTATGGG - Intergenic
922139286 1:222866131-222866153 AGGGTGAGCAGAGGAACTGTTGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924146908 1:241085997-241086019 AGCAAGCACACAGGAACTGTGGG + Intronic
1065295865 10:24274389-24274411 ATGGAGAACACAGCCAATCTGGG - Intronic
1065448944 10:25834865-25834887 AGGGAGCACTCATAAACTGTTGG - Intergenic
1065675241 10:28166831-28166853 AGGGGGAAAAAAGCAAGTGTTGG - Intronic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067761236 10:49048667-49048689 AGGGAGCACTCAGAAACTATTGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069336350 10:67356045-67356067 AGGGAAAACCCAGGAACTTTGGG - Intronic
1069914722 10:71780389-71780411 AGGGTGAAGGCAGCAATTGTAGG + Intronic
1071667734 10:87576953-87576975 AGGGAGAACACATCCTCTCTTGG + Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072197228 10:93126567-93126589 AGGGAGAACACAGCCTGGGTGGG + Intergenic
1073669527 10:105572127-105572149 AGGGAGAAGACTGAAAATGTTGG + Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870789 10:107861868-107861890 AGGGAGAGCTCAGCAGCTTTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1077068553 11:656504-656526 AAGGAGAACACAGCTTCTGCAGG + Intronic
1078190127 11:9087315-9087337 AGAGAGCACACAGCAACTGGAGG + Intronic
1079369149 11:19835419-19835441 AGTGAGAAGACAGCAGTTGTAGG + Intronic
1082664081 11:55951580-55951602 AGGAAGAAAACAGTATCTGTTGG + Intergenic
1083953583 11:65970552-65970574 GGGGAGGGCACAGCAGCTGTGGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085223332 11:74895259-74895281 ATGGAGAGCACAGCAACCGAGGG + Intronic
1085379803 11:76105136-76105158 AGATAGATCACAGAAACTGTGGG + Intronic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089609154 11:119660013-119660035 AAGGAGAAGCCAGCAGCTGTTGG - Intronic
1090355513 11:126137921-126137943 GGGGAGAACTCAGCCACTGGTGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1093699331 12:22201195-22201217 AGGTAGAACAAAGAAAATGTTGG - Exonic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094675865 12:32619844-32619866 AGAGAGAACACTGGAACTGCAGG + Exonic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1096879741 12:54658068-54658090 AGGGATAACACAGCCACCCTGGG + Intergenic
1097009510 12:55942197-55942219 AGGGGCAACACAGCAACAGGAGG - Exonic
1097094769 12:56537827-56537849 AGGCAGAAAACAACAAGTGTTGG - Intronic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099764263 12:86961627-86961649 AGGGAGAACACAGCATTTGGGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100388637 12:94127733-94127755 AAGGAGAACACAGTTTCTGTGGG - Intergenic
1103401792 12:120648244-120648266 AGGGAAAACACAAAAACTCTGGG - Intronic
1103706160 12:122874137-122874159 AGGTAGCACACAGCAAGTGCAGG + Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111750496 13:92325423-92325445 AGGAATAACACAGCAACTGTGGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1113658728 13:112088692-112088714 GGGGAGAACACAGCCACAGAGGG + Intergenic
1113658742 13:112088770-112088792 GGGGAGAACACAGCCACAGAGGG + Intergenic
1113658757 13:112088848-112088870 GGGGAGAACACAGCCACAGAGGG + Intergenic
1113734101 13:112664855-112664877 AGGGAGAACCCACCAGATGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117836700 14:59815467-59815489 AGAGAGACCATGGCAACTGTAGG - Intronic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1120934930 14:89885833-89885855 AGAAAGAAGACAGCAACTTTTGG + Intronic
1122448542 14:101784799-101784821 ACGGTGGACACAGCAGCTGTTGG + Intronic
1123216312 14:106812722-106812744 ATGGAGAACACTGCAGCTGTGGG + Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127219302 15:56860985-56861007 AGAGAAAACACAGCAAGTCTTGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129235616 15:74222119-74222141 GGGGAGACCACAACAGCTGTGGG + Intergenic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130080920 15:80732795-80732817 AGGGAGTAAACAGCAAGAGTGGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131273868 15:90964196-90964218 AGGCTGAACATACCAACTGTTGG + Intergenic
1131324048 15:91425325-91425347 AGGGTGAACACAGCAAACATGGG - Intergenic
1131404785 15:92155417-92155439 TAGGAGAACAAAGCAAGTGTGGG + Intronic
1131722481 15:95185444-95185466 AAGCAGAAAACAGCAAGTGTTGG + Intergenic
1131895492 15:97024464-97024486 GGAGAGAAAACAGCAAGTGTTGG + Intergenic
1132241834 15:100263827-100263849 AGCGTGAACACAGCACCTGCTGG - Intronic
1132329317 15:101000661-101000683 AGGGAGAAGACAGCAGATGACGG - Intronic
1133655683 16:7861523-7861545 AGGGAGTACAAGGCAACTTTTGG + Intergenic
1136071202 16:27788349-27788371 AGGAAGATCACCGCAACTATGGG - Exonic
1136407439 16:30056470-30056492 ATGTAAAACACAGCAACTTTGGG - Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1137549036 16:49424230-49424252 AGAGAGAACACAGCAATGGCAGG + Intergenic
1140534389 16:75696119-75696141 AAGGAGAACACAGAAGCTGTTGG + Intronic
1140954547 16:79849816-79849838 AGGGAGGAAGCAGCAGCTGTAGG - Intergenic
1141012547 16:80416363-80416385 AGGGAGAACAAACCAACCCTAGG - Intergenic
1143062726 17:4216195-4216217 AGGGAAAACACAGCAATAGGTGG + Intronic
1144217905 17:13072703-13072725 AGGGAGAACGCAGCACCAGGTGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1149092919 17:52805211-52805233 AGGGAGCGCACAACAACTGAAGG - Intergenic
1149486035 17:57043681-57043703 AGAGAGCAGACAGCAACTTTAGG + Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150325827 17:64256539-64256561 AGGAAGAAACCAGCAACTGGGGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1151112208 17:71691417-71691439 TGTGAGAACAAAGCCACTGTTGG + Intergenic
1151550015 17:74817112-74817134 AGCCAGAACTCAGCAACTGCAGG - Intronic
1152324187 17:79626127-79626149 TGGGAGAACACAGGAAGTGGGGG + Intergenic
1152452208 17:80388795-80388817 AGGGAGGCCGCAGAAACTGTGGG - Intronic
1152856455 17:82667478-82667500 AGGCTGGACACAGCAGCTGTGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153525961 18:5994743-5994765 AAGGAGAACCCAGCAAGTATTGG - Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155190264 18:23423309-23423331 AAGCAGAACACACCAAATGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156415790 18:36888173-36888195 GGGGAGAACACTACTACTGTGGG + Intronic
1158231107 18:55256471-55256493 AGGAAGAACACAGCAAAGGAGGG + Intronic
1158845217 18:61434940-61434962 AGGGTAAACACAGGAACTCTAGG - Intronic
1160705299 19:526836-526858 AGCCAGGACACAGCAGCTGTGGG - Intergenic
1162128094 19:8510363-8510385 AGGGAGAACGCTGCCACAGTGGG + Exonic
1163035197 19:14565737-14565759 AGGGAGAACAGGGCCACTGCAGG - Exonic
1163205296 19:15798245-15798267 AGTGAGAACACAGCAGGTCTGGG + Intergenic
1163314342 19:16532045-16532067 AGGGTGGAGACAGCAACAGTGGG + Intronic
1163697912 19:18773282-18773304 AGGCAGGACACAGCAGGTGTGGG - Intronic
1164251563 19:23481935-23481957 AGGGAGAAAACCGCACCTTTTGG - Intergenic
1164572593 19:29385179-29385201 AGGGTGAACACAGGAACTGGAGG + Intergenic
1165876277 19:39009440-39009462 AAGAAGAAAACAGCAAGTGTTGG - Intronic
1167735861 19:51294196-51294218 AGGGAGAAGACAGCATCTACCGG - Intergenic
1168081284 19:54012272-54012294 AGGGAGAACACAGTTTCTCTAGG - Exonic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926767322 2:16333532-16333554 AGGTGGCACACAGTAACTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
930042168 2:47134332-47134354 AGGGAGAACACAGGATTTTTAGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930317554 2:49816229-49816251 GGGGAGAACAAAGCAACAGTGGG + Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931685126 2:64785899-64785921 AGGGAGACCACAGCAGCTTCTGG + Intergenic
932280198 2:70484801-70484823 TGGGAGCACACAGAATCTGTGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933758795 2:85660864-85660886 GGGCAGGACACAGCAACCGTGGG - Intronic
935708707 2:105878499-105878521 AGGAAGAAGACAGCATCTGCAGG + Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
937667009 2:124499361-124499383 ATGGAGAAGGCAGCCACTGTGGG + Intronic
937835492 2:126466913-126466935 AAGGACAAAACAGCCACTGTGGG + Intergenic
938134955 2:128749241-128749263 AGGAAGAACACAGCAAAACTGGG - Intergenic
939251242 2:139684192-139684214 AGTGAGAACACAGCATATTTGGG + Intergenic
939344484 2:140946228-140946250 AGGGAACACACAGACACTGTTGG + Intronic
940469403 2:154076087-154076109 AGGGAGAGCAGAGCTGCTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942074462 2:172343813-172343835 AGGGAGGAGGAAGCAACTGTGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943371163 2:187017694-187017716 AGGAAGAACACAGAAGCTGAGGG + Intergenic
943557355 2:189421788-189421810 AGGCAGACCTCAGCAGCTGTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944126977 2:196305170-196305192 ACAGAGATGACAGCAACTGTGGG - Intronic
944238136 2:197459132-197459154 AAGGAGAACGCAGCAACAGTTGG + Intronic
945616337 2:212073120-212073142 AGAGAGAACACTGAAAATGTGGG + Intronic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169806660 20:9566780-9566802 AGGTATAACACAGCAGATGTAGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171209776 20:23308390-23308412 AAGGAGATCACTCCAACTGTGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1174371149 20:50088982-50089004 ATGCAGATCACAGTAACTGTTGG + Intronic
1174847304 20:53955114-53955136 ATGGAGAAGGCATCAACTGTAGG + Intronic
1175817011 20:61888408-61888430 AAGGAGAACACAGCCAGGGTGGG + Intronic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177276676 21:18921329-18921351 AGGGAGAACACTGCTGCTGCTGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1178433632 21:32537753-32537775 AGGGAGGAAACAGCAGGTGTGGG + Intergenic
1179028089 21:37697076-37697098 ATGAAGACCACAGCACCTGTTGG - Intronic
1179423532 21:41254794-41254816 AGAGAGAAGACAGCATCTGTGGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180835515 22:18927643-18927665 AGGATGAACACAGCAGCTGTGGG - Intronic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183718302 22:39547156-39547178 AGGAAGAACACAGGAGCTGCTGG + Intergenic
1203285603 22_KI270734v1_random:152942-152964 AGGATGAACACAGCAGCTGTGGG - Intergenic
950938952 3:16873980-16874002 AGGGAGTACACAGGGACTCTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951230951 3:20179202-20179224 AGGAAGTATACAGCATCTGTGGG + Intronic
951495166 3:23317388-23317410 ACGGAGAGCACACCAACTGTGGG - Intronic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
958559956 3:95734973-95734995 AGAGAAAACATAGCAAGTGTTGG - Intergenic
959111891 3:102132515-102132537 ATGGAGTTCACAGCAGCTGTGGG - Intronic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
960564811 3:119122244-119122266 AGAGAGAACACAGCAATTTGGGG + Intronic
961715918 3:128857385-128857407 ATGGTGAACACAGCATTTGTAGG - Intergenic
962698028 3:137970289-137970311 AGGGAGAACACGTCAAGTGGAGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964093344 3:152901514-152901536 AGGGAGAAGACAGAAAAAGTAGG + Intergenic
964169126 3:153746730-153746752 AGAAAGAACACAGCATGTGTTGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966437474 3:179904848-179904870 AGGGACAGCACAGCAGCAGTAGG - Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967919545 3:194604217-194604239 AAGGAGCACCCAGCAAGTGTCGG + Intronic
968017908 3:195356193-195356215 GGAAAGAGCACAGCAACTGTGGG + Intronic
968480665 4:831739-831761 AGGGAGAACACGGCCATTGGGGG + Intergenic
968500322 4:946939-946961 AGGGAGAGCACGGCCCCTGTAGG + Intronic
969161159 4:5260373-5260395 AAGGAGCACACAGCTAGTGTGGG + Intronic
969436223 4:7191227-7191249 AGGGAGGACTCTGCAGCTGTGGG - Intergenic
971451603 4:26806200-26806222 CAGGAGAAAACAGCAACTATAGG - Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972479763 4:39486216-39486238 ATGGTGAACACAGCATTTGTAGG + Intergenic
973207999 4:47582184-47582206 AGGGTGATCACAGCTACTCTGGG + Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
974860013 4:67508958-67508980 AGGCAGAAGACAGCAACTAAAGG - Exonic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
976523468 4:86058328-86058350 AGGGGGAGGACAGCATCTGTGGG - Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978917074 4:114140169-114140191 AGTGAGAACACAGCATGTTTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979067607 4:116157862-116157884 TGGGAGAACACAGAAACTGAAGG - Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981437773 4:144746766-144746788 AGGGAGAACCCAGGAGGTGTAGG - Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981551869 4:145949905-145949927 TGGGAAAACACAGCAACAATGGG - Intergenic
981629321 4:146800187-146800209 AGAGGGAACACAGCAAATGTAGG - Intronic
982761977 4:159295230-159295252 ATGAAAAACACACCAACTGTTGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
984493553 4:180467965-180467987 AGGTAGAATGCAGAAACTGTAGG - Intergenic
984871318 4:184327761-184327783 AGGAAGAACACAGCAAATGCTGG + Intergenic
985192746 4:187394314-187394336 AGAGAGAATACTGCAACTGCAGG + Intergenic
986809957 5:11346469-11346491 AGGGACAATACTGCAGCTGTCGG + Exonic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994005472 5:94832105-94832127 AAGGATACCACAGAAACTGTAGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
997073188 5:130641707-130641729 CTGGAGAACACTACAACTGTAGG + Intergenic
997607503 5:135185639-135185661 AGGCAGAGCCCAGCAGCTGTGGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999145293 5:149389020-149389042 AGGAAGAACTCAGTAAATGTCGG + Intronic
999736868 5:154519357-154519379 AGGGAGAAGGGAGCACCTGTGGG - Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002881244 6:1254416-1254438 AGGGAGAAGGCAGCATCTGCAGG + Intergenic
1005300537 6:24465980-24466002 AGCAAGAACACAGCCACTCTGGG + Intronic
1005843850 6:29762498-29762520 AGGGCTAACAGAGCATCTGTGGG - Intergenic
1006822850 6:36912190-36912212 AGGAAGAACACAGCAGATGCTGG - Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009742444 6:67764318-67764340 AGACAAAACACAGCAAGTGTTGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1012807207 6:103909168-103909190 AAAGAGAGCACAGCAACTGAAGG - Intergenic
1013470127 6:110456733-110456755 AGGGAGAACACATCGAGTTTGGG - Exonic
1013555660 6:111254684-111254706 AGTGAGAACATGGCAAGTGTAGG - Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1014795788 6:125722673-125722695 AGTGAGAACAGAGCAGCTATGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016427865 6:143953677-143953699 AGGGAGAAAACAACAAATTTTGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018417640 6:163614946-163614968 AGTGAGAACTCAGCCACAGTGGG - Intergenic
1018468798 6:164078858-164078880 AGAGAGTACTCAGCAACTGTGGG - Intergenic
1018732627 6:166663759-166663781 AGGATGAACACAGCAACTGCTGG + Intronic
1018835094 6:167477133-167477155 GGGGAGAACACAGCCACTGAAGG + Intergenic
1019270399 7:143923-143945 AGTGTGAACACAGCATCTGAGGG - Intergenic
1020113715 7:5463138-5463160 AGACAGAAAACAGCAAGTGTTGG + Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1020738725 7:11986256-11986278 TGTGAGAACACAGCAAATGGTGG - Intergenic
1021298407 7:18938694-18938716 AGAGTGAATACTGCAACTGTTGG + Intronic
1021590018 7:22250928-22250950 AGGGGGAACACACCCAGTGTAGG + Intronic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022674528 7:32486025-32486047 AGGTAGAACACAGCTAATGCTGG + Exonic
1023085260 7:36564029-36564051 AGGCAGATCACAGCTACTGTGGG - Intronic
1023197682 7:37659450-37659472 ATGGAAAACAATGCAACTGTAGG + Intergenic
1023975590 7:45027532-45027554 AGGCAGCACCCAGAAACTGTTGG - Intronic
1024658791 7:51473971-51473993 AGGGAGAAGACAGCATCTACAGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027278104 7:76583265-76583287 AGGGAGATCACTGCAAGTGAAGG + Intergenic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034164529 7:149015121-149015143 AGGGGGAAGAAAGCAAGTGTCGG + Intronic
1034491506 7:151395545-151395567 AGGGAGAAGGCAGCATCTGCAGG + Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1036685186 8:10904749-10904771 AGGCTGAACACAGCACCTGGGGG + Intronic
1038376225 8:27042790-27042812 ACGGAGAACACAAGAACTGGAGG - Intergenic
1038863039 8:31408577-31408599 AGGAACTGCACAGCAACTGTGGG - Intergenic
1039240982 8:35556585-35556607 AGGAGGAACACATCCACTGTAGG + Intronic
1039846986 8:41332473-41332495 AGGAAGAACATAGCCACTGTGGG - Intergenic
1040295980 8:46149304-46149326 GGGGAGATCACAGGAAATGTTGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041640423 8:60193881-60193903 AGAGAGAACACAGAAAGTGGAGG - Intronic
1042596479 8:70453323-70453345 GGGGACCACTCAGCAACTGTAGG - Intergenic
1043066871 8:75583680-75583702 AGGGAGAACACAGGATTTTTAGG + Intergenic
1046751907 8:117935183-117935205 AGAAACAACACAGCAGCTGTAGG + Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047246681 8:123152285-123152307 AGGGAGAACTCAGCAGCAGGTGG + Intergenic
1047273495 8:123386034-123386056 AAGGAGAAAATAGCAATTGTTGG + Intronic
1047352540 8:124089311-124089333 AGGAAGAACACAATAATTGTGGG - Intronic
1047359668 8:124156633-124156655 AGGGAGCACTTAGAAACTGTGGG - Intergenic
1047755398 8:127914300-127914322 AGGCAGAAAATAGCAAGTGTTGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048281908 8:133112058-133112080 TGGGTGAACACAGCCACTCTTGG - Intronic
1048831984 8:138486495-138486517 CGGAAGAACAAAGCAACTGCAGG - Intronic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052212384 9:25920973-25920995 AGGGGGAACCCATCAACTCTGGG - Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052913504 9:33905675-33905697 AGGGAAAACAGGGCAACTGATGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054801903 9:69358203-69358225 AGAAAGAAGACAGCAAGTGTTGG - Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056608750 9:88111279-88111301 TGGGAAAACAGAGCAACTCTAGG - Intergenic
1057426322 9:94952928-94952950 AAGGAAAAAACAGCAACTGAAGG + Intronic
1057530735 9:95843575-95843597 AAGTAGAAAACAGCAAATGTTGG - Intergenic
1057624870 9:96668059-96668081 AGGTAGAGCACAGGAACAGTGGG + Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1059323021 9:113483779-113483801 AGGGAGCACTCAGCAGCTGCTGG + Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061080330 9:128365891-128365913 AGGGAGAACACGGGGCCTGTGGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185463366 X:342433-342455 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463374 X:342460-342482 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463465 X:342784-342806 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463473 X:342811-342833 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463481 X:342838-342860 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463489 X:342865-342887 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463497 X:342892-342914 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463793 X:343919-343941 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463801 X:343946-343968 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463809 X:343973-343995 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463856 X:344135-344157 AGGGAGACCTCAGCAACGGGAGG + Intronic
1186422663 X:9438785-9438807 AGGGAGAAGACAGCATCTACAGG - Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188973266 X:36642555-36642577 AGGAAAAGCAAAGCAACTGTGGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192405988 X:70887034-70887056 AGGGAGTACATACCCACTGTGGG - Intronic
1192664495 X:73074099-73074121 AGGGAAAAGATAGCAAATGTTGG - Intergenic
1193015910 X:76733615-76733637 AGGGAGTCCAAGGCAACTGTAGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193776485 X:85649038-85649060 AGAGAGAAGACAGCAAGTGCAGG - Intergenic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194091474 X:89584794-89584816 ATGGTGAACACGGCATCTGTAGG - Intergenic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198759874 X:140020731-140020753 AAGGAGCACACAGAAACTTTTGG + Intergenic
1199018667 X:142848908-142848930 ACAGAGCACACAGCAACTGGGGG - Intergenic
1199104152 X:143841782-143841804 AAGGAGAACACATACACTGTTGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1200444114 Y:3240856-3240878 ATGGTGAACACGGCATCTGTAGG - Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1201689508 Y:16747307-16747329 AGGGAGAACACAGGAACACAGGG - Intergenic