ID: 917377304

View in Genome Browser
Species Human (GRCh38)
Location 1:174363254-174363276
Sequence TTGGCTATTCAAGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 1, 2: 20, 3: 139, 4: 488}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917377299_917377304 8 Left 917377299 1:174363223-174363245 CCAGCTTTGTTTCTTTTTGCTTA 0: 2
1: 22
2: 107
3: 302
4: 1740
Right 917377304 1:174363254-174363276 TTGGCTATTCAAGCTTTTCTGGG 0: 1
1: 1
2: 20
3: 139
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917377304 Original CRISPR TTGGCTATTCAAGCTTTTCT GGG Intronic
904448277 1:30593358-30593380 TTGGCTATTCAGGATTTCTTGGG - Intergenic
905658485 1:39701832-39701854 TTGGCTGTTCAACCCTTTCTGGG + Intronic
906081977 1:43097556-43097578 TTAGCTATTCAGGCTTTTATGGG - Intergenic
906573824 1:46869461-46869483 TTGGCTACTCAGGCTCTTTTTGG - Intergenic
906893948 1:49750563-49750585 TTGGCTATACAGGCTTCTTTTGG + Intronic
907453190 1:54560296-54560318 TTGGCCCTAAAAGCTTTTCTGGG + Intronic
907900962 1:58741062-58741084 TTGGCTACTCCTGCTTTCCTAGG + Intergenic
908864763 1:68534883-68534905 TTGGCTATTCAGGATTTTTTTGG - Intergenic
909230334 1:73081107-73081129 TTGACTATTCAAGTTCTTTTGGG - Intergenic
909460821 1:75911441-75911463 CATCCTATTCAAGCTTTTCTTGG + Intronic
910373587 1:86544990-86545012 TTGGCTATGCAGGCTTCTTTTGG - Intergenic
910908339 1:92206670-92206692 TTGGCTATTCAGGGTCTTTTGGG + Intergenic
912198375 1:107426645-107426667 TTGGCTATTTGGGCTTTTTTTGG + Intronic
916706945 1:167360663-167360685 TTGGCTATTCAGGCTCTTTTTGG + Intronic
916829781 1:168479021-168479043 TTGGCTGTTCAGGCATTTTTTGG - Intergenic
916859119 1:168784131-168784153 TTAGCTATCCAAGATTTTCCTGG - Intergenic
917046712 1:170868656-170868678 TTGGCTATGCGAGCTCTTTTTGG + Intergenic
917290321 1:173465809-173465831 TTGTCTATTCATGCTCTTTTGGG - Intergenic
917327886 1:173851985-173852007 TTGGCTATTAAACCTTCTCTTGG + Intronic
917377304 1:174363254-174363276 TTGGCTATTCAAGCTTTTCTGGG + Intronic
918536369 1:185579292-185579314 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
918789760 1:188811538-188811560 TTGGCTATGCAAGCTCTGTTTGG - Intergenic
919144689 1:193619042-193619064 TTGGCTATTCAAGATCTTTGCGG - Intergenic
920643610 1:207778757-207778779 TTGACTATTCAGGCTCTTTTTGG + Intronic
920931507 1:210393366-210393388 TGGTCTTTTCAAGCTTGTCTTGG + Intronic
921962081 1:221046720-221046742 TTGGCTACTCAAGCATCACTGGG - Intergenic
923458856 1:234189210-234189232 CTGGCAATTCAAGCATTTCTTGG - Intronic
923994927 1:239483353-239483375 TTAGCTAATCATGCTGTTCTTGG + Intronic
924800085 1:247323014-247323036 CTGCCTATTTTAGCTTTTCTGGG + Intronic
1063824245 10:9876704-9876726 TTGGCTTTTCCATCTTTTTTAGG - Intergenic
1064250514 10:13703110-13703132 TTGTCTAATTCAGCTTTTCTGGG - Intronic
1064343542 10:14508938-14508960 TTGGCCAGTCAAGGTCTTCTTGG - Intergenic
1066184893 10:32999866-32999888 TTGGCTATTCATGCTCTTTTTGG + Intronic
1066565004 10:36712461-36712483 TCTGCTATTCCAGCTGTTCTTGG - Intergenic
1068271288 10:54729089-54729111 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1068374468 10:56160572-56160594 TTGGCTATTTAAACCTTGCTAGG - Intergenic
1068490750 10:57720735-57720757 TTGGCAATGCAGGCTTTTTTTGG - Intergenic
1068575580 10:58680693-58680715 TTGGCTATACAGGCTCTTTTTGG - Intronic
1068627514 10:59265254-59265276 TCTGCTATTCAAGCTCTTCTAGG - Intronic
1068925732 10:62535802-62535824 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1069229591 10:65992619-65992641 TTGGGTATTCTCTCTTTTCTTGG + Intronic
1069234060 10:66048145-66048167 TTGGCTATTCAGACTCTTTTTGG - Intronic
1069320812 10:67169305-67169327 TTGGCTATTCAGGCTCATTTTGG - Intronic
1069530695 10:69217129-69217151 TTGGCTATTCAAGGATATCTAGG - Intergenic
1069671835 10:70212627-70212649 TTGCCTATTCTACCTATTCTAGG - Intronic
1070375092 10:75822481-75822503 TTGGCTATTCAGGCTTTTTTTGG - Intronic
1070860735 10:79658437-79658459 TTGGCCATTCAGCCTTTTTTTGG + Intergenic
1071643457 10:87339318-87339340 TTGGCCATTCAGCCTTTTTTTGG - Intergenic
1071772861 10:88749287-88749309 TTGACTATTCAGGCTTCTTTTGG - Intronic
1072024349 10:91439554-91439576 TTGGCTATACAGGCTCTTTTTGG + Intronic
1072045313 10:91648820-91648842 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1072203896 10:93185421-93185443 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
1072662158 10:97369815-97369837 GAGGCTAATCAAGCTGTTCTAGG + Intronic
1074204100 10:111266914-111266936 TTAGCTTTTCAGGGTTTTCTTGG + Intergenic
1074521918 10:114233793-114233815 TTGGCAAGTCGAGCTCTTCTGGG + Intergenic
1074645813 10:115450795-115450817 TTGGCTATTCAGGCTCTATTTGG - Intronic
1075308240 10:121387711-121387733 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1076074151 10:127519601-127519623 TTGACTATTCGGGCTTTTTTTGG - Intergenic
1077763179 11:5126119-5126141 TTGGCTATTCAGTCTCTTTTTGG - Intergenic
1077841325 11:5978176-5978198 TTGGCTATTCAGGTTCTTTTTGG + Intergenic
1077984439 11:7336821-7336843 CTGGCTATTCGAGCTCTTTTTGG + Intronic
1079879414 11:25906225-25906247 TTGGGTATTCAGGCTCTTTTTGG - Intergenic
1080085481 11:28276607-28276629 TTGGCTATTCAAGCTCTTTTTGG - Intronic
1080303165 11:30807250-30807272 TTGGCTATACAGGCTCTTTTTGG + Intergenic
1080709120 11:34729461-34729483 TTGGCTATTTGAGCTGTTTTTGG + Intergenic
1081463561 11:43295067-43295089 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1081850946 11:46274801-46274823 TTGTCTATTAAAGATTTTCCAGG - Intergenic
1082109047 11:48252928-48252950 TTGGCTATTCAGGATTTCTTTGG + Intergenic
1084584151 11:70046510-70046532 TTGTTATTTCAAGCTTTTCTAGG + Intergenic
1085194912 11:74663695-74663717 TTGGATAGTCAAACTTTTTTAGG + Intronic
1085291762 11:75405327-75405349 TTGGCTGCTCAAGATTTTCTAGG + Intronic
1086045863 11:82530810-82530832 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1086083385 11:82929401-82929423 TAAGCAATTAAAGCTTTTCTTGG + Intronic
1086237873 11:84653860-84653882 TTGTCTCTTCTAGCCTTTCTTGG + Intronic
1086512379 11:87573169-87573191 ATGGCTAGGCATGCTTTTCTTGG - Intergenic
1087060850 11:93976092-93976114 TTGGCTATTCAGGTTCTTTTTGG - Intergenic
1087119355 11:94556925-94556947 TTGGCTATTCGGGCTCTTTTTGG + Intronic
1087227569 11:95619136-95619158 TTGGTTTTTCAATATTTTCTTGG - Intergenic
1087310919 11:96542179-96542201 TTGGCTATTCAGGATTTTTATGG + Intergenic
1088184701 11:107153410-107153432 TTTCCTCTTCAAGCTTTTTTTGG + Intergenic
1088356577 11:108950369-108950391 TTGGCTATACAGGCTTTTTTTGG + Intergenic
1088603425 11:111505136-111505158 TTGGCTATTTGGGCTTTTTTTGG - Intronic
1090143398 11:124291071-124291093 TTGGCTATTCAGGCTGTTATTGG + Intergenic
1091249518 11:134130801-134130823 ATGTCTATTCCAGCCTTTCTGGG + Intronic
1092700354 12:11222203-11222225 TTGGCTATGCAGGCTTTTTTTGG - Intergenic
1092952434 12:13519350-13519372 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1093689740 12:22097036-22097058 TTGGCTATTCAGGCTTATTTTGG + Intronic
1097499169 12:60380228-60380250 TTGGCTCTACAAGCTTTGTTTGG - Intergenic
1097565461 12:61263903-61263925 TTAGTTATACAAGCTTTTTTTGG - Intergenic
1097749707 12:63338206-63338228 TTGGCTATTGAAGCTTGTGCAGG - Intergenic
1097977421 12:65702162-65702184 TTGGCTATTCAGGGTCTTTTTGG + Intergenic
1098609611 12:72439271-72439293 TTGGCTATTCAGGGTCTTTTTGG + Intronic
1098674473 12:73271457-73271479 TTGGCCATTCAGGCTCTTTTTGG - Intergenic
1099323297 12:81178815-81178837 TTGGCTATTTGAGCTCTTTTTGG - Intronic
1099400413 12:82196641-82196663 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
1099973050 12:89519682-89519704 ATGGCAAATCAAACTTTTCTAGG - Exonic
1100099597 12:91087295-91087317 TTGGCTATTTAGGCATTTTTTGG + Intergenic
1100196350 12:92250580-92250602 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1100894200 12:99161009-99161031 TTGGCTATTCAGGATCTTTTTGG + Intronic
1100937264 12:99683244-99683266 TTGGATATTCTCTCTTTTCTTGG - Intronic
1101215992 12:102583628-102583650 TTGGCTATTCAAGCACTTTTTGG - Intergenic
1101219394 12:102621569-102621591 TTACCTATTAAAGCTTTTCAGGG - Intergenic
1102386745 12:112516433-112516455 TTGCCTTTTCCAGCTTTTCGAGG + Intergenic
1104291557 12:127473741-127473763 GCGGCTATTCAAGGGTTTCTTGG - Intergenic
1104377297 12:128275911-128275933 TTGCCTTTTCCAGCTTCTCTTGG + Intronic
1105478596 13:20751629-20751651 TTGGCCATTCAGGCTGTTTTTGG + Intronic
1106425914 13:29629493-29629515 TTGGCTATTCGGGCTCTTTTTGG - Intergenic
1106648193 13:31659772-31659794 TTGGCTATTTGGGCTTTTTTGGG + Intergenic
1107439997 13:40417918-40417940 TTGGCTATGCGGGCTTTTTTTGG - Intergenic
1107543363 13:41413978-41414000 TTGTCTTTTCAAGCTTTTAGAGG + Intergenic
1108477312 13:50833709-50833731 TTGGCTATGCAGGCTCTTTTCGG - Intronic
1108629173 13:52264244-52264266 TTGGCTATACGAGCTCTTTTTGG - Intergenic
1108656882 13:52542232-52542254 TTGGCTATACGAGCTCTTTTTGG + Intergenic
1108889786 13:55242259-55242281 TTCACTATTAAAGCTTTTCAGGG - Intergenic
1109003508 13:56836802-56836824 TTGGCTATTCAGGCTTATTTTGG - Intergenic
1109200677 13:59427373-59427395 TTGGCTATGCAGGCTATTTTTGG - Intergenic
1109246299 13:59957844-59957866 TTGGCTATTTTAGCTCTCCTGGG + Intronic
1109308713 13:60667190-60667212 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1109471492 13:62811675-62811697 TTGGCTATTTGAGCTTTTTTGGG + Intergenic
1109712330 13:66177930-66177952 TTGGCTATTGCAGCAATTCTCGG + Intergenic
1109767633 13:66925972-66925994 TTGGTTATTAAAGATTCTCTGGG - Intronic
1109911539 13:68918520-68918542 TTGCCTCTTCTACCTTTTCTAGG - Intergenic
1110134972 13:72055481-72055503 GTGCCTATACAAGCTTTGCTGGG - Intergenic
1110396569 13:75036534-75036556 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1110788860 13:79565164-79565186 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1111077301 13:83253914-83253936 TTGGCTATTCACGCTCTTTTTGG - Intergenic
1111338447 13:86852111-86852133 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1111491961 13:88990646-88990668 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1111725167 13:91998311-91998333 TTTGCTCTTCAAGATTATCTTGG + Intronic
1113424498 13:110196981-110197003 TTTACTATTCCAGGTTTTCTAGG - Intronic
1114694242 14:24611977-24611999 TTGGCTGTTACTGCTTTTCTGGG + Intergenic
1114971504 14:28035377-28035399 TTGGCTATTCAAACTCTTTTTGG - Intergenic
1115538490 14:34396171-34396193 TTGGCTATACAGGCTTTTTTTGG - Intronic
1115947682 14:38681006-38681028 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1116108092 14:40537647-40537669 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1116148744 14:41110009-41110031 TTTGCAATTCAGACTTTTCTTGG - Intergenic
1116318303 14:43426532-43426554 TTGGCTATACAGGCTTTTTTTGG - Intergenic
1116593810 14:46814099-46814121 TTGGCTATTCAGGCTTTTTCTGG - Intergenic
1116796632 14:49398103-49398125 TTGGCTATTTAGGCTCTTTTTGG - Intergenic
1117062827 14:51980628-51980650 TTGGTTATTTTAGCTTTTCCAGG - Intergenic
1117502695 14:56369491-56369513 TTGGCTATTCAGGCTTTTCTTGG + Intergenic
1117824993 14:59692581-59692603 TTGGCTCTTCAGGCTCTTTTTGG - Intronic
1117893050 14:60447713-60447735 TTGGCTATGCGGGCTTTTTTTGG - Intronic
1117917935 14:60697947-60697969 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1118034555 14:61852390-61852412 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1119068595 14:71556849-71556871 CTGTCTATTCAGACTTTTCTTGG + Intronic
1119255593 14:73193319-73193341 TTGGTTTTTCAAGCTTTTTGAGG + Intronic
1120422595 14:84307128-84307150 TTGGCTACTTAAGCTCTTTTTGG - Intergenic
1121168206 14:91829650-91829672 CTGGTTTTTCAAGCTTTTGTAGG + Intronic
1121623812 14:95370183-95370205 CTGGCTATCCAGGCTTCTCTAGG - Intergenic
1121742749 14:96265613-96265635 TTGTCTATTCAAAGCTTTCTAGG + Intronic
1121928967 14:97954740-97954762 TTGGCTATGCAAATATTTCTGGG + Intronic
1123184258 14:106499911-106499933 TTGGCTATCCAAGTCTTTTTTGG + Intergenic
1123430638 15:20212891-20212913 TTGGTTATTCAATCTTTTCTTGG - Intergenic
1123983964 15:25628107-25628129 TTGGCTATTCAGACTTTTTCTGG + Intergenic
1126086625 15:45016487-45016509 TTGGCAATGCAGGCTTTTTTTGG + Intergenic
1126377123 15:48007671-48007693 TTTTCTATTCAAGTTTTTCAGGG - Intergenic
1126480627 15:49115792-49115814 TTGGCTATTTGAGCTCTTTTTGG - Intronic
1126981135 15:54244443-54244465 TTGGTTATTCAGGCTCTTTTTGG + Intronic
1128801246 15:70498464-70498486 TTGGCTGTTCAGGATTCTCTGGG - Intergenic
1128880331 15:71236642-71236664 TTTGTTATTTCAGCTTTTCTAGG + Intronic
1130248439 15:82276376-82276398 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1130451902 15:84063409-84063431 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1130539993 15:84815701-84815723 TTGGCAGTTCAAACTTTCCTTGG - Intergenic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1130737995 15:86570736-86570758 TTTGCTATTCATGTTTTTATGGG + Intronic
1131474267 15:92723018-92723040 TTGGCTATGCAGGCTGTTTTTGG + Intronic
1131493831 15:92885459-92885481 TTTGATTTTCAAGCATTTCTTGG - Intronic
1131660470 15:94509923-94509945 TTGGCTATTCAGGGTCTTGTTGG - Intergenic
1131725426 15:95218006-95218028 TTGTCTATTTTTGCTTTTCTTGG - Intergenic
1133093239 16:3421875-3421897 TTGGCTATTCAGGCTCTTTTTGG + Intronic
1136695257 16:32074563-32074585 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1136795756 16:33017820-33017842 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1136854001 16:33638326-33638348 TTGGTTATTCAATCTTTTCTTGG + Intergenic
1136874162 16:33836560-33836582 TTGGCTATTCAGGCTGTTTTTGG + Intergenic
1137307252 16:47214705-47214727 TTGGCTATTCAGGCTTTGCTAGG + Intronic
1137461051 16:48663816-48663838 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1137918056 16:52454542-52454564 TTGGAAATTCAAGCTCTTTTAGG + Intronic
1138753029 16:59447078-59447100 TGGGCTATTCAGACTTTTTTTGG + Intergenic
1138928735 16:61625459-61625481 TTGGCTATTTAAATCTTTCTAGG + Intergenic
1140437774 16:74962260-74962282 TTGGCTATACAGGCTCTTTTTGG + Intronic
1141211385 16:81983586-81983608 TTGGCTATTCAGGCTCTCTTTGG - Intergenic
1203098014 16_KI270728v1_random:1279479-1279501 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
1203115581 16_KI270728v1_random:1486765-1486787 TTGGTTATTCAATCTTTTCTTGG + Intergenic
1142649429 17:1337915-1337937 TTTGCTGTTCAAGATTTTATTGG - Intergenic
1143337383 17:6182413-6182435 TTGGCTATTCCATCTGGTCTGGG - Intergenic
1144281373 17:13730421-13730443 TTGTCTCTTCCAGCTTTTCATGG - Intergenic
1144399335 17:14880379-14880401 TTGGCTATTCAGGCCCTTTTTGG + Intergenic
1144617030 17:16786044-16786066 TTAGCTATTCCAGCTGTTTTGGG + Intronic
1144895662 17:18529630-18529652 TTAGCTATTCCAGCTGTTTTGGG - Intergenic
1145136555 17:20414601-20414623 TTAGCTATTCCAGCTGTTTTGGG + Intergenic
1145417275 17:22728655-22728677 TTGGCGATGCAGGCTTTTTTTGG + Intergenic
1146654949 17:34629660-34629682 CTGGCTATTCAAGCTGCCCTGGG - Intronic
1146959899 17:36965279-36965301 TTGCCTTTTCCAGCTTTTATAGG + Intronic
1149152775 17:53589503-53589525 TTAGCTATTTGAGCTTTTTTTGG - Intergenic
1149160067 17:53682309-53682331 TTGGCTATTTGAGCTCTTTTTGG + Intergenic
1149393059 17:56211577-56211599 TTGGCTATGCAGGCTTTTTTTGG + Intronic
1150063547 17:62089626-62089648 TTTGCTATTTATGCTTCTCTTGG - Intergenic
1150852866 17:68721856-68721878 TTGGCTATTAAAGATTAGCTAGG + Intergenic
1153133050 18:1879691-1879713 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1153460422 18:5326864-5326886 TTGGCTATTCGGGCTCTTTTTGG - Intergenic
1155250588 18:23949701-23949723 TTGGCTACCCATGCCTTTCTTGG + Intronic
1155286701 18:24295976-24295998 TTGGCTATTCAGGTTCTTATGGG + Intronic
1156026397 18:32659868-32659890 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
1156248065 18:35322325-35322347 TTGGCTCTTCAATTCTTTCTGGG + Intergenic
1156437553 18:37149094-37149116 TTGGCTATATAAGCTCTTTTTGG - Intronic
1156662952 18:39369359-39369381 TTGGCTATTCAGGGTTTTTGTGG - Intergenic
1156816583 18:41318792-41318814 TTGGATATTCAAGATTTCATAGG - Intergenic
1156824349 18:41412516-41412538 TTGGCTATTCAGGCTATTTCTGG - Intergenic
1156929618 18:42625833-42625855 TTGCCTATTCCAGCTTCTATAGG - Intergenic
1156965728 18:43089545-43089567 TTGGCTATTTGAGCTCTTATTGG - Intronic
1157068558 18:44379737-44379759 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1157390693 18:47300491-47300513 TTGGCTATTCATTCTCCTCTTGG + Intergenic
1157594934 18:48858698-48858720 TGGGCTTTTCAAGATTATCTAGG + Intronic
1158036781 18:53041486-53041508 TTGGCTATCCAGGTTTTTTTTGG + Intronic
1158599401 18:58844356-58844378 TTTACTTTTCAAGCTTTTCAGGG - Intergenic
1158767888 18:60477418-60477440 TTGGCTATTCAGGTTCTTTTTGG + Intergenic
1159621101 18:70639355-70639377 TTGGCTATTCTGGGTCTTCTGGG + Intronic
1159626665 18:70703189-70703211 TTGCCTCTTCCAGCTTTTCATGG + Intergenic
1159686101 18:71422905-71422927 TTGGCTATACAGGCCTTTTTTGG + Intergenic
1160376781 18:78419887-78419909 TTGGCTCTGCTAGGTTTTCTGGG - Intergenic
1165651250 19:37492505-37492527 TTGGCTATTCAAGGTCTTTTGGG + Intergenic
1167537024 19:50060246-50060268 TTGGCGTTTCAAGCTCTTCCAGG + Intergenic
1167773116 19:51534314-51534336 TTGGCTATTCAGGTTCTTTTTGG + Intergenic
925607117 2:5670887-5670909 TTGCTTTTTGAAGCTTTTCTTGG + Intergenic
925689032 2:6502140-6502162 TTGGTTATTCATCCTTTTCTGGG + Intergenic
925790668 2:7483470-7483492 TTGTCTATTCAGGCTTTTTTTGG - Intergenic
926514948 2:13831690-13831712 TTGGCTATTCTGGCTCTTTTTGG - Intergenic
926866630 2:17366482-17366504 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
927127887 2:20029855-20029877 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
927234964 2:20864439-20864461 TTGGCTATTCAAGTTTTTTCTGG - Intergenic
927363123 2:22260594-22260616 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
927368569 2:22327943-22327965 TTTGCCATTCATGCTTTTTTAGG - Intergenic
928693826 2:33828167-33828189 TTGGCTATTTGAGCTCTTTTTGG + Intergenic
930749651 2:54921599-54921621 TTGGCTATTCAGGTTTTTTGTGG - Intronic
930831428 2:55747936-55747958 TTGGCTATTCAGGCTCTTTGTGG - Intergenic
930894116 2:56425701-56425723 TTGGCAATACAGGCTTTTTTTGG - Intergenic
931045500 2:58347474-58347496 TTGGCTATTCAGGCTAATTTTGG - Intergenic
931539783 2:63317434-63317456 TTGGGTGTTCAGGCTTTTTTTGG - Intronic
932014962 2:68016476-68016498 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
933161783 2:79032929-79032951 TTGCCTATTCCAGCTTTTAGAGG - Intergenic
933231750 2:79815731-79815753 TTGGCTATGCAGGCTCTTTTTGG + Intronic
933410699 2:81921398-81921420 TCGGCTATTGAAGCTTTTTAAGG + Intergenic
933605678 2:84380266-84380288 TTGCCTATTCAGGCTCTTTTTGG - Intergenic
933936910 2:87213459-87213481 TTGGCTGGGGAAGCTTTTCTTGG + Intergenic
934923273 2:98363123-98363145 TTGGCTATACAAGCTCTTTTTGG + Intronic
935061045 2:99608059-99608081 TTGGCTTTTGAAGCTCTTCAGGG + Intronic
935338652 2:102040000-102040022 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
935807682 2:106765117-106765139 TTGGTTATTAAAGTTTTTCTAGG - Intergenic
936356233 2:111752366-111752388 TTGGCTGGGGAAGCTTTTCTTGG - Intergenic
936812415 2:116418098-116418120 TTGGCTATTTGGGCTTTTTTAGG - Intergenic
936881556 2:117258084-117258106 TTGGCTATTCGGGCTCTTTTTGG - Intergenic
937008465 2:118540047-118540069 TTGGCTTTTCCAGCTTCTCCTGG + Intergenic
937173968 2:119907636-119907658 TTGGCTATTCAGGATCTTTTAGG - Intronic
937848729 2:126612738-126612760 TTGGCTACTCAGGCTCTTTTTGG + Intergenic
938006628 2:127792359-127792381 TTAGCAATTTAAGCTATTCTTGG + Intronic
939639592 2:144623254-144623276 TTGCCTATTCGAGCTCTTTTTGG + Intergenic
939653242 2:144789917-144789939 TTGGCTATACAGGCTTTTTTTGG - Intergenic
939860242 2:147411416-147411438 TTGGCTATACAGGCTCTTTTTGG + Intergenic
940097789 2:149997753-149997775 TTGGCTATTTAGGCTGTTTTTGG - Intergenic
940392956 2:153153869-153153891 TTGGTTATTCTGGCTTTTTTTGG + Intergenic
940598238 2:155821873-155821895 TTGGCTATTCAGGGTCTTGTAGG - Intergenic
940603019 2:155884873-155884895 TTGGCTATACAAGCTCTTTTTGG - Intergenic
940709025 2:157139808-157139830 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
942224407 2:173802666-173802688 TTGTCTGTTCAGACTTTTCTTGG + Intergenic
942257994 2:174125960-174125982 TTGGCTGTTAAATCTTTTGTGGG - Intronic
942868248 2:180702327-180702349 TTGGCTATTCAGGATTTTTGTGG + Intergenic
943653206 2:190479146-190479168 GAGGCTATTCAAGCCTTTATTGG + Intronic
943714686 2:191137538-191137560 TTGGCTCTTCAGGCTCTTTTTGG - Intronic
943823134 2:192353247-192353269 TTGGCTATTTAAACTTTTAAAGG + Intergenic
943875957 2:193067604-193067626 TTGGCTATTGAAGCAATTTTTGG + Intergenic
944081182 2:195790344-195790366 TTGGCTATTCAAGCTGTTTTTGG - Intronic
944524667 2:200606455-200606477 TTGGCTATACAGGCTCTTTTTGG + Intronic
945521106 2:210828480-210828502 TTGGCTAATCAGGCTCTTTTTGG + Intergenic
945909415 2:215631051-215631073 TTGACTATTCAAGCTCTTTTTGG + Intergenic
946515637 2:220408013-220408035 TTGACTAGTCTAGCTTTTTTTGG + Intergenic
946589909 2:221234016-221234038 ATGGCTATTCAAGGTTTTTGTGG + Intergenic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1170162437 20:13327476-13327498 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1170205964 20:13798982-13799004 TTTCCTCTTGAAGCTTTTCTAGG - Intronic
1170413746 20:16118323-16118345 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1170491589 20:16881413-16881435 TTGGTTATTCAGGCTGTTTTTGG + Intergenic
1170520968 20:17184924-17184946 TTAACTATTCAAGCCTTTTTTGG - Intergenic
1170537200 20:17352368-17352390 TTGGCTATTCGGGCTCTTTTTGG - Intronic
1171130776 20:22651346-22651368 TTAGCTATTCAGGCTTTTTTTGG + Intergenic
1172787060 20:37475393-37475415 TGGGCTAGTGAAGCGTTTCTAGG - Intergenic
1175554866 20:59843368-59843390 TTGGCTATTCAGGTTCTTTTTGG - Intronic
1176349354 21:5779479-5779501 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176356168 21:5900063-5900085 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176543675 21:8177549-8177571 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176562626 21:8360594-8360616 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1176987218 21:15451314-15451336 TTGGCTATACAGGCTCTTTTTGG + Intergenic
1177621959 21:23607362-23607384 TTGGCTATTCAAGCAGTTTTGGG - Intergenic
1177661724 21:24092943-24092965 TTGGTTTTTAAAGCATTTCTTGG + Intergenic
1177985888 21:27974110-27974132 TTGGCTATACATGCTATTTTTGG + Intergenic
1178000671 21:28158895-28158917 TTGTCTCTTCAGACTTTTCTTGG + Intergenic
1178833758 21:36078675-36078697 TTGACTCTTCCAGCTTTTGTGGG - Intronic
1183009206 22:34931139-34931161 TTGGCAATTAAAACATTTCTGGG - Intergenic
1203248543 22_KI270733v1_random:93771-93793 TTGACTATTCAGGCCTTTGTTGG - Intergenic
949118554 3:358219-358241 TTGCCTTTTCCAGCTTTTCCAGG + Intronic
949593768 3:5522250-5522272 TTGGCTATTCAGGTTCTTTTTGG + Intergenic
949714415 3:6912346-6912368 TTGGCTATGCAAACCTTTGTTGG + Intronic
949825438 3:8159832-8159854 TTGTCTGTTCAGACTTTTCTTGG + Intergenic
950619260 3:14190266-14190288 TTGGCTATGCAGGCTCTTTTTGG + Intronic
950848547 3:16039362-16039384 TTGGTTATTCAGGCTATTTTTGG + Intergenic
951070054 3:18317177-18317199 TTGGCTATTCAGACTCTTTTTGG + Intronic
951070431 3:18321959-18321981 TTGGCTATTCAGACTCTTTTTGG + Intronic
951587567 3:24231077-24231099 TTGGCTATTCAGCCCTTCCTTGG + Intronic
951807094 3:26657771-26657793 TTGGCTTTTCATTCATTTCTGGG + Intronic
952026260 3:29086339-29086361 TTGGGTATTCAGGCTTTTTTTGG + Intergenic
952241650 3:31536203-31536225 TGGGCTTTTAAAGCTTTTCGGGG + Intronic
952663656 3:35879068-35879090 TTGGCAAGTCCTGCTTTTCTAGG - Intergenic
952689487 3:36187886-36187908 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
952718395 3:36506400-36506422 TTGGCTATGCGGGCTTTTTTTGG + Intronic
952940228 3:38438525-38438547 ATGGCTATTCAGGCTCTTTTTGG - Intergenic
952973013 3:38666850-38666872 TTGGCTATTCAGGGTTTTTGTGG - Intergenic
956019679 3:64920871-64920893 TTCACTCTTCAAGATTTTCTTGG - Intergenic
956120396 3:65960277-65960299 TTATCTAGTCAAGCTTTTCTGGG - Intronic
956564706 3:70623419-70623441 TGGGCTATACAATGTTTTCTTGG - Intergenic
957271627 3:78037579-78037601 TTGGCTCTTCAAACCTATCTAGG + Intergenic
957289717 3:78263622-78263644 TTGACTATTCACGCTCTTTTGGG + Intergenic
957312436 3:78538346-78538368 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
958070481 3:88604488-88604510 TTGGCTATGTAGGCTTTTTTGGG - Intergenic
958103692 3:89046986-89047008 TTGACTATTCACACATTTCTGGG + Intergenic
958577754 3:95974273-95974295 TTGAGTATTGCAGCTTTTCTAGG - Intergenic
958894589 3:99815746-99815768 TTGGCTATTCAATATAATCTGGG + Intergenic
958910862 3:99993131-99993153 TTGGCTATTTGAGCTTTTTTTGG + Intronic
959119892 3:102220890-102220912 TTGGCTATACGAGCTCTTTTTGG + Intronic
959428249 3:106219887-106219909 TTGGCTATACAGGCCTTTTTTGG + Intergenic
959524187 3:107357750-107357772 TTGGCTATTTAGGCTTTACTTGG - Intergenic
959779113 3:110206721-110206743 TTGGCTATTCAGGTTATTTTTGG - Intergenic
959846859 3:111042914-111042936 TTGGCTATTCAGGCTGTTTTTGG - Intergenic
960100051 3:113732331-113732353 TTGGCTCTTCCAGCTTCTATAGG - Intronic
960257679 3:115528494-115528516 TTGGCTATTTGGGCTTCTCTTGG + Intergenic
960343258 3:116501100-116501122 TTGGCTATTCAAGCTCTTGTTGG - Intronic
960549163 3:118954375-118954397 TTGGCTATGAAGGCTTTTTTGGG + Intronic
960683763 3:120276133-120276155 TTGGCTATTCAGGCTCTTTTTGG + Intronic
962047828 3:131779352-131779374 TTGGCTATTCAGGTTCTTTTTGG - Intronic
962169945 3:133090570-133090592 TTGACTTCTCAAGCTTTACTTGG - Intronic
962650642 3:137485849-137485871 TTGGCTATTCAGGCTCTTTTGGG + Intergenic
963014155 3:140804702-140804724 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
963591409 3:147264652-147264674 TTGTCAACTCATGCTTTTCTTGG - Intergenic
963635162 3:147785526-147785548 TTGGCTATTCAGGGTCTCCTAGG - Intergenic
964166279 3:153709694-153709716 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
964296141 3:155235529-155235551 CTGGCTATTCAGGCTCTTTTTGG + Intergenic
964462816 3:156954828-156954850 TTGGCTAGTCAGGCTCTTTTAGG + Intronic
964571569 3:158112624-158112646 CTGGTTTTTCAAACTTTTCTTGG + Intronic
965196549 3:165604466-165604488 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
965214687 3:165847602-165847624 TTAACTTTTTAAGCTTTTCTTGG - Intergenic
965249523 3:166325218-166325240 TTGGCTATTCGGGCTCTTTTGGG + Intergenic
965745786 3:171924458-171924480 TTGGCTGTGCAGGCTTTTTTTGG - Intronic
966037716 3:175440356-175440378 TTGGCTATGCAGGCTCTTTTTGG + Intronic
966070518 3:175871811-175871833 TTGGCTATTCAGGCTGTTTTTGG + Intergenic
966369435 3:179232574-179232596 TTGGCTATTCAGACTCTTTTTGG + Intronic
966459579 3:180161303-180161325 TTGGCTACTCAGGCTTTTTCTGG + Intergenic
966519855 3:180861100-180861122 TTGGCTACTCAGGCTTTTTTTGG - Intronic
966910056 3:184554430-184554452 TTGGATATTCAGCATTTTCTTGG + Intronic
967443618 3:189538496-189538518 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
968108994 3:196027071-196027093 TTTGCTATTCTAGCTTTAGTTGG + Intergenic
968315134 3:197717540-197717562 TTGCCTTTTCCAGCTTCTCTAGG - Intronic
970668861 4:18372528-18372550 TTGACTATTCAGGCTCTTTTGGG - Intergenic
970863030 4:20725413-20725435 TTGGTTATTCTAACTTTTCAAGG + Intronic
971207246 4:24583169-24583191 TTGGCTACTCGGGCTTTTGTGGG + Intronic
972062313 4:34891383-34891405 TTGACTATTCTTCCTTTTCTGGG + Intergenic
972063988 4:34916196-34916218 TTGGCTACTCAGGCTCTTTTTGG - Intergenic
972118115 4:35663985-35664007 TTGGCTATACAGGCTCTTTTTGG + Intergenic
972177954 4:36430618-36430640 TTGGCTATTCAAGCTGTATTTGG - Intergenic
972962144 4:44466551-44466573 TTGGCTATTCTGGGTCTTCTGGG - Intergenic
973195992 4:47442483-47442505 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
973237755 4:47924134-47924156 TTGGCTGTTCAGGCTCTTTTTGG - Intronic
973313199 4:48731453-48731475 TTGGCTATGCAGGCTCTTTTTGG - Intronic
974456951 4:62140911-62140933 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
974663362 4:64924057-64924079 TTGGCTATTCAGGCTATATTTGG - Intergenic
974735372 4:65924089-65924111 TGGTCTATTCAAGCTTTAATGGG + Intergenic
975344530 4:73278840-73278862 TTGGCTATTCAGGGTCTTTTTGG + Intergenic
975800065 4:78051833-78051855 TAGGTTATTCAAGGTGTTCTAGG + Intergenic
976157709 4:82165465-82165487 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
976480569 4:85539575-85539597 TTTGCTTTTTAGGCTTTTCTAGG + Intronic
976583255 4:86765304-86765326 TTGGCTAATGAATCCTTTCTAGG + Intronic
976916805 4:90386177-90386199 TTGGCTATTCAGGCTCTTTTTGG - Intronic
977041769 4:92026692-92026714 TTGGCAAGTCCCGCTTTTCTGGG + Intergenic
977141632 4:93380299-93380321 TTGTCTTTTCCAGCTTCTCTTGG - Intronic
977462405 4:97341533-97341555 TTGGCTATGTAGGCTTTTTTTGG - Intronic
977737569 4:100435546-100435568 TTGGATATTCAGGCTCTTTTTGG - Intronic
977763654 4:100771790-100771812 TTGACTATTCAAGGTTTTTGTGG - Intronic
978499594 4:109394502-109394524 TTGCCTGTTCAACCTTTTCTTGG + Intergenic
978940545 4:114430976-114430998 TTGACTATTCAGGTTTTTTTTGG + Intergenic
979357336 4:119720289-119720311 TTGGCTATGCAGGCTATTTTTGG - Intergenic
979586911 4:122431121-122431143 TTGGCTCTTCCACCTTCTCTTGG + Intergenic
979729741 4:124009861-124009883 TTGGCAATGCAAGTTTTTTTTGG + Intergenic
980255735 4:130378649-130378671 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
980573663 4:134657730-134657752 CTGGCTATTCATGCTCTTTTTGG + Intergenic
980989028 4:139722547-139722569 TTGAATATACAAGATTTTCTTGG - Intronic
982246149 4:153353654-153353676 TTGCCTTTTCAAGTTTTTTTTGG + Intronic
982452944 4:155573720-155573742 TTGGCTATACAGGCTCTTTTTGG - Intergenic
982883847 4:160752881-160752903 TTGGCTATTCTGGCTTTTTTGGG + Intergenic
983703411 4:170626780-170626802 TTGGCTATTCAGGGTCTTTTTGG + Intergenic
984548464 4:181133532-181133554 TTGCCCATGCAAGCTTTTCTAGG + Intergenic
985301050 4:188490003-188490025 TTGGCTGTTCAGGCTCTTTTTGG + Intergenic
986378470 5:7159119-7159141 TTGGCAATACAAGCTCTTTTTGG + Intergenic
986381304 5:7188874-7188896 ATGGCTACTCAGGATTTTCTTGG + Intergenic
987289221 5:16492135-16492157 TTTGCTTTTCAAGTTTTTGTAGG + Intronic
987416309 5:17665223-17665245 TTGGCTATCCTAGCTGTTTTTGG + Intergenic
987670103 5:20995647-20995669 TTGGCTATTCAGGCTCTTTATGG - Intergenic
987770173 5:22292370-22292392 TTGTCTATTTTTGCTTTTCTTGG - Intronic
987900783 5:24008946-24008968 TTGGCTATTCAAGATCTATTTGG + Intronic
987939360 5:24512928-24512950 TGGGCTTTTCAAAGTTTTCTAGG + Intronic
987957124 5:24754653-24754675 TTGGCTATACAAGCTCTTTTTGG - Intergenic
988075948 5:26354633-26354655 TTGGCAATTCAGGCTTTTTGTGG + Intergenic
988092285 5:26559557-26559579 TTATCTATTCATGCTTTTCTTGG + Intergenic
988405354 5:30817368-30817390 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
988978933 5:36544512-36544534 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
989624228 5:43414229-43414251 CTGCCTGTTCAGGCTTTTCTTGG - Intergenic
989824952 5:45842054-45842076 TTGGCTACTCAGGCTCTTTTTGG + Intergenic
990088111 5:52003995-52004017 CTGGCTATTCATGTTCTTCTTGG - Intergenic
990712454 5:58600311-58600333 TTGGCTATGCAGGCTCTTTTTGG + Intronic
990771419 5:59250700-59250722 TTGGCTATTCGGGCTCTTTTTGG - Intronic
991047875 5:62241855-62241877 TTGGTTTTTCAATCTTTTCTTGG - Intergenic
993146402 5:84099269-84099291 TTGACTATACAGGCTTTTTTTGG - Intronic
993217330 5:85042886-85042908 TTGGCTATTCAGACTCTTTTTGG + Intergenic
993577517 5:89620784-89620806 TTGGCTATACAGGCTCTTTTTGG + Intergenic
993611376 5:90058753-90058775 TTGGCAATGCAAGCTCTTTTTGG + Intergenic
993743646 5:91569185-91569207 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
993948195 5:94140008-94140030 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
993965183 5:94351609-94351631 TTGGCTATGCAGGCTCTTTTAGG - Intronic
994327901 5:98470158-98470180 TTGACTATTCATGCTCTTTTTGG - Intergenic
994422963 5:99545216-99545238 TTGGCTATTAAGGCTTTTTGGGG + Intergenic
994623283 5:102188566-102188588 TTGGCTATGCAGGGTTTTTTTGG + Intergenic
994624691 5:102203926-102203948 ATGGCTATTCAGGCTCTTTTTGG - Intergenic
995108734 5:108404211-108404233 TTGGCTATGCAGGGTTTTTTTGG - Intergenic
995488335 5:112662229-112662251 TTGGCTATTCCGGCTCTTTTTGG - Intergenic
995653515 5:114398520-114398542 TTGGCTATTCAGGCTTTTTTTGG + Intronic
996789039 5:127272398-127272420 TTGGCTACTCAGGCTCTTTTTGG + Intergenic
996930775 5:128883998-128884020 TTGGCTATGCAGGCTCTTTTTGG + Intronic
996983081 5:129523981-129524003 TTGGCTATACGAGCTATTTTTGG - Intronic
997017778 5:129956935-129956957 TTGGCTATTCGGGCTATTTTTGG + Intronic
997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG + Intergenic
997761233 5:136450006-136450028 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
998662241 5:144252521-144252543 TTGGCTCTTTGAGTTTTTCTAGG - Intronic
998686600 5:144534256-144534278 TTGGCTATACGGGCTTTTTTTGG - Intergenic
998720345 5:144939321-144939343 TTGGCTATTTGTGCTTTTTTGGG - Intergenic
1001176793 5:169476798-169476820 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1001203780 5:169743143-169743165 TTTTCTTTTCAAGCTTTTCAAGG + Intronic
1003216518 6:4118330-4118352 TTGGCTATTAGAGCATTCCTTGG - Intronic
1005197251 6:23301897-23301919 TTGGCTTTTCCAGTTTTCCTGGG - Intergenic
1005394967 6:25372224-25372246 TTGGCTATTCAGGTTCTTTTTGG + Intronic
1005877749 6:30026546-30026568 TTTGCTATGCAGGCTTTTTTTGG - Intergenic
1005895811 6:30176686-30176708 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
1006054383 6:31371736-31371758 TTGGCTATACAAGTTCTTTTTGG - Intergenic
1007016873 6:38477483-38477505 TTTGCTAAACAAGCTTTTTTAGG - Intronic
1007188234 6:39991072-39991094 TTGACTATTCAGGCTCTTTTTGG + Intergenic
1007314453 6:40974716-40974738 TTGGCTATTCAGGCTCATTTTGG + Intergenic
1007561815 6:42815490-42815512 TTGCCTATTTAAGATATTCTGGG - Intronic
1008115887 6:47549729-47549751 TTGGCTATGCAGGCTCTTTTTGG - Intronic
1008285512 6:49644435-49644457 TTGTCTATTCATCCTTTTCTTGG + Intergenic
1008334530 6:50285745-50285767 TTGGGTATTCAGGCATTTTTTGG - Intergenic
1008529359 6:52441572-52441594 TTGACTATTCAGGCTCTTTTTGG + Intronic
1008731764 6:54491445-54491467 TTGGCTCTTACAGCGTTTCTGGG - Intergenic
1008805890 6:55427714-55427736 TTGGCTACTTATGCTTTGCTAGG + Intergenic
1009547286 6:65036000-65036022 TTGGCTATCCAGGCTCTTTTTGG - Intronic
1009704324 6:67226093-67226115 TCTGCTTTTCAAGATTTTCTTGG + Intergenic
1010345468 6:74805040-74805062 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1010549149 6:77200219-77200241 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1010556049 6:77281129-77281151 TTGGCTATTTAGTCTTTTTTTGG - Intergenic
1010629292 6:78178095-78178117 TTGGCTATTCGAGATATTTTTGG - Intergenic
1010674998 6:78732845-78732867 TTGGCTATTTCAGCTTTTTTTGG - Intergenic
1010681374 6:78803064-78803086 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1011678876 6:89763575-89763597 TTGGGTACTTAAGATTTTCTAGG - Intronic
1012560870 6:100579799-100579821 TTGGCTATTCCAGCTCTTTTTGG + Intronic
1012668708 6:102012905-102012927 TTGACTATTCAAGCTCTTTTTGG + Intronic
1012710789 6:102601662-102601684 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1013671021 6:112402853-112402875 TTGGCTATTTGAGCTCTTTTTGG + Intergenic
1013715726 6:112959178-112959200 TTGGCTATACAGTCTTTTTTTGG - Intergenic
1013983462 6:116161699-116161721 TTGGCTATTTAGGCTCTTATGGG + Intronic
1014070795 6:117179507-117179529 TTGGCTATACAGGCTGTTTTTGG - Intergenic
1015184952 6:130405128-130405150 TTGGCTATTGGAGCTCTTTTTGG + Intronic
1015255268 6:131172308-131172330 TTGGCTATTACATCTTTACTAGG + Intronic
1015774169 6:136796648-136796670 TTAGCTATTCAGGCTCTTTTGGG + Intergenic
1015861682 6:137687756-137687778 TTAGCTATTCATGGTATTCTTGG + Intergenic
1017190111 6:151644177-151644199 TTGGCTATGCAGGCTTTTTTTGG + Intergenic
1017296619 6:152803560-152803582 TTGTCTATTCAGGCATTTTTTGG + Intergenic
1018034536 6:159870947-159870969 TTGGCTATTCAAAGTTTTTTGGG + Intergenic
1018375330 6:163205235-163205257 TTGGCTATTCAGTCTCTTTTTGG - Intronic
1020735601 7:11945473-11945495 TTGACTATTCAGGCTCTTTTTGG + Intergenic
1020995806 7:15262632-15262654 TTGGCTATGCAGGCTCTTTTTGG - Intronic
1021345922 7:19528489-19528511 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1022075866 7:26969643-26969665 TTGGCTATTCTGGCTCTTTTTGG + Intronic
1022545309 7:31182043-31182065 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1022630008 7:32076033-32076055 TGGGCTAACCAAGCTTTTCACGG + Intronic
1023740019 7:43271868-43271890 TTGGCTATTCAAGCTCTTTTTGG - Intronic
1023885839 7:44355001-44355023 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1027576350 7:79935635-79935657 TTGGGAATTTATGCTTTTCTAGG - Intergenic
1028026950 7:85855176-85855198 TTGGCTATTCGAGGTCTTTTGGG + Intergenic
1028279520 7:88904424-88904446 TTGGCTATTCAGGCCTTTTTTGG + Intronic
1028337659 7:89677540-89677562 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1028339415 7:89700116-89700138 TTGGCTATTCTGGGTCTTCTTGG - Intergenic
1028346093 7:89784938-89784960 TTGGTTAGTCAAGCTATTTTTGG - Intergenic
1028346900 7:89794088-89794110 TTGACAATTCAAGCTTTTTTGGG + Intergenic
1028877361 7:95838509-95838531 TTGGTTATTCAAGGTCTTTTGGG + Intronic
1028880148 7:95871177-95871199 TTGCCTATACAAGCTGTTGTGGG + Intronic
1029805935 7:102996218-102996240 TTCCATATACAAGCTTTTCTAGG + Intronic
1030450189 7:109699455-109699477 TTGGCTATTCAATACTTTTTTGG - Intergenic
1030508931 7:110458847-110458869 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1030517223 7:110553155-110553177 TTCTCAATTCAAGCTTTTCCAGG + Intergenic
1031077440 7:117226408-117226430 TAGGCTGTTCCAGGTTTTCTTGG + Intronic
1031128225 7:117799756-117799778 TTGTATATTCATGATTTTCTAGG - Intronic
1031427053 7:121617669-121617691 TTGGCTTTTTAGCCTTTTCTTGG + Intergenic
1031568962 7:123334636-123334658 TTGGCTATTTGAGCTCTTTTTGG - Intergenic
1031641216 7:124166541-124166563 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1031725035 7:125228004-125228026 TTGGCTATTCAGGCCTTTCATGG + Intergenic
1031736175 7:125364919-125364941 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1032891100 7:136195890-136195912 TTGGCTATTCAGGCACTTTTTGG + Intergenic
1033794169 7:144827679-144827701 TTGACTGTTCATGCTTTTCTTGG - Intronic
1035005836 7:155659863-155659885 TTGCCTCTTCCAGCTTTTGTTGG + Intronic
1037478568 8:19281783-19281805 TTGGCTATTCAGGCTCTTTTCGG + Intergenic
1037482501 8:19317325-19317347 TTGGCTGTTCAAGCCTTTAAGGG + Intronic
1037703218 8:21294351-21294373 ATGGCTTTTCAATCTTTTGTTGG + Intergenic
1039073599 8:33668593-33668615 TTGGCTATTCGAGTTCTTTTTGG - Intergenic
1039367272 8:36943152-36943174 TTTGCTATTCAAGCTCTTTTTGG - Intergenic
1039710045 8:40046616-40046638 TTGGCTATGCAGGCTTTTTTTGG - Intergenic
1039832493 8:41226320-41226342 TTGGCTATTGAAGCTTGTGATGG - Intergenic
1040750921 8:50706204-50706226 TTGGCTATTTAAGACTTTTTAGG - Intronic
1041309383 8:56499079-56499101 TTCTCTGTTGAAGCTTTTCTGGG + Intergenic
1041470766 8:58206079-58206101 TTGGCTATTCAGGCTCTTTTTGG + Intergenic
1041706450 8:60851327-60851349 TCGGCTACACAAGCTTTTCTGGG - Intronic
1041926916 8:63246891-63246913 TTGGCTATGCAGGCTGTTTTTGG + Intergenic
1042066063 8:64878711-64878733 TTGGTTATTCAGGCTCTTTTTGG - Intergenic
1043214065 8:77563264-77563286 TTGGCTATTCAGGCTACTTTTGG - Intergenic
1044028310 8:87202071-87202093 TTGCGTATTCCAGCTTCTCTTGG - Intronic
1044131346 8:88527688-88527710 TTGGCTATACAGGCTCTTTTTGG - Intergenic
1044793905 8:95876793-95876815 ATGGCTATTCAGGCTCTTTTAGG - Intergenic
1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG + Intergenic
1045635398 8:104181212-104181234 TTGTCTATTGAAGCATATCTTGG + Intronic
1045715439 8:105038188-105038210 TTGGCTATGCAGGCTCTTTTTGG - Intronic
1046005304 8:108473998-108474020 TGGTCTAGTCCAGCTTTTCTAGG - Intronic
1046318736 8:112542736-112542758 TTGACTATTCAAGTTATTTTTGG - Intronic
1046480806 8:114815155-114815177 TTGACTATTCAGGCTGTTTTTGG - Intergenic
1047496036 8:125409569-125409591 TTGCCTTTTCCAGCCTTTCTTGG + Intergenic
1048191386 8:132292910-132292932 TTGTCCATTCAAACTTTTCTTGG - Intronic
1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG + Intergenic
1048679283 8:136821878-136821900 TTGGCTATTCAGAGTTTTTTAGG - Intergenic
1048763248 8:137820102-137820124 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1050045791 9:1543759-1543781 TTAGCTATTCAGGATTTTTTTGG + Intergenic
1050071694 9:1821586-1821608 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1050177925 9:2888488-2888510 TTAGCTATTCAGGCTGTTTTTGG - Intergenic
1050928170 9:11292188-11292210 TTGGCTATTCAGGCTCTTTATGG + Intergenic
1051257764 9:15232593-15232615 TTGAGTTTTCAACCTTTTCTTGG - Intronic
1051309228 9:15751444-15751466 TTGGCTATGCGGGCTCTTCTTGG - Intronic
1051324412 9:15949294-15949316 TTGGCGATTCGGGCTTTTTTTGG + Intronic
1051597010 9:18834158-18834180 TTGGCTATTAGGGCTTTTTTTGG + Intronic
1051611213 9:18963276-18963298 TTGGCTATACAGGCTTTTTTTGG + Intronic
1052597907 9:30585210-30585232 TTGGGTATACAAGCTCTTTTTGG - Intergenic
1052734717 9:32329314-32329336 TTGGCTATTCAGGGTTTTTATGG - Intergenic
1054932329 9:70648510-70648532 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1054998069 9:71415182-71415204 TTGTCTTTTCCAGCTTCTCTTGG - Intronic
1055781259 9:79823948-79823970 TTGACTGCTTAAGCTTTTCTTGG - Intergenic
1055994066 9:82138724-82138746 TTGGCTAGACAAGCTCTTTTTGG + Intergenic
1056493481 9:87131945-87131967 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1057793917 9:98142577-98142599 TTGGCTCATCTGGCTTTTCTTGG - Intronic
1058092763 9:100824460-100824482 TTGTCTATTCTGGCTTTTGTTGG + Intergenic
1058347945 9:103986736-103986758 TTGGCTATTCATACTCTTTTTGG - Intergenic
1058709535 9:107667419-107667441 TAGGCTCTGCAGGCTTTTCTGGG - Intergenic
1058931554 9:109724424-109724446 TTGGTTTTTCAAGTTTTTCTTGG - Intronic
1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG + Intergenic
1059262295 9:112989592-112989614 TTGGCTATTTGGGCTTTTTTTGG + Intergenic
1059398634 9:114054731-114054753 TTGCCTTTTCAGGGTTTTCTGGG + Exonic
1061624767 9:131835266-131835288 ACGGCTTTTCAAGCCTTTCTGGG - Intergenic
1203464944 Un_GL000220v1:77019-77041 TTGACTATTCAGGCCTTTGTTGG - Intergenic
1185781338 X:2849816-2849838 TTGGCTACTCTCGCCTTTCTTGG - Intronic
1186600564 X:11032642-11032664 TTGGCTGTTCAGGCTTTTTGTGG - Intergenic
1187586892 X:20673060-20673082 TTGGCTATTTGAGCCTTTTTGGG + Intergenic
1187818591 X:23260571-23260593 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1188014395 X:25092092-25092114 TTGGCTATTTGAGCTTTTTTTGG + Intergenic
1188341675 X:29009727-29009749 TTGGCTATTCAGGCTCTTTTTGG + Intronic
1188822410 X:34791610-34791632 TTTGCAATTCTAGCTTTGCTTGG + Intergenic
1188982739 X:36741930-36741952 TTGGCTAATCAGGCTATTTTTGG + Intergenic
1189091133 X:38084067-38084089 TTGTCTGTTCAGACTTTTCTTGG - Intronic
1189353444 X:40294349-40294371 TTGGTTATTCCACCTCTTCTAGG + Intergenic
1190902628 X:54693177-54693199 TTGGCTATTCAGGATCTTTTTGG - Intergenic
1191086874 X:56577694-56577716 TTGGCTATTCGGGCTCTTTTTGG + Intergenic
1191163603 X:57363046-57363068 TTGGCTATTCGGGCTTTTCTTGG + Intronic
1191597545 X:62962159-62962181 TTGGCTATACAAGCTCTTTCTGG + Intergenic
1191599522 X:62987484-62987506 TTGGCTATTCAGGCTCTCTTTGG - Intergenic
1191701712 X:64048936-64048958 TTGGCTATACAAGCTCTTTTTGG - Intergenic
1191779577 X:64850859-64850881 TTGGCTAGGCAAGCTTGGCTAGG - Intergenic
1191822000 X:65320568-65320590 TTGGCTATTCAGACTTTTTTTGG - Intergenic
1192011894 X:67282526-67282548 TTGGTTATTCAGGCTCTTTTTGG - Intergenic
1192688764 X:73336646-73336668 TTGGCTATTCAGGATTTTTTTGG - Intergenic
1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG + Intergenic
1192881527 X:75289479-75289501 TTGGCTATTCTGGCTCTTTTGGG - Intronic
1193030288 X:76890832-76890854 TTGGCTATGCAGGCTCTTTTTGG - Intergenic
1193084482 X:77437122-77437144 ATGGCTATGCAAGCTTGTCTGGG + Intergenic
1193189981 X:78559289-78559311 CTGGCTATACAAGCTCTTTTTGG + Intergenic
1193207655 X:78767426-78767448 TTGACTATTCGAGCTCTTTTTGG - Intergenic
1193209746 X:78792545-78792567 TTGGCTATACAAGCCCTTTTTGG - Intergenic
1193217349 X:78879542-78879564 TTGGCTATACTAGCTCTTTTTGG - Intergenic
1193285376 X:79708032-79708054 TTAACTATTCAAGCTCTTTTTGG - Intergenic
1193318056 X:80087617-80087639 TTGGAAAATCAAGCTTTTATTGG - Intergenic
1193385305 X:80863912-80863934 TTGACTATTTGGGCTTTTCTTGG + Intergenic
1193499366 X:82255427-82255449 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1193611293 X:83634589-83634611 TTGGCTCTTCAAGCTCTTTTTGG + Intergenic
1193637086 X:83964648-83964670 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1193670894 X:84384998-84385020 TTGGCTATTTAGGCTTGTTTTGG + Intronic
1193906207 X:87247529-87247551 TTGGCAATTCAAGCTCTCTTTGG + Intergenic
1193923528 X:87458554-87458576 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1193942232 X:87690132-87690154 TTAGCTATTCAGGCTGTTTTTGG + Intergenic
1193964259 X:87965257-87965279 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1194040427 X:88935213-88935235 TTGGCTATTCAGGATCTTTTTGG + Intergenic
1194072617 X:89345986-89346008 TTGGCTATACAGGCTATTTTTGG + Intergenic
1194085413 X:89520999-89521021 TTGGCTATTCTGGCTCTTTTTGG + Intergenic
1194101665 X:89713018-89713040 TTGGCTATTCATGCTCTTTTTGG + Intergenic
1194208868 X:91044495-91044517 TTGGCTATTTGAGCTTTTTTGGG - Intergenic
1194221161 X:91193239-91193261 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1194273564 X:91851911-91851933 TTTGCTTTTCATGTTTTTCTAGG + Intronic
1194337946 X:92672260-92672282 TTGGCTATTCAGGTTCTTTTTGG - Intergenic
1194355827 X:92882579-92882601 TTGGCTGTTCAAGCTCTTTTTGG - Intergenic
1194637875 X:96367615-96367637 TTGGCTATGCAGGCTCTTTTTGG + Intergenic
1194909813 X:99628245-99628267 TTGGCTATTCAGCCTTTCTTTGG - Intergenic
1194910256 X:99632441-99632463 CTGACTATTCAGGCTTTTATTGG + Intergenic
1194914261 X:99685539-99685561 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1195155595 X:102120426-102120448 TTGGCTATTCAGGCCTTTTTTGG - Intergenic
1195500296 X:105589849-105589871 TTAGCTATTTAAGCTCTTTTTGG + Intronic
1195855283 X:109325119-109325141 TTGGATATTCTCTCTTTTCTTGG + Intergenic
1196159143 X:112463174-112463196 TCGGCTATTGAAGCTTGTATAGG - Intergenic
1196361636 X:114867976-114867998 TTGGCTATTCCAGGTCTTTTTGG + Intronic
1196524617 X:116717841-116717863 TTGGTTTTTCAGGCTTTTTTTGG - Intergenic
1196589011 X:117463674-117463696 TTGGCTATGCAAGCTCTTTTTGG + Intergenic
1197073617 X:122329585-122329607 TTGGCTATTCAGTCTCTTCTTGG - Intergenic
1197279232 X:124515869-124515891 TTGGCTATTTAGGCTTTTTTGGG - Intronic
1197308931 X:124880019-124880041 TTGGCTACTCAGGCTTTTTTTGG + Intronic
1197790948 X:130253433-130253455 TTGGCTATCCAGGCCTTTTTTGG - Intronic
1198650015 X:138852236-138852258 TTGGCTATGCAGGCTCTTTTTGG - Intronic
1198743092 X:139862016-139862038 TTGTCTGTTCAGACTTTTCTTGG - Intronic
1198930161 X:141848797-141848819 TTGGCTATTCAGGCTCTTTTTGG - Intronic
1199000373 X:142629300-142629322 TTGGCTATTTGAGCTCTTTTTGG + Intergenic
1199193034 X:144994476-144994498 TTGGATATTCAGGCTCTTTTTGG + Intergenic
1199254871 X:145708024-145708046 TTTGTTGTTCAAACTTTTCTAGG - Intergenic
1199354401 X:146844409-146844431 TTTGCTTTTCAAGTTTTTCTAGG + Intergenic
1199410953 X:147522255-147522277 TTGGCTATTCAGGCTCTTTTCGG - Intergenic
1199857237 X:151769753-151769775 TTGGCTATTTGGGCTTTTTTGGG - Intergenic
1200438056 Y:3176876-3176898 TTGGCTATTCTGGCTCTTTTTGG + Intergenic
1200454612 Y:3374102-3374124 TTGGCTATTCATGCTCTTTTTGG + Intergenic
1200557666 Y:4656992-4657014 TTGGCTATTCAGGCTCTTTTTGG - Intergenic
1200590807 Y:5073335-5073357 TTCGCTTTTCATGTTTTTCTAGG + Intronic
1200646355 Y:5788999-5789021 TTGGCTATTCATGTTCTTTTTGG - Intergenic
1200664174 Y:5999560-5999582 TTGGCTGTTCAAGCTCTTTTTGG - Intergenic
1200726856 Y:6681735-6681757 TTGGCTATACAGGCTATTTTTGG + Intergenic
1200728008 Y:6697511-6697533 TTGGCTATACAGGCTATTTTTGG + Intergenic
1202041642 Y:20691480-20691502 TTGGCAATGCAAGCTCTTTTTGG + Intergenic