ID: 917378115

View in Genome Browser
Species Human (GRCh38)
Location 1:174373077-174373099
Sequence ACATATGAGGTACATTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917378115_917378119 -2 Left 917378115 1:174373077-174373099 CCACCTAAATGTACCTCATATGT 0: 1
1: 0
2: 0
3: 18
4: 142
Right 917378119 1:174373098-174373120 GTTTTTATCTGTTTTATTTAGGG 0: 1
1: 0
2: 5
3: 119
4: 1217
917378115_917378118 -3 Left 917378115 1:174373077-174373099 CCACCTAAATGTACCTCATATGT 0: 1
1: 0
2: 0
3: 18
4: 142
Right 917378118 1:174373097-174373119 TGTTTTTATCTGTTTTATTTAGG 0: 1
1: 0
2: 17
3: 290
4: 3046

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917378115 Original CRISPR ACATATGAGGTACATTTAGG TGG (reversed) Intronic
901342535 1:8508242-8508264 TCACATGAGGTACTTTTATGAGG + Intronic
902460808 1:16575097-16575119 ACATATGAAGAATATCTAGGAGG - Intronic
904953267 1:34261636-34261658 AGATTTGAGATACATTTGGGAGG + Intergenic
905113691 1:35618175-35618197 AAATATGAGATATATTTAGAAGG + Intronic
907590531 1:55663413-55663435 ACATATATGGTACATATACGTGG + Intergenic
911952334 1:104191116-104191138 ACATATGAGGTAAACTCTGGTGG - Intergenic
912857940 1:113188350-113188372 ACATATGAGTTACATGAAGTGGG - Intergenic
913604617 1:120453482-120453504 ACATATGAGGAATATCTAGGAGG + Intergenic
913641488 1:120816195-120816217 ACATATGAGGAATATCTAGGAGG + Intronic
914083925 1:144435721-144435743 ACATATGAGGAATATCTAGGAGG - Intronic
914189947 1:145400999-145401021 ACATATGAGGAATATCTAGGAGG - Intronic
914211798 1:145586701-145586723 ACATATGAAGAATATCTAGGAGG - Intergenic
914276993 1:146134133-146134155 ACATATGAGGAATATCTAGGAGG - Intronic
914365815 1:146977039-146977061 ACATATGAAGAATATCTAGGAGG + Intronic
914486628 1:148116403-148116425 ACATATGAAGAATATCTAGGAGG - Intronic
914538037 1:148585081-148585103 ACATATGAGGAATATCTAGGAGG - Intronic
914586959 1:149071544-149071566 ACATATGAGGAATATCTAGGAGG - Intronic
914627884 1:149480252-149480274 ACATATGAGGAATATCTAGGAGG + Intergenic
917070506 1:171145499-171145521 ACATATGAGGAAGTATTAGGTGG + Intronic
917378115 1:174373077-174373099 ACATATGAGGTACATTTAGGTGG - Intronic
918864440 1:189876339-189876361 ACATATGATGTTCATTTAACTGG - Intergenic
919028322 1:192205905-192205927 ATTTAGGAGGTAGATTTAGGAGG + Intergenic
919170737 1:193950592-193950614 ACAGATGAGGTACATTCAACAGG - Intergenic
1065691523 10:28338842-28338864 CCATATGTTTTACATTTAGGGGG + Intergenic
1066437692 10:35409069-35409091 AGAAATGAAGTACATTAAGGAGG + Intronic
1067131645 10:43570661-43570683 ACATTGGAGGGAAATTTAGGAGG - Intronic
1067379046 10:45755590-45755612 ACATAGGACTTACATTTAAGAGG - Intronic
1067886749 10:50096253-50096275 ACATAGGACTTACATTTAAGAGG - Intronic
1068691099 10:59915314-59915336 ACATATGAGGTATACTTTGCTGG - Intergenic
1071269539 10:83994163-83994185 ACACATGGGGTAGATTTATGGGG - Intergenic
1073676890 10:105658013-105658035 AAATATGAAGTACATTAAGTTGG - Intergenic
1082782338 11:57297630-57297652 ACATAGGTGGTAAATTTTGGTGG + Intergenic
1085481794 11:76829243-76829265 AAAAATGAAATACATTTAGGGGG - Intergenic
1085939326 11:81189720-81189742 AGTTATGAGGCACATTCAGGAGG + Intergenic
1086325015 11:85689872-85689894 ATATATGGGATACTTTTAGGAGG - Intergenic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1097415615 12:59312787-59312809 ACATAAAAGTTAAATTTAGGTGG + Intergenic
1099833068 12:87870311-87870333 AGATCAGAAGTACATTTAGGAGG + Intergenic
1100666580 12:96760179-96760201 ACAGATGAAGTACATTTTGAAGG + Intronic
1106167647 13:27262968-27262990 ACAAATGTGGAACATCTAGGAGG - Intergenic
1106532442 13:30605892-30605914 ACATCCGAGGTATATTTAGAGGG - Intronic
1106633932 13:31507097-31507119 ACATATGACCTTCATTTGGGTGG + Intergenic
1108536850 13:51391504-51391526 ACACATGAGGAACATTACGGAGG - Intronic
1110167244 13:72458149-72458171 AAATATAAGTTACATTAAGGAGG + Intergenic
1112451258 13:99512444-99512466 ACAAATAAGGTACATTTAATGGG + Intronic
1112537731 13:100276567-100276589 ACATAAGAGATATATTAAGGAGG - Intronic
1125419040 15:39485738-39485760 ACATATGAGGTAGATTGGGTAGG + Intergenic
1126536857 15:49775739-49775761 ACATATGGAGTACATTTTAGTGG - Intergenic
1126644408 15:50860615-50860637 CCACATGAGCTACATTTAGCGGG - Intergenic
1127596119 15:60483878-60483900 ACATTTGATGAACATTTAGATGG + Intergenic
1130895739 15:88169241-88169263 ACATCAGAGGCACATTTAAGAGG + Intronic
1131860146 15:96645007-96645029 ACATGTGAGGACCATTTTGGAGG + Intergenic
1133396104 16:5448808-5448830 GCATCTGGGATACATTTAGGAGG + Intergenic
1137523619 16:49214453-49214475 AAATATGAAGAACATTTATGAGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141696331 16:85621487-85621509 TTATAAGATGTACATTTAGGTGG - Intronic
1144614563 17:16757283-16757305 CCCTATGAGGAACATTTAGGTGG + Intronic
1144898143 17:18558391-18558413 CCCTGTGAGGAACATTTAGGTGG - Intergenic
1145134228 17:20387323-20387345 CCCTATGAGGAACATTTAGGTGG + Intergenic
1156803791 18:41151476-41151498 ACATATAAGGTACAATTTGAGGG - Intergenic
1158341584 18:56472406-56472428 ACATATGTGGGACACTTAGAAGG - Intergenic
1202677238 1_KI270711v1_random:18837-18859 ACATATGAAGAATATCTAGGAGG - Intergenic
926761036 2:16279352-16279374 ACATATGGGGAACATTTGTGAGG - Intergenic
928050291 2:27986484-27986506 CCATATGAGTGACATTTTGGAGG + Intronic
928251712 2:29686686-29686708 ACCCATGAGGTTCAGTTAGGAGG + Intronic
928346338 2:30500598-30500620 ACATAGCAGATAGATTTAGGGGG + Intronic
928935429 2:36671568-36671590 AAATACATGGTACATTTAGGTGG - Intergenic
931972591 2:67605522-67605544 ATATATGAGATACATATAGGAGG - Intergenic
934014980 2:87870932-87870954 ATATTTGAGATACATTTTGGAGG - Intergenic
938738183 2:134205393-134205415 AGATTTGGGGTACATTTTGGAGG + Intronic
939129477 2:138217169-138217191 AGATTTGAGAGACATTTAGGGGG + Intergenic
939480247 2:142739377-142739399 ACATTTGAGGTTCATATATGTGG - Intergenic
939785649 2:146508185-146508207 ACATATGAGGTGCATTATGAGGG - Intergenic
941548221 2:166880732-166880754 AAATATGAGGTACATAGAGAAGG + Intergenic
943478603 2:188389560-188389582 ATATATAAGGTACCTCTAGGAGG - Intronic
943693155 2:190890386-190890408 CCCTATGAGGTAAATTAAGGTGG - Intronic
946050808 2:216860788-216860810 GCATATGCCATACATTTAGGTGG + Intergenic
946122154 2:217525473-217525495 AGAAATGATGTAAATTTAGGGGG + Intronic
1174012482 20:47461677-47461699 ACATAGTAGGTACATATATGAGG + Intergenic
1177607773 21:23404179-23404201 TAATAAGAAGTACATTTAGGGGG - Intergenic
1179128579 21:38614170-38614192 ACATATAAGTTATATGTAGGAGG - Intronic
950927142 3:16752813-16752835 ACATAATAGGTATATTTATGGGG + Intergenic
952312856 3:32205935-32205957 ACATATGAGGCATACTGAGGAGG - Intergenic
952538557 3:34340582-34340604 ACATATGGAGTACATATAGTTGG + Intergenic
952662918 3:35873214-35873236 AAATATGTGGTACATTTTGAGGG + Intergenic
954543906 3:51416459-51416481 AAATATACGGTAAATTTAGGTGG - Intronic
954674601 3:52308870-52308892 AGATTTGAGGGATATTTAGGAGG + Intergenic
956513654 3:70022231-70022253 TCAAATTAGGTACATTTGGGGGG - Intergenic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
958874137 3:99596398-99596420 AAAAATGAGGTTCATTTGGGAGG - Intergenic
959014432 3:101117327-101117349 AAATATTACATACATTTAGGGGG + Intergenic
959112765 3:102141833-102141855 AGAAATGAGCTGCATTTAGGAGG + Intronic
963538760 3:146561143-146561165 ACATAGTAGGTATATTTATGGGG - Intergenic
964041225 3:152264107-152264129 ACATATGAGGTAATTTCAGATGG - Intronic
965076108 3:163978540-163978562 ACATAAGAAGTACATATAGAGGG - Intergenic
965740789 3:171872267-171872289 ACATATAAGGCAAATTTAGGAGG - Intronic
966712410 3:182983157-182983179 AAATATGAGGTGCATTTGGGTGG - Intronic
972254915 4:37342942-37342964 ACATATGACGGATATATAGGAGG - Intronic
973080768 4:45990174-45990196 ACACATGAGTTACATTAAGCAGG + Intergenic
974334956 4:60530567-60530589 TCATAGGAGGTCTATTTAGGTGG + Intergenic
977472924 4:97464661-97464683 AAATATGAGGAACATTTGGGAGG - Intronic
978351207 4:107822686-107822708 ACATAGTAGGTATATTTATGGGG + Intergenic
979614630 4:122728606-122728628 ACATATGAAGCACATTTAATAGG + Intergenic
981775963 4:148368088-148368110 GCATCTGAGAGACATTTAGGAGG - Intronic
982315931 4:154031877-154031899 ACATATGAGGGTCTTTTTGGTGG + Intergenic
986181816 5:5400091-5400113 ACAAAGGAGGGACATTTATGAGG + Intergenic
986796756 5:11220109-11220131 ACAGAAGAGGGACATATAGGAGG + Intronic
986974228 5:13377209-13377231 ACATATGAAATGCATTTTGGAGG - Intergenic
987326927 5:16821261-16821283 ACATAGGATGTACACATAGGAGG - Intronic
988306932 5:29504918-29504940 AAAAATGAGGAACATTTAGTAGG + Intergenic
990114095 5:52367600-52367622 ATATATGAGGGAGATTTAGTTGG - Intergenic
990779269 5:59340412-59340434 ACATAGTAGGTATATTTATGGGG + Intronic
992126624 5:73649223-73649245 CCACATGAGTGACATTTAGGAGG - Intronic
993166337 5:84358960-84358982 ACAACTGTGGTACATTTGGGGGG + Intronic
994165908 5:96607857-96607879 ACATATGGGGTACATTGTGATGG + Intronic
1003951863 6:11123886-11123908 ACATAGTAGGTACATATATGGGG + Intronic
1005367559 6:25094542-25094564 AGATTTGAGATACATTTAGAAGG - Intergenic
1005669365 6:28089651-28089673 CCAAAAGAGCTACATTTAGGGGG + Intergenic
1009034191 6:58096852-58096874 AGATATTAGGTATACTTAGGAGG - Intergenic
1009209799 6:60848552-60848574 AAATATTAGGTATACTTAGGAGG - Intergenic
1009760372 6:67997283-67997305 AAATATGAGGTACAGGCAGGTGG + Intergenic
1012926252 6:105270985-105271007 ACATTTGAGGGAAATTTAGAAGG + Intergenic
1013323105 6:109014801-109014823 TCATGTGAGGAACATGTAGGAGG - Intronic
1015376438 6:132515392-132515414 ACATATGAACAACACTTAGGAGG - Intergenic
1015895419 6:138012141-138012163 AAATATGAGTGACATTTAGAAGG + Intergenic
1020150884 7:5680887-5680909 AGATGTGAGGTGCATTTTGGAGG - Intronic
1023335776 7:39168304-39168326 CCATATGAGGTACATGGAGCAGG + Intronic
1027501494 7:78957316-78957338 ACTTATAAGGAGCATTTAGGAGG - Intronic
1028568724 7:92262176-92262198 ATATAACAGTTACATTTAGGAGG - Intronic
1031493435 7:122417876-122417898 ACAGATGAGGTGCATTTTGGAGG + Intronic
1033759634 7:144424663-144424685 ATATGTGGGGTACATGTAGGTGG - Intergenic
1036603898 8:10289334-10289356 ACATAGTAGGTACATTTATGGGG + Intronic
1039249532 8:35646956-35646978 ACAAATGTGTTACCTTTAGGTGG - Intronic
1039409789 8:37343081-37343103 AAATAAAAGGTACATTAAGGCGG - Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1041627197 8:60043905-60043927 ACATAAAAGGTACATTAAAGAGG - Intergenic
1041768298 8:61443867-61443889 ACATATGTCTTCCATTTAGGTGG + Intronic
1044161783 8:88927250-88927272 AAATATAAAGTACATTTATGGGG + Intergenic
1046635011 8:116664954-116664976 ACATATGTGGAACACTTAGCAGG - Intronic
1046802708 8:118446995-118447017 ACAAATGAGGCATTTTTAGGGGG - Intronic
1048252128 8:132875497-132875519 AGAGATGAGTTACATTTATGTGG - Intronic
1054712065 9:68521633-68521655 ACATGTGAGGGACATTTGGGAGG + Intronic
1059626420 9:116071946-116071968 ACATAAGAGCTACCTTAAGGAGG - Intergenic
1061978805 9:134087967-134087989 ACATTGGAGGGATATTTAGGAGG - Intergenic
1188002911 X:24998865-24998887 ACATATAAGGTGCATAGAGGGGG + Intergenic
1188259922 X:28010473-28010495 ACAGATAACATACATTTAGGTGG + Intergenic
1189422189 X:40866149-40866171 AAATATGAGAGACATTTAGGAGG - Intergenic
1189948095 X:46200987-46201009 ACATAAAAAGGACATTTAGGAGG + Intergenic
1192346610 X:70314122-70314144 ACATTTGAGGTAGATTTCGAGGG + Intronic
1193903649 X:87216311-87216333 TCATATGAGGTAGTTTTGGGTGG + Intergenic
1196272111 X:113724342-113724364 ACATAAGATGTACAATTTGGGGG - Intergenic
1196405543 X:115358691-115358713 AGATCTGAGGTACAGTTATGGGG + Intergenic
1196666544 X:118323155-118323177 ATATTTGAGGTATATTTTGGAGG - Intergenic
1197673331 X:129302844-129302866 ACATTTGAGAGATATTTAGGGGG - Intergenic
1197854418 X:130899958-130899980 AGATTTGAGAAACATTTAGGAGG - Intronic
1198389661 X:136161546-136161568 ACACATAAGGAAAATTTAGGGGG - Intronic
1198776070 X:140180099-140180121 TCATATCAGGATCATTTAGGAGG - Intergenic
1199129499 X:144167579-144167601 ATATTTGAGATACATTTTGGAGG + Intergenic
1199234785 X:145478949-145478971 GCATATGAGGTACATCTCAGAGG - Intergenic
1199303414 X:146239191-146239213 ACATATGAGGTTTTTTTTGGAGG + Intergenic
1199776740 X:151018581-151018603 ACATATTAAGTATATTTAAGTGG + Intergenic