ID: 917380423

View in Genome Browser
Species Human (GRCh38)
Location 1:174400277-174400299
Sequence CTGCTGACATAGTATTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917380423_917380429 2 Left 917380423 1:174400277-174400299 CCATTATAATACTATGTCAGCAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 917380429 1:174400302-174400324 ATTGCTTGCTTCAGAGGAGGGGG 0: 1
1: 0
2: 2
3: 34
4: 270
917380423_917380427 0 Left 917380423 1:174400277-174400299 CCATTATAATACTATGTCAGCAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 917380427 1:174400300-174400322 CCATTGCTTGCTTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 163
917380423_917380425 -1 Left 917380423 1:174400277-174400299 CCATTATAATACTATGTCAGCAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 917380425 1:174400299-174400321 GCCATTGCTTGCTTCAGAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 180
917380423_917380424 -4 Left 917380423 1:174400277-174400299 CCATTATAATACTATGTCAGCAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 917380424 1:174400296-174400318 GCAGCCATTGCTTGCTTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 109
917380423_917380428 1 Left 917380423 1:174400277-174400299 CCATTATAATACTATGTCAGCAG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 917380428 1:174400301-174400323 CATTGCTTGCTTCAGAGGAGGGG 0: 1
1: 0
2: 1
3: 24
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917380423 Original CRISPR CTGCTGACATAGTATTATAA TGG (reversed) Intronic
909057733 1:70842827-70842849 CTCCTGAGATAGTTCTATAATGG - Intergenic
915139920 1:153761088-153761110 CTCCTGCCATCGTATTACAAAGG + Intronic
915789735 1:158655188-158655210 CTCCTGACATAGTAACTTAAAGG - Intronic
917380423 1:174400277-174400299 CTGCTGACATAGTATTATAATGG - Intronic
917784066 1:178433376-178433398 CTTGTCACATTGTATTATAATGG + Intronic
921147410 1:212371379-212371401 CTGATGCCACAGTAATATAAAGG + Intronic
923175047 1:231455455-231455477 CTGTTAACATAGAAATATAAAGG + Intergenic
924657762 1:245988918-245988940 CTTCAGACATAGTTTGATAAAGG - Intronic
1069806448 10:71128116-71128138 TTACTGTCATAGTTTTATAAAGG - Intergenic
1072290194 10:93958046-93958068 CTGATGACATATTATAATCAAGG + Intergenic
1078705087 11:13735734-13735756 ATGCCAACATAGCATTATAATGG - Intergenic
1079511168 11:21212125-21212147 CTTCTGACATAGTTTGATAGTGG + Intronic
1080003972 11:27385169-27385191 CTTCTGACAGATTATTATCAAGG - Intronic
1080478780 11:32623930-32623952 CAGCTGACAAAGTATTAAGAAGG + Intronic
1081158122 11:39720052-39720074 ATTCTGCCATAGTGTTATAAAGG + Intergenic
1081721555 11:45293076-45293098 CTAATGACATAGAAGTATAAAGG + Intergenic
1085937186 11:81161666-81161688 ATTATGACTTAGTATTATAAAGG + Intergenic
1086472730 11:87132911-87132933 GTGCTGGCATATTGTTATAACGG - Intronic
1087090178 11:94262398-94262420 CTGCTGCCAGAGCACTATAAGGG - Intergenic
1090866161 11:130702608-130702630 CTTCTGAAATGGTATTAAAATGG - Intronic
1093373519 12:18393854-18393876 CTGCTGAGATATTTTTAAAAAGG + Intronic
1093560813 12:20537415-20537437 CTGATGACAGATTATTCTAAAGG + Intronic
1095797420 12:46235375-46235397 ATGCTAACATTGTATTAAAAAGG + Intronic
1100063391 12:90609504-90609526 CTTCTGACATGGTATTCTCAGGG - Intergenic
1104162939 12:126198169-126198191 CTGCTCTCAAAGGATTATAAAGG - Intergenic
1105493376 13:20908494-20908516 CTGCTGACATACTGGTACAAAGG + Intergenic
1107354162 13:39548089-39548111 ATGTTCACAAAGTATTATAAAGG + Intronic
1108312830 13:49212595-49212617 CTGCAGAAATAATCTTATAATGG - Intergenic
1110994933 13:82095652-82095674 CTGCTCCCATAAGATTATAATGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1112848534 13:103674149-103674171 TTGATGTCAAAGTATTATAAAGG + Intergenic
1114382157 14:22218492-22218514 GTGCTCCCATAATATTATAATGG - Intergenic
1114722314 14:24895675-24895697 GTTCTGACTTACTATTATAATGG - Intronic
1115272828 14:31573207-31573229 GTGGTGACATAAGATTATAATGG - Intronic
1119283911 14:73435204-73435226 CTGCTGATGAAGTATTAAAACGG + Intronic
1123688757 15:22819828-22819850 GTGCTGACATAGTAATATAGTGG + Intronic
1124816189 15:32995842-32995864 CTGTTGCCATAGTTTTATGAAGG - Intronic
1125161362 15:36648134-36648156 CGGCTGTGATAGTATTAAAAAGG + Intronic
1130359075 15:83164268-83164290 CTGCTTATAAATTATTATAATGG - Intronic
1131288879 15:91087342-91087364 ATGCTGACTTTGTATTTTAATGG - Intergenic
1131303669 15:91222128-91222150 CTGCTGAAATAGTATCCTAGAGG - Intronic
1134829584 16:17312325-17312347 CTGCTGGCATAGTACTGTGAAGG + Intronic
1139062207 16:63265745-63265767 CAGGTGACACAATATTATAAAGG + Intergenic
1140986463 16:80162390-80162412 CTGCTGAGACAGAATTAAAAAGG - Intergenic
1141460840 16:84178000-84178022 CTGATGACATAGTAAGAGAAAGG - Exonic
1144612054 17:16728769-16728791 ATGCAGACACAGTAGTATAATGG - Intronic
1144900681 17:18586615-18586637 ATGCAGACAGAGTAGTATAATGG + Intergenic
1144998087 17:19284603-19284625 ATGCTGACATAGTGTTACTAGGG - Intronic
1145071600 17:19814272-19814294 ATGCTGCCCTAGTGTTATAATGG - Intronic
1145131772 17:20359124-20359146 ATGCAGACAGAGTAGTATAATGG - Intergenic
1148088696 17:45009733-45009755 CTGCAGACATGGTCTTATGAGGG - Intergenic
1154203253 18:12314838-12314860 CAGCTGACATTGTCTCATAAAGG + Intronic
1156105258 18:33651622-33651644 CTGCTACCATAGTGTTATATTGG + Intronic
926667272 2:15539815-15539837 ATGCTAACATTGTATTAGAAAGG + Intronic
927022914 2:19035889-19035911 CTGCTGACATTCTATGACAAGGG - Intergenic
931704121 2:64932822-64932844 CTGTTGAAATAGTATTTTAGTGG + Intergenic
937920744 2:127128329-127128351 CTGCAGACTTATTATTATATGGG - Intergenic
938913830 2:135913857-135913879 CTGCTGAAACAGCATTTTAAAGG + Intronic
940649031 2:156422427-156422449 CTGCCTGCATAGTATTTTAATGG - Intergenic
941240761 2:163034659-163034681 CTGCTTAGATATTATTATCAAGG + Intergenic
943135831 2:183911669-183911691 CTGCAAAAATACTATTATAAAGG + Intergenic
943480965 2:188417038-188417060 CTACTGTCCTAGTTTTATAATGG - Intronic
944247439 2:197545971-197545993 CTGCTGAAATGGTATTATTTTGG + Intronic
944443188 2:199763378-199763400 CATCTGATATAGTATTACAAGGG + Intronic
944882101 2:204023753-204023775 CAGGTGACATAGTTTTAAAATGG + Intergenic
945397893 2:209343432-209343454 CTGCTGCCATAGCATTATCTTGG - Intergenic
1169438295 20:5612454-5612476 CTGCTGATATAATTTTATATTGG - Intergenic
1172318014 20:33971455-33971477 CTGCTGACAGAGTAATAATAAGG - Intergenic
1177668551 21:24194376-24194398 TTGCTGGCATAGTCTGATAAAGG + Intergenic
1177680677 21:24365587-24365609 CTGCTAATATAATGTTATAATGG - Intergenic
1177747291 21:25233627-25233649 CTGCTGATATGGTATATTAAAGG + Intergenic
1178000402 21:28155937-28155959 CTGATGACAATGTTTTATAAGGG + Intergenic
1178937771 21:36878986-36879008 CTGGTGAGATAGTATCATCATGG - Intronic
1184830075 22:46979813-46979835 CTGCTGTCATAGTAACATGAAGG - Intronic
949650579 3:6154429-6154451 CTGCAGAGACAGCATTATAAAGG + Intergenic
950971263 3:17190662-17190684 ATGCTGACAGATTATTATACAGG + Intronic
951768933 3:26232891-26232913 CTCCTGTCATGGTAGTATAAAGG - Intergenic
953208904 3:40857237-40857259 CTCCTGACATAGTATGACCAGGG - Intergenic
957322274 3:78647232-78647254 CTGGGGACAGAGAATTATAAGGG + Intronic
961598421 3:128038871-128038893 CTGTTTGCATGGTATTATAATGG - Intergenic
964879591 3:161408837-161408859 CTGCAGACATAGCATTACACTGG + Intergenic
965644407 3:170864957-170864979 CTGCTGTGTTAGTATTATGACGG - Exonic
967826039 3:193878313-193878335 CTTCTAACAGAGTATTATAAAGG - Intergenic
968687791 4:1973140-1973162 CGGCCGACATATTGTTATAAAGG + Intronic
970918151 4:21359925-21359947 CCACTAACATGGTATTATAAAGG + Intronic
971651460 4:29280968-29280990 CTGATCACATGATATTATAATGG + Intergenic
972135585 4:35889047-35889069 TTTCTTACATAGAATTATAATGG - Intergenic
976663205 4:87561942-87561964 CTGCTGTCATAGAAGTTTAAGGG - Intergenic
977792363 4:101122739-101122761 ATGGTGACATTATATTATAAGGG + Intronic
979863759 4:125726891-125726913 CTGCTGGCATAGTTGTAGAAAGG + Intergenic
984070148 4:175100970-175100992 GTGTTGACATAATATTATAAGGG - Intergenic
984234537 4:177140261-177140283 ATGATGCCATAATATTATAATGG - Intergenic
986371029 5:7080169-7080191 CTGCCAATATAATATTATAATGG - Intergenic
993596082 5:89857647-89857669 CTGATGAAATAATATTAGAATGG - Intergenic
1003801708 6:9677376-9677398 TAGCTAACATAGTATTTTAAGGG + Intronic
1004535419 6:16496008-16496030 CTGTTGACGTAATATTATTATGG - Intronic
1010828822 6:80506043-80506065 CTGCTACAATAGTCTTATAATGG - Intergenic
1012169433 6:96000665-96000687 CAGCTGACACAGTATTAAGAGGG + Intergenic
1014581418 6:123142078-123142100 CAGCTACAATAGTATTATAAAGG - Intergenic
1014946110 6:127499969-127499991 CTGAGGAAATAGTATTATAGAGG - Intronic
1016873492 6:148841766-148841788 CTGCTATTATAGTATTTTAAGGG - Intronic
1026147984 7:67764397-67764419 CTGCTGCCATCGTATTTTTAGGG + Intergenic
1031822741 7:126525064-126525086 CTGTTGATGTAGAATTATAATGG + Intronic
1032457868 7:132087339-132087361 ATGTTGACATCATATTATAAAGG + Intergenic
1033988354 7:147253857-147253879 GTGCTGACATAGTATCTTATTGG + Intronic
1037112837 8:15185900-15185922 CTGCTTAAATAGTATTATTTTGG - Intronic
1039218705 8:35303061-35303083 ATGTTGACATAATATTATATTGG - Intronic
1039500587 8:38013631-38013653 CTTCTTAGATAGTATTATCAAGG + Intergenic
1040462301 8:47660618-47660640 CTGTAGACATGGTATTCTAATGG + Intronic
1041949171 8:63480819-63480841 CTGATGCCATAGAATTACAAAGG - Intergenic
1045707023 8:104936115-104936137 CTGCTGAAATGTCATTATAAAGG - Intronic
1046635566 8:116671648-116671670 CAGCTGACATAGTAGTGTAGAGG + Intronic
1047778685 8:128094048-128094070 CTGCTGACATGGCATTAAGAGGG - Intergenic
1051050380 9:12925424-12925446 TTGATGATATAGTACTATAAGGG + Intergenic
1051244922 9:15100422-15100444 CTGCTGAGACATTATTTTAAAGG + Intergenic
1060611995 9:124975307-124975329 CTGCTGACATAGTTTGACACAGG - Intronic
1186815770 X:13236473-13236495 CTGCTGACAAATTCTCATAAAGG - Intergenic
1188606048 X:32031216-32031238 CTTCTGTCATGGTATTACAAAGG + Intronic
1189859192 X:45254773-45254795 TTGCTGAAATAGTATTTTCATGG - Intergenic
1190467610 X:50741950-50741972 ATGCTAATATAGTTTTATAATGG + Intronic
1192332910 X:70192868-70192890 CTGATGACACAGAAATATAAAGG + Intronic
1194704860 X:97162968-97162990 CTGCTGACTTTGTATCATAGTGG + Intronic
1196767858 X:119265225-119265247 TTGCTGTCATAGTATTAGAAAGG + Intergenic
1201075685 Y:10185485-10185507 CTGCTGGCATAGTTTCACAATGG + Intergenic