ID: 917380537

View in Genome Browser
Species Human (GRCh38)
Location 1:174401412-174401434
Sequence CTCACCCGTGATGGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917380533_917380537 -5 Left 917380533 1:174401394-174401416 CCTAATACATGATAAGCACTCAC 0: 1
1: 0
2: 3
3: 47
4: 340
Right 917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917380537 Original CRISPR CTCACCCGTGATGGGGAATG AGG Intronic
901443956 1:9295620-9295642 TTCACCAGAGCTGGGGAATGGGG + Intronic
901935317 1:12622509-12622531 CTCACCTGTGGCGGGGCATGGGG - Intergenic
903033191 1:20477697-20477719 CTCCCCCAGGATGGGGGATGAGG - Intergenic
903193747 1:21670148-21670170 CTCCCCCTTGGTGGGGAGTGGGG - Intergenic
904620677 1:31773245-31773267 GTCAACTGTGCTGGGGAATGTGG - Intergenic
906826596 1:48988086-48988108 TTCCCCTGGGATGGGGAATGAGG - Intronic
907329816 1:53663578-53663600 CACAGCCGTGAAGGGCAATGAGG - Intronic
907335781 1:53698550-53698572 CTCACCCCTGATGGGGAAATGGG - Intronic
910958636 1:92736443-92736465 CTCAACTGTGATGGGGAAGATGG + Exonic
912397266 1:109355666-109355688 CTCACCAGTGATGGGGGTTCAGG + Intronic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
921681985 1:218044580-218044602 CTCACCCTGGATGGCGAAGGAGG - Intergenic
922135791 1:222825131-222825153 CTCCCCAGGGATGGGGAATGTGG + Intergenic
924579216 1:245309059-245309081 CTCACCCTTGATGGACAATCAGG + Intronic
1063344434 10:5297973-5297995 GTCACCAATGATGGGCAATGGGG + Intergenic
1063758251 10:9040988-9041010 CTCAGCAGTGATAGAGAATGAGG + Intergenic
1069991998 10:72321753-72321775 CCCACCTGTGATAGGGAAAGGGG - Intergenic
1074700543 10:116088283-116088305 CTGACCCTTGATGGGGGCTGGGG + Intronic
1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG + Intergenic
1077087913 11:763816-763838 CTCGCCCGTGTTGCGGAAGGAGG - Exonic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1078581536 11:12542945-12542967 CTCAGGTGTGTTGGGGAATGGGG - Intergenic
1078949876 11:16118183-16118205 TTCACCCGTGATGGGGTTTCCGG - Intronic
1084527684 11:69706772-69706794 CTCACCCATGCAGGGGTATGGGG + Intergenic
1089698642 11:120230953-120230975 CTCAGCCTTGCTGGGGGATGGGG + Intergenic
1091152050 11:133338045-133338067 CTCATCCGTTATGGGGGAAGGGG + Intronic
1096215711 12:49796568-49796590 TTCACCTGAGATGAGGAATGGGG + Exonic
1098222039 12:68280487-68280509 CTCACCCAAGACGGGGAATCTGG + Intronic
1098619602 12:72578416-72578438 CTCAACAGTCAAGGGGAATGAGG - Intronic
1103120709 12:118377027-118377049 CTCGACCGTGATGGGGAGAGGGG + Intronic
1103201907 12:119094684-119094706 CTAACCCCTCCTGGGGAATGTGG - Intronic
1103740044 12:123084935-123084957 CTGACCCTTGATGGGGGAGGGGG - Intronic
1104155388 12:126126348-126126370 CTGACACCTGATGGGGAAAGGGG - Intergenic
1104981888 12:132576914-132576936 CTCACCTGTGCTGGGGAAGAGGG - Exonic
1112370468 13:98788767-98788789 CTCACTGGGGAGGGGGAATGGGG - Intergenic
1117002400 14:51384070-51384092 CCCCCCCATGATGGGGACTGAGG - Intergenic
1119115415 14:72016310-72016332 GTCACACGTGTTTGGGAATGTGG - Intronic
1120367622 14:83591021-83591043 CTGACCCGCCATGGGGAAGGGGG - Intergenic
1124075129 15:26436999-26437021 CTCAACTGTGATGAGGACTGTGG + Intergenic
1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG + Intronic
1124645875 15:31437220-31437242 CTCACAGGTGACTGGGAATGTGG + Intergenic
1127853873 15:62938919-62938941 CTGGCCAGTTATGGGGAATGTGG - Intergenic
1128528100 15:68426061-68426083 CTGACCAGTGATGGGGCAGGGGG + Intronic
1128978371 15:72169227-72169249 CTCACCCGCACTGGGGAAGGTGG - Intronic
1136913393 16:34161623-34161645 CTCATTCGTGATGGGGATGGGGG + Intergenic
1142676109 17:1514384-1514406 CACACTCATGATGGGAAATGTGG + Intronic
1145108051 17:20136597-20136619 CCCACCAGTGGTGGGGAATGTGG + Intronic
1146006826 17:29165894-29165916 CTAAGCAGGGATGGGGAATGTGG - Intronic
1149550370 17:57535148-57535170 CTCAGCCCTGATGGAGAAAGTGG + Intronic
1151435128 17:74090581-74090603 CACACCTGTGTTGGGGAGTGTGG + Intergenic
1156457971 18:37305339-37305361 CTCCACCGTGTTGTGGAATGTGG - Intronic
1157602324 18:48901885-48901907 CTCTCCCTTGATGGAGAAGGAGG + Intergenic
1166321588 19:42022313-42022335 CTCAGCTGTGATGGTGAAGGCGG + Exonic
1167215861 19:48164280-48164302 TTCTCCCGTGATGAGGAATCTGG - Intronic
1168184606 19:54691517-54691539 TTCACCCGTGTTGTAGAATGTGG - Intronic
926728290 2:16015269-16015291 CTCACCTGGGAAGGGGGATGGGG - Intergenic
929231933 2:39568956-39568978 CTCATCTGAGATGGGGAATGAGG - Intergenic
932971602 2:76550032-76550054 CTTGCCCATGATGGGAAATGTGG - Intergenic
937295484 2:120807551-120807573 TTCACCCGTGATGTGCAAGGAGG + Intronic
944055577 2:195518871-195518893 CTCACGCTTGATTGTGAATGAGG - Intergenic
945148691 2:206765245-206765267 CTCACCCGCGATGACGAATTTGG + Exonic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG + Intronic
948943819 2:241209541-241209563 CTCACCCGTGATGGGGTTCGGGG - Exonic
1171846930 20:30283081-30283103 CCCACCCATGAGGGGAAATGTGG - Intergenic
1173194699 20:40904781-40904803 CTCAGCCATGATGGTGACTGTGG - Intergenic
1174374450 20:50116436-50116458 CTCTCCCGTGATGAGGGAGGTGG + Intronic
1175553701 20:59832977-59832999 CTCACCAGTGGAGGGGATTGAGG - Intronic
1178352457 21:31882066-31882088 CTCACGAGTGATGGGGGAGGGGG - Intronic
1183678764 22:39314626-39314648 GGCCCCCGTGATGGGGAGTGGGG - Intronic
1184776029 22:46623346-46623368 CTAACCCGGGCTGCGGAATGCGG - Intronic
953889996 3:46744385-46744407 CTCATGCGTGATGGGGTAGGGGG + Intronic
954370860 3:50169006-50169028 CCCAGCAGTGATGGGGACTGGGG - Intronic
955025544 3:55164011-55164033 CTCAGCCATGATGATGAATGAGG - Intergenic
955687087 3:61559794-61559816 CTCCCCCAGGGTGGGGAATGAGG - Intergenic
967781141 3:193440898-193440920 CTCAGCTGTCACGGGGAATGTGG + Intronic
968890474 4:3366122-3366144 CCCACCCGAGAAGGGCAATGGGG + Intronic
969622981 4:8288099-8288121 CTCTCCCTTGATGGGGCAAGAGG - Intronic
969624151 4:8293868-8293890 CTCTCCAGGGATGGGGAAGGGGG + Intronic
970603537 4:17658930-17658952 CTGTCCTGTGATGGGGGATGTGG - Intronic
977477464 4:97530785-97530807 CTCACCGCTGCTGGGAAATGGGG - Intronic
982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG + Intergenic
993908940 5:93656940-93656962 CTAACCCCTGGTGGGGAGTGAGG - Intronic
997383031 5:133450939-133450961 TTCACCCTGGAGGGGGAATGGGG + Intronic
999719752 5:154390903-154390925 CTCATCCGGGAGGGGGAAGGAGG + Intronic
1001714373 5:173802906-173802928 CTCTGCCCTGTTGGGGAATGGGG + Intergenic
1004311527 6:14550150-14550172 CTCAGCCCTGATGGGGAGTGGGG + Intergenic
1016153856 6:140780103-140780125 CTGACAGGGGATGGGGAATGGGG - Intergenic
1016439468 6:144068291-144068313 CTCTCCTGGGTTGGGGAATGGGG + Intergenic
1017699903 6:157058711-157058733 CTCACCCGTGCTGGGTGCTGAGG + Intronic
1021054188 7:16026794-16026816 TTCACCCGTCCTTGGGAATGTGG - Intergenic
1023986170 7:45097869-45097891 ATCACCAGTGTTGGAGAATGGGG - Intergenic
1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG + Intronic
1025777219 7:64569999-64570021 GTCGCCTGTGATGGTGAATGAGG - Intergenic
1029704939 7:102271200-102271222 CTCATCCCTGAGGTGGAATGTGG + Intronic
1030129002 7:106180695-106180717 CTCCCCATTGTTGGGGAATGAGG + Intergenic
1032965416 7:137091586-137091608 CTGACCCCTCTTGGGGAATGTGG + Intergenic
1035854553 8:2960366-2960388 CTCACGAGAGATGGGGAAAGTGG + Intronic
1036591495 8:10172718-10172740 CTCACCAGAGATGGGAAAGGAGG + Intronic
1044840092 8:96329829-96329851 CTCTCCTGTGATGGGGAAGCCGG + Intronic
1046239635 8:111474449-111474471 TTCACCCGTGATGGGTACTATGG + Intergenic
1049613217 8:143565392-143565414 CTCACCCCAGATGGGGGCTGAGG - Intergenic
1049714880 8:144085121-144085143 ATCACCTGTGATGGGGGAAGGGG - Exonic
1051634944 9:19173133-19173155 CTTCCCCGTGATGGGGAGAGGGG - Intergenic
1052473201 9:28925926-28925948 CTCACCCCTGAGTGGGAATGGGG + Intergenic
1058150530 9:101459024-101459046 CTCACATGTGAAAGGGAATGAGG + Intergenic
1060839270 9:126781394-126781416 CTCCCAGGTGATGGGGAAGGGGG + Intergenic
1186542622 X:10416262-10416284 CTCAGCCATGCTTGGGAATGTGG + Intergenic
1194867459 X:99086316-99086338 CCACCCAGTGATGGGGAATGTGG - Intergenic