ID: 917382482

View in Genome Browser
Species Human (GRCh38)
Location 1:174429233-174429255
Sequence GTGAAGAAGACGACTAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917382482_917382486 1 Left 917382482 1:174429233-174429255 CCATCACTAGTCGTCTTCTTCAC 0: 1
1: 0
2: 1
3: 3
4: 89
Right 917382486 1:174429257-174429279 GGATAAGATAGTTAAAGGAAGGG 0: 1
1: 0
2: 1
3: 22
4: 289
917382482_917382485 0 Left 917382482 1:174429233-174429255 CCATCACTAGTCGTCTTCTTCAC 0: 1
1: 0
2: 1
3: 3
4: 89
Right 917382485 1:174429256-174429278 TGGATAAGATAGTTAAAGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 220
917382482_917382487 20 Left 917382482 1:174429233-174429255 CCATCACTAGTCGTCTTCTTCAC 0: 1
1: 0
2: 1
3: 3
4: 89
Right 917382487 1:174429276-174429298 AGGGCATTTGTGTTTTTTGAAGG 0: 1
1: 0
2: 2
3: 32
4: 399
917382482_917382484 -4 Left 917382482 1:174429233-174429255 CCATCACTAGTCGTCTTCTTCAC 0: 1
1: 0
2: 1
3: 3
4: 89
Right 917382484 1:174429252-174429274 TCACTGGATAAGATAGTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917382482 Original CRISPR GTGAAGAAGACGACTAGTGA TGG (reversed) Intronic
908935069 1:69365338-69365360 TTAAACAAGATGACTAGTGATGG - Intergenic
909566101 1:77055049-77055071 GAGAGGAAGAAGACAAGTGATGG - Intronic
913484308 1:119319876-119319898 GTGAAGGTGAGGACTAGGGAAGG - Intergenic
914417830 1:147500457-147500479 GTGAAGGAGAAGCCTAGAGAGGG + Intergenic
915888979 1:159753419-159753441 GTAAACAAGAGGACTGGTGAAGG - Intergenic
916664490 1:166953552-166953574 GTGAAGAAAAAAACTATTGATGG - Intronic
917382482 1:174429233-174429255 GTGAAGAAGACGACTAGTGATGG - Intronic
921187298 1:212681368-212681390 GGGATGAAGACAACTAGGGAGGG + Intergenic
922915428 1:229253236-229253258 GTGAAAAAAACGAATGGTGAGGG - Intergenic
1068038872 10:51797725-51797747 GTTATGAAGATGAATAGTGATGG - Intronic
1071274218 10:84038092-84038114 TTGAAGAAGAGGAATAGGGAGGG + Intergenic
1073572786 10:104594873-104594895 GTGATGGAGCAGACTAGTGAGGG + Intergenic
1073649921 10:105347453-105347475 GTGAAGAAGGGGACTAGATATGG - Intergenic
1074783500 10:116819076-116819098 GTGAAGAAGAGGAAAAGTCAAGG - Intergenic
1075409696 10:122218281-122218303 GTGAAGAAGATCACATGTGAAGG + Intronic
1076679436 10:132164048-132164070 GTTAAGAACACCACTAGCGAAGG + Intronic
1079533208 11:21479995-21480017 GATAAGAAGACTACTAGTCAGGG - Intronic
1080820984 11:35806366-35806388 GTGAAGAAGAGGACACATGAAGG + Exonic
1085376303 11:76065017-76065039 GTAAAGAAGGGGAATAGTGAGGG + Intronic
1088689965 11:112317498-112317520 GTGAAGAACAGGACTAGCAATGG - Intergenic
1094719022 12:33043310-33043332 CTGCAGGAGACGACTAATGAAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109747507 13:66646660-66646682 GTGTAGAAGACGATTGGTGAAGG - Intronic
1113042860 13:106123638-106123660 CTGAAGAAGGAGACAAGTGATGG - Intergenic
1124071205 15:26394616-26394638 CTGAAGAAGGCAACTAGTGTAGG + Intergenic
1126621183 15:50641514-50641536 GTCAAGAAGAGGGATAGTGAGGG - Intronic
1128431145 15:67595428-67595450 GTGAAGCAAAGGTCTAGTGATGG + Intronic
1130809250 15:87359238-87359260 GTGAAGAACAAAACCAGTGAGGG - Intergenic
1130976731 15:88782275-88782297 GTGAAGGAGAGGATGAGTGAGGG + Intergenic
1133057398 16:3152598-3152620 GTGGAGACGACGGCTTGTGAAGG + Intergenic
1135526827 16:23219648-23219670 GTGACTCAGAGGACTAGTGAGGG - Intergenic
1138217147 16:55214445-55214467 CTGAAGAAGACGATGAGGGAAGG + Intergenic
1139076618 16:63457817-63457839 GTGTAGAAGACAACTTCTGAGGG + Intergenic
1144028706 17:11301168-11301190 GGGAGGAAGAAAACTAGTGAGGG - Intronic
1147755319 17:42763387-42763409 ATGAAGAAGAGGAATAGTCAGGG - Intergenic
1159623112 18:70662141-70662163 ATGAAGAACAAGACTAGTCATGG - Intergenic
1163170637 19:15528557-15528579 GGGAAGAAGACCACCAGTAAAGG - Intronic
1168609411 19:57787204-57787226 GTGAGGATGAGGACCAGTGAGGG - Intronic
925768021 2:7256434-7256456 GGGAAGAAGACGACTAAATATGG - Intergenic
927897774 2:26795599-26795621 GTGATGAAAATGATTAGTGAGGG + Intronic
931597949 2:63970806-63970828 GAGAAGAAAACGACTGGTGATGG - Intronic
935158338 2:100505005-100505027 GTGCAGAATACCAATAGTGAGGG + Intergenic
936748944 2:115616980-115617002 GTAAAGAGGACTTCTAGTGAGGG - Intronic
943620988 2:190148041-190148063 GTGTTGAAGACGAGTGGTGAGGG + Intronic
1170803771 20:19612089-19612111 GTCAAGTAGACAACTAGGGACGG - Intronic
1178929587 21:36805810-36805832 ATGAAGTGGACGTCTAGTGATGG - Intronic
955362610 3:58288582-58288604 GTGAACAAACCAACTAGTGAAGG + Intronic
957553146 3:81732695-81732717 GTAAACAGGACGACTAGTTATGG - Intronic
957639740 3:82836539-82836561 TTGTGGAAGACCACTAGTGAGGG + Intergenic
966274462 3:178148538-178148560 GTGAAGAAGATGGAAAGTGAAGG + Intergenic
968413788 4:410717-410739 TGAAAGAAGACAACTAGTGATGG - Intergenic
972155304 4:36153797-36153819 ATGAAGAGGAGGAGTAGTGAAGG - Intronic
974651547 4:64759700-64759722 GTGAAGAAGAAGAAGAGTGAAGG - Intergenic
976730681 4:88258027-88258049 GTGAACAAGCCAACTTGTGATGG - Exonic
977293367 4:95187032-95187054 GAGAAGAAGAAGAAAAGTGAGGG + Intronic
981193724 4:141893749-141893771 ATGAAAAAGAGGAATAGTGAGGG - Intergenic
981788221 4:148504800-148504822 GTGATGATGATGACCAGTGAGGG + Intergenic
984456627 4:179977438-179977460 GGGAAGAAGAGGAATAGAGAGGG - Intergenic
984925894 4:184806370-184806392 GTGATGAAGACAACTAGAGGTGG - Intronic
985909287 5:2866350-2866372 GGGAAGCAGATGCCTAGTGACGG - Intergenic
995666925 5:114552934-114552956 GTGAGGAAGAGGTCTAGTGTTGG - Intergenic
995959376 5:117821403-117821425 GTGAGGAAGAGGTCTAGTGTTGG + Intergenic
1010851783 6:80785561-80785583 GAGAAGAAGACGGAGAGTGAAGG - Intergenic
1013160721 6:107542166-107542188 GTGAGGGAGAGGGCTAGTGAAGG + Intronic
1014016447 6:116536396-116536418 TTGAAGAAAAAAACTAGTGAGGG + Intronic
1020594375 7:10186364-10186386 GTGAAGAAAAGAAATAGTGAGGG + Intergenic
1027494035 7:78865340-78865362 GTGAGGAAGACCATTAGTCAAGG + Intronic
1028262292 7:88681210-88681232 GTGAAGCAGACAAGTAGTTAGGG - Intergenic
1028968981 7:96835680-96835702 GTGGAGAAGATGAAAAGTGAGGG - Intergenic
1030283830 7:107804482-107804504 GTGAAGATGAAGAAAAGTGATGG - Intergenic
1030733150 7:113013992-113014014 CTGGATAAGATGACTAGTGAAGG - Intergenic
1031459389 7:122027254-122027276 GTGAAGGAGAGGACCAGTGTGGG + Intronic
1031781063 7:125965920-125965942 CTCAAGAAGATGACAAGTGATGG - Intergenic
1033356204 7:140602138-140602160 GTGGAGAGGAGGAGTAGTGATGG - Exonic
1034214699 7:149396381-149396403 GTGAAGAAGACGAGTAGGGAAGG + Intergenic
1035941716 8:3908947-3908969 GTGAAGGAGAACAGTAGTGAAGG - Intronic
1037590360 8:20306745-20306767 GTGGAGAAGGAGACCAGTGATGG + Intergenic
1037798676 8:22018757-22018779 GTGTTGAATACGACTGGTGAAGG - Intergenic
1038394129 8:27234332-27234354 GTGAAGAGCAAGCCTAGTGAGGG + Intergenic
1043683972 8:83065549-83065571 GTAATGAAGACTACTATTGATGG - Intergenic
1046021044 8:108665288-108665310 GTGAAGAAGTTGTCTAATGAGGG + Intronic
1046561207 8:115839748-115839770 GGCAAGAAGAAGACTAATGAAGG + Intergenic
1047445582 8:124916214-124916236 GGGAAGAAGAAGACCAGGGAAGG - Intergenic
1055663570 9:78531421-78531443 GTGAAGATGACAACATGTGAGGG + Intergenic
1055802345 9:80052168-80052190 CTGTGGGAGACGACTAGTGAAGG + Intergenic
1058457382 9:105150050-105150072 ATGAACAAGAAGAGTAGTGAAGG + Intergenic
1187030911 X:15487255-15487277 GTGAAGAACAAGATTAGTCAAGG + Intronic
1187933249 X:24312762-24312784 GTGAAGACGATGACAAGAGATGG - Intergenic
1187938975 X:24363292-24363314 GTGAAGATGATGACAAGAGATGG + Intergenic
1188987523 X:36780772-36780794 GTGCAGAATACAACCAGTGAAGG - Intergenic
1190441873 X:50482823-50482845 GTGAAGAAGACTATGAGGGAGGG + Intergenic
1195900938 X:109796550-109796572 ATGACGACGACGACTAGAGATGG - Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1199521801 X:148744383-148744405 GTGAAGAAGAAAACAAGTTAAGG + Intronic