ID: 917383815 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:174446084-174446106 |
Sequence | CAGGATGAGGAGGAGGAGTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3356 | |||
Summary | {0: 2, 1: 1, 2: 41, 3: 608, 4: 2704} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
917383807_917383815 | 9 | Left | 917383807 | 1:174446052-174446074 | CCTTTCTGATGGTGAGTTTTTCT | 0: 1 1: 0 2: 3 3: 200 4: 6673 |
||
Right | 917383815 | 1:174446084-174446106 | CAGGATGAGGAGGAGGAGTAGGG | 0: 2 1: 1 2: 41 3: 608 4: 2704 |
||||
917383806_917383815 | 17 | Left | 917383806 | 1:174446044-174446066 | CCGAGTCACCTTTCTGATGGTGA | 0: 1 1: 0 2: 1 3: 22 4: 149 |
||
Right | 917383815 | 1:174446084-174446106 | CAGGATGAGGAGGAGGAGTAGGG | 0: 2 1: 1 2: 41 3: 608 4: 2704 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
917383815 | Original CRISPR | CAGGATGAGGAGGAGGAGTA GGG | Intronic | ||
Too many off-targets to display for this crispr |