ID: 917383815

View in Genome Browser
Species Human (GRCh38)
Location 1:174446084-174446106
Sequence CAGGATGAGGAGGAGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3356
Summary {0: 2, 1: 1, 2: 41, 3: 608, 4: 2704}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917383807_917383815 9 Left 917383807 1:174446052-174446074 CCTTTCTGATGGTGAGTTTTTCT 0: 1
1: 0
2: 3
3: 200
4: 6673
Right 917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG 0: 2
1: 1
2: 41
3: 608
4: 2704
917383806_917383815 17 Left 917383806 1:174446044-174446066 CCGAGTCACCTTTCTGATGGTGA 0: 1
1: 0
2: 1
3: 22
4: 149
Right 917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG 0: 2
1: 1
2: 41
3: 608
4: 2704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917383815 Original CRISPR CAGGATGAGGAGGAGGAGTA GGG Intronic
Too many off-targets to display for this crispr