ID: 917384928

View in Genome Browser
Species Human (GRCh38)
Location 1:174462012-174462034
Sequence TAAGGTATACAGAAGGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917384928_917384932 11 Left 917384928 1:174462012-174462034 CCAAGAACCTTCTGTATACCTTA 0: 1
1: 0
2: 2
3: 11
4: 166
Right 917384932 1:174462046-174462068 GTTTCTGTCCAGGCTTCTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 271
917384928_917384931 1 Left 917384928 1:174462012-174462034 CCAAGAACCTTCTGTATACCTTA 0: 1
1: 0
2: 2
3: 11
4: 166
Right 917384931 1:174462036-174462058 TAAAAGCATTGTTTCTGTCCAGG 0: 1
1: 0
2: 0
3: 31
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917384928 Original CRISPR TAAGGTATACAGAAGGTTCT TGG (reversed) Intronic
901445477 1:9305474-9305496 TTAGGTCCACAGTAGGTTCTTGG + Intronic
903599724 1:24527748-24527770 AAAGGTATTGAGAAGTTTCTTGG + Intronic
903892067 1:26576410-26576432 TAAGGGAAACAGAAGATTCAAGG + Intergenic
912600088 1:110921977-110921999 TGAGGTCTACATAAGGTTGTAGG - Intergenic
913042441 1:115040640-115040662 TAAAGTATACAGGAGGAGCTAGG + Intergenic
915333708 1:155128751-155128773 AAGGGGTTACAGAAGGTTCTGGG + Intronic
916946133 1:169729525-169729547 TGAGGTACACTGAAGGCTCTGGG + Exonic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
919720444 1:200828309-200828331 TAAAGTATACAGCATATTCTAGG + Intronic
920242687 1:204564862-204564884 TAGGGTCCACAGATGGTTCTAGG - Intergenic
920518749 1:206606607-206606629 ACAGGTAAACAGAAGTTTCTAGG + Intronic
921931856 1:220761357-220761379 TTAGGCATACAGAAGCTTGTTGG + Intronic
922589609 1:226764740-226764762 TAAGATAAACTGAAGATTCTGGG - Intergenic
1064333286 10:14414687-14414709 TAATGTCTTCAGTAGGTTCTTGG + Intronic
1066311694 10:34203529-34203551 TAAAGTATACAGGAGGATGTGGG - Intronic
1068760952 10:60708573-60708595 TAAGGAAAACAGAATGTTCTGGG - Intronic
1071035905 10:81245350-81245372 TAAGATATACAGACGTTTTTTGG - Intergenic
1073740501 10:106400818-106400840 TTAGGTTTAGATAAGGTTCTAGG + Intergenic
1085215033 11:74821974-74821996 CAAGGTCTAAAGAAGCTTCTGGG + Intronic
1085313301 11:75528738-75528760 TAAGGAAGGTAGAAGGTTCTTGG - Intergenic
1088053714 11:105550794-105550816 TAAGGAAAACAGAAAGATCTTGG - Intergenic
1088927271 11:114315027-114315049 AAATGTATACAGATGGTCCTCGG - Intergenic
1089707449 11:120289962-120289984 TTTGGTATACAGTAGGTGCTTGG + Intronic
1090152564 11:124401103-124401125 TAATTTATACAGAATTTTCTTGG + Intergenic
1092486284 12:8905024-8905046 AAAGGTATACAGTAGTTCCTTGG + Intergenic
1092487224 12:8913515-8913537 TAACCTTTACAGAAGGGTCTGGG - Intergenic
1093794133 12:23291079-23291101 TAAGGTCAACAGAAGATTCAGGG - Intergenic
1094386252 12:29896885-29896907 TATGGTAAACAGAAGTTTATTGG + Intergenic
1095818257 12:46448863-46448885 TTATATATAAAGAAGGTTCTTGG - Intergenic
1099982901 12:89627609-89627631 TATGGTATACAGTAGATTTTTGG + Intronic
1101246803 12:102891334-102891356 TAAGGCAAACAGTGGGTTCTGGG - Intronic
1101334108 12:103781289-103781311 TGTGATAAACAGAAGGTTCTTGG - Intronic
1101482720 12:105116697-105116719 TAAGGTATACAACATGTTATGGG - Intronic
1103625588 12:122216740-122216762 TGAGGTAAGCAGAAAGTTCTAGG - Exonic
1105987652 13:25584439-25584461 TAAGGTATCCAGAAGATATTTGG + Intronic
1107846962 13:44524960-44524982 TAAGGATAACAGAATGTTCTGGG - Intronic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110455552 13:75686618-75686640 GAATGTGTACAGAAGGGTCTAGG + Intronic
1110527202 13:76552407-76552429 TAAAATATACAGACTGTTCTTGG - Intergenic
1111716397 13:91884866-91884888 TAAAGGATACAGAAGGTTTCAGG - Intronic
1112837408 13:103532991-103533013 TCAGGTATACAGAATATTCAAGG - Intergenic
1114764200 14:25351686-25351708 TTTGTTACACAGAAGGTTCTAGG + Intergenic
1114998032 14:28383567-28383589 TAATGTGTACAAAAGATTCTTGG - Intergenic
1117048813 14:51840244-51840266 TAAGGGATGAAGAAAGTTCTGGG - Intronic
1120110878 14:80554450-80554472 TAAGTTCTACCGAATGTTCTAGG - Intronic
1121067288 14:90980274-90980296 TAAGGAACACAGAAGTTTCAGGG - Intronic
1121838251 14:97111013-97111035 AAAGGTATATAGAAAGTTCTTGG - Intergenic
1121937653 14:98035044-98035066 TATGCTATCCAGAAGCTTCTGGG + Intergenic
1122841500 14:104466385-104466407 TAAGGAACACAGATGGATCTTGG - Intergenic
1123737301 15:23197879-23197901 TAAAGGATACAGAAGGTTTCAGG - Intergenic
1124288518 15:28426543-28426565 TAAAGGATACAGAAGGTTTCAGG - Intergenic
1124294708 15:28490771-28490793 TAAAGGATACAGAAGGTTTCAGG + Intergenic
1124782240 15:32647116-32647138 TAAGCTAAACAGAAGGTTATAGG - Intronic
1128755858 15:70183269-70183291 ATAGGCATACAGTAGGTTCTGGG - Intergenic
1128915694 15:71559903-71559925 TAAGGTATTCAATAGTTTCTTGG - Intronic
1129169326 15:73798178-73798200 TAAGGTAGACACAGGGTCCTGGG + Intergenic
1129287295 15:74536035-74536057 CAAGGTATAGAAAAGGTCCTAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132380735 15:101364285-101364307 TAACGTTTACAGAATGTGCTGGG - Intronic
1133454758 16:5932281-5932303 TAAGGAATACAGAAGGTCTGTGG + Intergenic
1134091101 16:11392141-11392163 TGAAGTAGACACAAGGTTCTCGG + Intronic
1139190674 16:64859227-64859249 TGAGGTAGACAGAAAGTTCCTGG + Intergenic
1139208877 16:65056721-65056743 GAAGGAAAACAGAAGGTACTTGG - Intronic
1140306580 16:73808468-73808490 TCAGGTATACAGAAGATGGTTGG + Intergenic
1144841995 17:18192517-18192539 TAAGGAGAACAGTAGGTTCTTGG - Intronic
1146249889 17:31330304-31330326 TAAGGCACACAGAAGATTATAGG - Exonic
1148386898 17:47240547-47240569 TAAGGGAGACAGTAGGTTGTAGG + Intergenic
1150002003 17:61446717-61446739 TCAGGTCTACAGCATGTTCTAGG - Intergenic
1152499769 17:80700070-80700092 AAAGGTAGGAAGAAGGTTCTGGG + Intronic
1154115710 18:11611523-11611545 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154120154 18:11645742-11645764 TAAAGTATACAGGAGGATGTGGG + Intergenic
1157085385 18:44575257-44575279 TATGGAATGCATAAGGTTCTGGG - Intergenic
1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG + Intergenic
1158936154 18:62366602-62366624 TAAGGTATACAACATGTTATAGG - Intronic
1159047570 18:63383885-63383907 TAATGTAAAAAGAAGGGTCTAGG - Intergenic
1159452531 18:68620577-68620599 TAAGGTATAAGGAAGGTTTCCGG - Intergenic
1160614416 18:80113575-80113597 TAAGATATGCAGAAAGTGCTAGG - Intronic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162226363 19:9225932-9225954 TAATGAATACAGATGGCTCTGGG - Intergenic
1165586251 19:36918371-36918393 TAATGTATAAAGAAGGATGTAGG - Intronic
927708946 2:25313501-25313523 TAAGGTGTTCAGTAGCTTCTAGG - Intronic
927886400 2:26721289-26721311 GAAGGTTCCCAGAAGGTTCTCGG + Intronic
929991709 2:46795563-46795585 TTAAGTATACAGAAGGATGTGGG - Intergenic
930307883 2:49699149-49699171 TAAATTATACAGTAAGTTCTAGG - Intergenic
931851258 2:66252611-66252633 TCAGTTCTCCAGAAGGTTCTCGG - Intergenic
934865148 2:97802282-97802304 TAAGGTTGAGAGAAGGTTTTAGG - Intronic
936745396 2:115570409-115570431 TGAAGTATACAGAAGGTGTTGGG - Intronic
938590198 2:132728629-132728651 TAAGGAATACTGTGGGTTCTTGG - Intronic
939000560 2:136729227-136729249 TAAGGTCGTCAGAAGATTCTGGG + Intergenic
939209656 2:139157708-139157730 TAAAGTATACAGGAGGATGTGGG + Intergenic
940552784 2:155182919-155182941 AAAGGGATAGAGAAAGTTCTAGG + Intergenic
940979023 2:159980521-159980543 AAAGGTACACAGTAGGTTTTGGG + Intronic
941042689 2:160641163-160641185 TAAGGTATAAAGAAGGTAGTTGG - Intergenic
941082167 2:161074276-161074298 TAAAGTATACAGAGGGATGTAGG - Intergenic
941855129 2:170223180-170223202 TCAGGTAAAGAGAAGGTTCAAGG - Intronic
945232729 2:207609465-207609487 TGAAATATACAGAAGGTACTGGG + Exonic
945247295 2:207730196-207730218 TAAGGAATATAGAAGGTTCTGGG - Intronic
947019233 2:225656319-225656341 TTAAGTATACAGAAGGGACTGGG - Intergenic
947206984 2:227669917-227669939 TAATGTATAGTGAAGATTCTAGG + Intergenic
1169820975 20:9709637-9709659 AAAGCTTTACAGAAGGATCTGGG + Intronic
1171497342 20:25565220-25565242 TATGGAAAACAGAATGTTCTGGG - Intronic
1175229705 20:57465971-57465993 TAATGTACACAGAAGCTTCTTGG - Intergenic
1177189508 21:17834409-17834431 TGAAATATACAGAAGGTACTCGG - Intergenic
1177687851 21:24463256-24463278 TCAAGGATACAGAAGGTGCTCGG - Intergenic
1178627634 21:34231561-34231583 TAACATTTACAGAAGGTGCTGGG - Intergenic
1179320565 21:40287412-40287434 TGAGGACTACAGAAGGTTCCAGG + Intronic
1183492829 22:38125942-38125964 CTAGGTATACAGCAGGTGCTGGG + Intronic
1183792384 22:40083213-40083235 TGAGGGATACAGCAGCTTCTAGG - Intronic
949805201 3:7947360-7947382 TAACGTATACAGGAGATTCTGGG + Intergenic
950962907 3:17123966-17123988 CAAGGGATATAGAAAGTTCTTGG - Intergenic
951720081 3:25689040-25689062 TAAGGGAGAGAGAAGGTGCTGGG + Intergenic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
954011848 3:47647522-47647544 TTTGCTATACAGATGGTTCTTGG - Intronic
954991463 3:54844080-54844102 TAAGGCAGACAGTAGGTACTGGG + Intronic
957443070 3:80277944-80277966 TAAGTTATAGAGAAAGTTATAGG + Intergenic
958876691 3:99624878-99624900 TAAGGTGTCAAGAAGTTTCTTGG + Intergenic
963974150 3:151461493-151461515 TAAGGTATACAACATGTTATGGG + Intergenic
970891435 4:21049248-21049270 TAAGATAAACAGAAGGTACTGGG - Intronic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
972973613 4:44607052-44607074 TAATGGATACATAAGATTCTAGG + Intergenic
973018142 4:45166982-45167004 TAAGTTATACAGAAGGTTGGAGG - Intergenic
975487043 4:74945507-74945529 TAATGGTTAGAGAAGGTTCTGGG + Intronic
975777614 4:77805149-77805171 TAATATATACAGTAGTTTCTTGG - Intronic
975831442 4:78373230-78373252 TATGGTATACAGAGGGTTGAAGG - Intronic
983176535 4:164595312-164595334 TGAGGTATGAAGTAGGTTCTTGG + Intergenic
984258795 4:177419313-177419335 TAAGGTCTACAGAAGGAAATGGG + Intergenic
984587956 4:181584404-181584426 TAAGGAATACAGAAGAAGCTTGG - Intergenic
986484896 5:8226066-8226088 TAACGTAGACAAAAGGTTATTGG + Intergenic
991509648 5:67362601-67362623 TAAGTTATACAGGAGGCCCTAGG + Intergenic
992373051 5:76164887-76164909 TAAAGTATACAGGAGGATGTGGG - Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
993391903 5:87328637-87328659 TAAGGTAGACAGCATTTTCTTGG + Intronic
995078658 5:108018624-108018646 TCAGGTATTCAAAAGGTTCATGG - Intronic
995940677 5:117578988-117579010 TAAGTTATACAGAATGTACCAGG - Intergenic
997255380 5:132424290-132424312 TAAGTTCCACAGAAGGTTCTTGG + Intronic
998359052 5:141568725-141568747 GTAGGTATACCGAAGGTTTTAGG + Intronic
1002165097 5:177338968-177338990 TAACGTCTGCAGAAGGTTCCAGG - Intronic
1002990918 6:2237969-2237991 TAAGAGCTACAGAAAGTTCTGGG + Intronic
1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG + Intergenic
1004971887 6:20919733-20919755 TAAGGTGTTCAAAAGGTGCTGGG - Intronic
1005773008 6:29096374-29096396 TTTGTTATACAGAAGGTTTTTGG - Intergenic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007877837 6:45126583-45126605 GAAGATTTACAGAATGTTCTGGG + Intronic
1008577686 6:52876886-52876908 TCAGGTATACAGAAGCTCCCAGG + Intronic
1008597327 6:53055608-53055630 AAAGGTATGAAGAAGTTTCTGGG - Intronic
1012760152 6:103291383-103291405 TAAGGCTTACAGCAGGTTTTAGG + Intergenic
1013832641 6:114292805-114292827 TAAAGTATACAGGAGGATATTGG - Intronic
1021329908 7:19323809-19323831 TTAAGTATACTGAAGGTTCAGGG + Intergenic
1021514361 7:21466653-21466675 TAAGAGATACAGAAGGTACTCGG + Intronic
1026922946 7:74169887-74169909 CAATGTATACAGAACTTTCTGGG + Intergenic
1028058133 7:86274479-86274501 TAAGATATAGAAAAGCTTCTAGG + Intergenic
1029066004 7:97849121-97849143 CAAGGCTTATAGAAGGTTCTTGG - Intergenic
1029387937 7:100256138-100256160 TAAGTTATACAGATGGCTTTAGG + Intronic
1030603200 7:111612121-111612143 GCAGGTATACAGAAGTGTCTGGG - Intergenic
1034369345 7:150581054-150581076 GAAGGCAGACAGAAGGTCCTTGG + Intergenic
1036037676 8:5037872-5037894 TAAAGTATACACAAGGATGTAGG - Intergenic
1036182180 8:6594991-6595013 TAAGATTTACAAGAGGTTCTTGG - Intronic
1036925062 8:12896397-12896419 TCAGGTACACAGTAGTTTCTGGG + Intergenic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1040603338 8:48905969-48905991 TAAGGCAAACATAAGGTTATGGG - Intergenic
1041684139 8:60627046-60627068 TAAAGTATACAGCAGGATGTGGG + Intergenic
1043777131 8:84283798-84283820 TAAGGGATTCAGAATTTTCTGGG + Intronic
1043978867 8:86615097-86615119 TAAAGTATACAGGAGGATGTGGG + Intronic
1046349450 8:112987987-112988009 TAAGGAAAATAGAAGGGTCTAGG + Intronic
1059899146 9:118903420-118903442 TAAGGTATACACCATGTTATAGG - Intergenic
1060545268 9:124455680-124455702 TAAGGTGGTCAGCAGGTTCTTGG - Intronic
1188648589 X:32600829-32600851 TTAAGAATTCAGAAGGTTCTAGG + Intronic
1189198355 X:39170337-39170359 TAATGTATACATAAAGTGCTTGG - Intergenic
1192455872 X:71275276-71275298 GAAGATATACAAAAGGTTCAAGG - Intergenic
1193292519 X:79792255-79792277 TTTGGGATACAGATGGTTCTTGG + Intergenic
1194116358 X:89903637-89903659 AAAGGTATTCATAACGTTCTCGG - Intergenic
1197138755 X:123093032-123093054 TAACATAAACAGAAGGTTTTGGG - Intergenic
1199044519 X:143153300-143153322 TATAGTATACAGAAGATTCATGG - Intergenic
1199066759 X:143428359-143428381 TAAGGTCTTCAGAAAGTTCAAGG - Intergenic
1199493660 X:148428569-148428591 TATGGTTTATAGAAGGTGCTAGG - Intergenic
1200469156 Y:3560810-3560832 AAAGGTATTCATAACGTTCTCGG - Intergenic
1201960316 Y:19673926-19673948 GAGGGTATAGAGAAGTTTCTTGG - Intergenic
1202362700 Y:24128511-24128533 TTAGGATTACAGAAGGCTCTGGG - Intergenic
1202508406 Y:25545528-25545550 TTAGGATTACAGAAGGCTCTGGG - Intergenic