ID: 917393596

View in Genome Browser
Species Human (GRCh38)
Location 1:174566906-174566928
Sequence AAGGCTGATGAAGCTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917393596 Original CRISPR AAGGCTGATGAAGCTTTTCT GGG (reversed) Intronic
900939470 1:5788904-5788926 AGTGCTGATGAGACTTTTCTGGG - Intergenic
906573283 1:46862820-46862842 AAGTGTGGTGAAGCTTTGCTAGG - Intergenic
906900203 1:49827552-49827574 AAGGCTGATGATACTTTCCAAGG + Intronic
908279274 1:62513521-62513543 AAGCTTGAAGAAGCTATTCTTGG - Exonic
909344226 1:74566731-74566753 AAGGAAGATGAAGCTTTTCATGG - Intergenic
910189861 1:84584346-84584368 AATGCTGATGCAGCTAATCTAGG + Intergenic
910480089 1:87649344-87649366 GAGGCTGATGAGGCTTCACTTGG - Intergenic
910574893 1:88750210-88750232 AAGTCTGAGGAGGCTTTCCTGGG + Intronic
913359130 1:117959947-117959969 AAGTCTGAGGACGCTGTTCTGGG - Exonic
917354236 1:174109286-174109308 AAGTTTGACGAAACTTTTCTAGG + Intergenic
917393596 1:174566906-174566928 AAGGCTGATGAAGCTTTTCTGGG - Intronic
918116861 1:181505305-181505327 AAGGATGATGAGTCTTCTCTCGG - Intronic
921580118 1:216886564-216886586 GAGGATGAGGAAGCTTTTCAAGG - Intronic
923517722 1:234711516-234711538 AAGGCTGAAGAATCTTTCCTTGG + Intergenic
1064089026 10:12367777-12367799 AATACTGATGAAGCTTTGCTTGG + Intronic
1064737254 10:18395005-18395027 CAGGCTGAAGGAGTTTTTCTGGG + Intronic
1072662158 10:97369815-97369837 GAGGCTAATCAAGCTGTTCTAGG + Intronic
1073176746 10:101561521-101561543 AAGGGTGATGATGTTCTTCTGGG + Intergenic
1073604094 10:104876486-104876508 AAGGATCAGAAAGCTTTTCTGGG - Intronic
1074278631 10:112029087-112029109 AAGGGTGATGATGCTGCTCTGGG + Intergenic
1074293537 10:112160097-112160119 AAGCCAGTTGAAGTTTTTCTTGG - Intronic
1075164577 10:120055512-120055534 AAGGCTGATGCATTTCTTCTAGG + Intergenic
1075492869 10:122888695-122888717 AAGCCTGATGAAGGCATTCTTGG + Intergenic
1075841009 10:125503345-125503367 ATGGCTGGTGAATTTTTTCTAGG + Intergenic
1077467759 11:2741703-2741725 CAGGCTGAGGAAGCTGTGCTCGG + Intronic
1080923260 11:36730336-36730358 AAGGCTGATGCTGCTAGTCTGGG - Intergenic
1081302518 11:41469722-41469744 AAAGCTGCTGAAACTTTTCTTGG - Intergenic
1081341351 11:41931935-41931957 AATTCTGATGAATGTTTTCTTGG + Intergenic
1082715163 11:56603264-56603286 AAGGATGCTGAAGCTGTTCATGG - Intergenic
1085484488 11:76850455-76850477 AAGGCAGAGAAAGCATTTCTGGG - Intergenic
1086325480 11:85694189-85694211 AAGGCTAATGAACTTCTTCTGGG - Intergenic
1086397844 11:86434226-86434248 AAGTCTGATGAAGCTTCCATAGG + Intergenic
1087202817 11:95363371-95363393 AAGGATGAGTAAGCTTTTGTTGG + Intergenic
1087277932 11:96179028-96179050 AAAGCAGATGAACCCTTTCTCGG - Intronic
1087837759 11:102891867-102891889 AAGGCTGATGCTGCTGGTCTGGG - Intergenic
1088272298 11:108046306-108046328 AAGCCTGATGAATTTTTGCTGGG - Exonic
1089078036 11:115754446-115754468 AAGCCTCATGAAGCTTTTAGAGG - Intergenic
1089425809 11:118373756-118373778 AAGGCTGCTCAAGCCTCTCTGGG + Intronic
1091942256 12:4498509-4498531 AAGTCTGATGAAGCTTTCATAGG + Intronic
1092710646 12:11333681-11333703 ACCTCTGCTGAAGCTTTTCTGGG - Intergenic
1093389740 12:18603460-18603482 AAGGCTGGGGAAGTTTTGCTTGG - Intronic
1093517471 12:20006009-20006031 AAGGCTGAAGAGGCTTTCCAAGG + Intergenic
1097521070 12:60672029-60672051 AAGGCTGATGAAGTTTGCTTGGG + Intergenic
1098573992 12:72020091-72020113 AAGGATGATGTTGCTCTTCTGGG + Intronic
1098613597 12:72493822-72493844 AAGGCTGATGTGAGTTTTCTAGG - Intronic
1101629890 12:106483022-106483044 ATGGCTGAAGAAGCTTTAGTGGG - Intronic
1103651884 12:122439319-122439341 AAAGCTCAAGAAGCTTGTCTAGG - Intergenic
1105282910 13:18979517-18979539 AAGGGTGATGTAAGTTTTCTAGG - Intergenic
1105912114 13:24878805-24878827 ATGGCTGGTGAAGCATTTCTAGG - Intronic
1108577420 13:51802288-51802310 GATGCTGATGCAGCTTGTCTGGG - Intronic
1108795641 13:54026565-54026587 AATGCTGAGGAAGCTTATTTTGG - Intergenic
1109899006 13:68738245-68738267 AAGGCTGAAGAAACTCTTCTTGG + Intergenic
1110711687 13:78657709-78657731 AAGGCTGATAAAAATATTCTTGG - Intronic
1111864034 13:93745361-93745383 AAGGATGATGAAGTTTCTTTAGG - Intronic
1112261682 13:97883245-97883267 AATGCAGATGAACCTTTTCAGGG - Intergenic
1113858552 13:113464941-113464963 AAGTATTATGGAGCTTTTCTAGG - Intronic
1115019553 14:28659647-28659669 ATGGCAGATGAAGCTCATCTGGG + Intergenic
1116263851 14:42662914-42662936 AAGACTGAGGAAGCTATTTTGGG + Intergenic
1118406733 14:65431696-65431718 AAAGCTGAAGAAGCTTCTGTTGG - Intronic
1118467865 14:66047278-66047300 GACTCTGATGAAGCTTTTCCAGG + Intergenic
1119530567 14:75357457-75357479 AATGTTGATGAAGATTATCTAGG + Intergenic
1120258826 14:82156425-82156447 AAGGCTTATGTAGCATTTCATGG + Intergenic
1121232516 14:92368290-92368312 AAGGGTCATGAAGCTTTCCTGGG - Intronic
1126711237 15:51458795-51458817 ACTGCTGATGAATGTTTTCTAGG - Exonic
1128170960 15:65512575-65512597 AAGGCACATGAAGCTGTTCACGG + Intronic
1128330446 15:66752153-66752175 GAGGCCTAGGAAGCTTTTCTGGG + Intronic
1130711312 15:86284235-86284257 AAGGCTACTGATGGTTTTCTTGG + Intronic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1131069665 15:89458042-89458064 AACACTTATGAGGCTTTTCTGGG - Intergenic
1131386839 15:92014980-92015002 AAGGCTGATGCATTCTTTCTTGG + Intronic
1131949408 15:97664831-97664853 TAGTCTGCTGAAGCTGTTCTTGG + Intergenic
1132227398 15:100153024-100153046 AAGGCTGATGGACTTTTACTGGG + Intronic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1135497171 16:22962781-22962803 AAGGCTTATGCAGCTCTACTAGG - Intergenic
1137962872 16:52901183-52901205 CAGCCTGGTGATGCTTTTCTAGG - Intergenic
1139953489 16:70682786-70682808 AAGGCTGAGGATGCTGTTCCTGG - Intronic
1140832283 16:78762955-78762977 AAGGCTGGGGAAGATTTTCCTGG + Intronic
1143779857 17:9223726-9223748 AAGGCTCTTGTAGCTTTCCTAGG + Intronic
1144317861 17:14080884-14080906 CAGGGTGATGAAACCTTTCTAGG - Intronic
1148235945 17:45969231-45969253 AAGACTGGAGAGGCTTTTCTGGG + Intronic
1149403256 17:56320722-56320744 AGGACGGATGAAGCTGTTCTTGG + Intronic
1152699427 17:81811769-81811791 GAGGCTGAAGAAGCTCCTCTCGG - Exonic
1153261510 18:3228725-3228747 AAGCCTGAGGAAACTTTTCTGGG - Intergenic
1156687783 18:39670591-39670613 GAAGCAGATGAAGTTTTTCTTGG - Intergenic
1157638352 18:49185206-49185228 AAGAAAGATGAAACTTTTCTTGG - Intronic
1158649065 18:59270789-59270811 TATGCAGATGAATCTTTTCTAGG - Intronic
1159858540 18:73618204-73618226 AAGACTGCTGAAGTTTCTCTGGG - Intergenic
1160099445 18:75906334-75906356 TATGCTGATGAAGCTTGTCGGGG - Intergenic
1162823183 19:13235713-13235735 CAGGTTGATGAAGTTATTCTGGG + Exonic
1165816943 19:38648157-38648179 AAGGCTGATGAAGGATTTGGAGG + Intronic
925668783 2:6290069-6290091 AAGGCTGATACAGCATTTGTAGG - Intergenic
926541743 2:14188901-14188923 AAGGTTGATGAAGCTTACCTAGG - Intergenic
926940999 2:18136827-18136849 AAGGCAGATGTGTCTTTTCTCGG - Intronic
926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG + Intergenic
927442076 2:23126140-23126162 AAGGGTCAAGAACCTTTTCTAGG - Intergenic
928817458 2:35316505-35316527 AAAGCTAATGAAACATTTCTTGG + Intergenic
929575861 2:43051296-43051318 AAGGCCTTTGAAGATTTTCTAGG + Intergenic
930384930 2:50682292-50682314 AAGGTTTATGAAGATTTTCTTGG - Intronic
931276090 2:60745173-60745195 GAGGCTGAGACAGCTTTTCTGGG - Intergenic
931803192 2:65778605-65778627 AAGGCACATCAATCTTTTCTAGG - Intergenic
933936910 2:87213459-87213481 TTGGCTGGGGAAGCTTTTCTTGG + Intergenic
934088306 2:88528986-88529008 AGAGATGATGTAGCTTTTCTTGG - Intronic
935155756 2:100482321-100482343 AAGGGTGATGAAGCTGATCTTGG - Intronic
935221239 2:101015294-101015316 AGGGCTGTGGAAGCTGTTCTGGG + Intronic
936356233 2:111752366-111752388 TTGGCTGGGGAAGCTTTTCTTGG - Intergenic
936455070 2:112666680-112666702 TAGCCTTCTGAAGCTTTTCTGGG - Intergenic
937205239 2:120232170-120232192 AAGGCTGAGAAAGCTTTTCAGGG - Intergenic
937925850 2:127166753-127166775 CAGGCAGAAGCAGCTTTTCTGGG + Intergenic
938623244 2:133079637-133079659 AAGGATGAGGAAGATCTTCTGGG + Intronic
938686773 2:133745870-133745892 AAGCATCAAGAAGCTTTTCTTGG + Intergenic
939671910 2:145023122-145023144 TAGGCTGATGAATATTTTCCTGG + Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940636098 2:156298881-156298903 AAGGCTGATGAAGCTAGTCTGGG + Intergenic
942229111 2:173843128-173843150 AAGGCTGTGTAAACTTTTCTGGG + Intergenic
942362397 2:175185620-175185642 AAGGCTGGTGAAACTTTTGCAGG - Intergenic
942523758 2:176831274-176831296 TAGGCTGATGCAGCATTTGTTGG + Intergenic
945823395 2:214691586-214691608 AAGGCAGATGGAGTTTTTTTGGG - Intergenic
946108716 2:217395164-217395186 AAGGCTGATGTCACTTCTCTAGG + Intronic
946747160 2:222857870-222857892 AAGTCTGATGAAGCTGTACAAGG + Intergenic
947444832 2:230155874-230155896 AAGGATGATGAATCTCTCCTGGG + Intergenic
948740230 2:240041729-240041751 TGAGCTGAAGAAGCTTTTCTTGG + Intergenic
1171048880 20:21837276-21837298 AAGGCTGAGAAATTTTTTCTAGG - Intergenic
1171520018 20:25768667-25768689 AAGGCTGAGGAAGGTTTTAGAGG - Intronic
1171556901 20:26087826-26087848 AAGGCTGAGGAAGGTTTTAGAGG + Intergenic
1171795209 20:29561175-29561197 AAGCCTGTTGATTCTTTTCTGGG + Intergenic
1172847602 20:37939107-37939129 AAGAGTGATGAAGCTTGGCTGGG + Intronic
1174362848 20:50039375-50039397 AAGAATGATGAACCCTTTCTGGG - Intergenic
1174868015 20:54156610-54156632 AAGTCTGATGAGGCTCTTCCAGG - Intronic
1175353249 20:58341409-58341431 GAGGCTGTTGGGGCTTTTCTGGG + Intronic
1178565319 21:33678633-33678655 AAGCCTGAAGATGATTTTCTTGG + Intronic
1179968359 21:44819245-44819267 AAGGCTGCTGAAGTCTTTCGGGG + Intergenic
1183337759 22:37260427-37260449 AATACAGATGAAGCTTCTCTGGG + Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
952079310 3:29738782-29738804 AAGGCTAATGTTGCATTTCTGGG + Intronic
955122691 3:56076705-56076727 ATCTCTGATGAAGCTTTTGTGGG - Intronic
955159772 3:56453323-56453345 CAGGCTGAAGGAGCCTTTCTTGG - Intronic
955204612 3:56884563-56884585 ATGGCTGATTAAGCATTCCTGGG - Intronic
956013433 3:64856092-64856114 AAGGCTCATTAATCTTTTCTTGG - Intergenic
956019574 3:64919820-64919842 AAGGGGGAAGAAGCTTTTATAGG - Intergenic
956056914 3:65309298-65309320 AAGACTGAAGCATCTTTTCTTGG + Intergenic
956246114 3:67185550-67185572 ATGGCTGAAAAAGCTGTTCTGGG + Intergenic
958896086 3:99831083-99831105 GAGCCTTATGAATCTTTTCTAGG + Intronic
959461467 3:106630919-106630941 AAGGCAGATGAAGGAATTCTTGG + Intergenic
961623910 3:128245947-128245969 AATGCCCATGAAGCATTTCTCGG - Intronic
964623332 3:158736267-158736289 AAGGCTCCTGCAGCTCTTCTGGG - Intronic
965011141 3:163093602-163093624 AAGGGTGATGAATGTTTTCTAGG - Intergenic
966545066 3:181137505-181137527 AAGCCTGATGAACCTAATCTTGG + Intergenic
967681817 3:192372501-192372523 AAGGCTGATGGATGTGTTCTTGG - Intronic
969110250 4:4839916-4839938 AAGGCTGATGATGCTGGTTTGGG + Intergenic
969610625 4:8225859-8225881 AAGGCTGTTGTAGGTTTTCCTGG + Intronic
969614585 4:8244887-8244909 AAGGCTGATGTAGACTTGCTGGG - Intergenic
970894492 4:21086569-21086591 AAGGTTAATGAAGCATTTCCTGG + Intronic
972323024 4:37990283-37990305 AAAGTTGATGAATCTTTTTTGGG - Intronic
972565477 4:40265360-40265382 CAGGGTGATGAGGCTTTGCTGGG - Intergenic
972794705 4:42403898-42403920 AAGGATGATCAAACTTTGCTGGG - Intergenic
973745423 4:53959119-53959141 AAGGATAATGAAGCTTTACCAGG - Intronic
976049662 4:80996724-80996746 CAGGCTTCAGAAGCTTTTCTGGG - Intergenic
976948674 4:90801204-90801226 GAGGCTGATGAACACTTTCTTGG + Intronic
977746921 4:100559829-100559851 AAGGCTGGGGAAGATTTCCTTGG - Intronic
979778394 4:124618654-124618676 ATGGCTGATGAAGCACCTCTTGG + Intergenic
980098414 4:128517263-128517285 AAGGCTGATGAGGCAATTCATGG - Intergenic
980824924 4:138061756-138061778 GAGGCTGATGACTCTCTTCTCGG + Intergenic
981305937 4:143247127-143247149 AATACTGATGATGCTTTGCTAGG - Intergenic
983107548 4:163708059-163708081 CAGGGTGAAGAAGCATTTCTAGG - Intronic
985002535 4:185500253-185500275 AATACAGATGAAGCTTTGCTCGG + Intergenic
987356894 5:17071518-17071540 AAGGCTAATGTAGCACTTCTTGG - Intronic
987767128 5:22247316-22247338 AAGCATGATGAAGCTTTACTAGG - Intronic
988034965 5:25815626-25815648 ATGGCTGGTGAAACATTTCTAGG - Intergenic
989223815 5:39002105-39002127 CATTCTGTTGAAGCTTTTCTGGG - Intronic
989780680 5:45261970-45261992 AAGACTGAGGAAGATTCTCTTGG + Exonic
994292614 5:98046974-98046996 ATGGCTGATGAAATGTTTCTTGG - Intergenic
994575862 5:101578739-101578761 AAGGCTGAAGTAGTATTTCTGGG + Intergenic
995235847 5:109829365-109829387 AACTCTGATGAAACTTTCCTGGG + Intronic
995337010 5:111011273-111011295 GAGGCTGAAGAAGCTGGTCTTGG - Intergenic
995466706 5:112457151-112457173 AAGGCTGAGGAAAGTTTCCTTGG + Intergenic
996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG + Intergenic
996831293 5:127743303-127743325 AAGGTTGGTGAAGCATTTCCTGG - Intergenic
997035648 5:130188403-130188425 AATGCTGATGAAATTATTCTTGG - Intergenic
997285740 5:132676991-132677013 CTGGCTGATGAAGGGTTTCTTGG + Intronic
999615224 5:153416134-153416156 AAGGCTGATCAACATTTTCTTGG - Intergenic
1001503887 5:172261344-172261366 AAGATTAATAAAGCTTTTCTAGG - Intronic
1003164348 6:3663329-3663351 AAGGCAGTTTGAGCTTTTCTGGG - Intergenic
1004776840 6:18857135-18857157 AAGTCTCAGGATGCTTTTCTTGG + Intergenic
1004897124 6:20159233-20159255 AATACAGATGAAGCTTCTCTCGG - Intronic
1009360147 6:62801741-62801763 AAGGCTAAGGAAGCGTTTCATGG + Intergenic
1010980892 6:82367240-82367262 AAGGCTAATGAAGTTATTGTTGG + Exonic
1011957342 6:93039301-93039323 AAGTTTGATGAAGTTATTCTTGG + Intergenic
1012548537 6:100447923-100447945 TAGGCGGAAGAAGCATTTCTGGG - Intronic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1016747727 6:147598922-147598944 AAGGCTGAGGATGTTCTTCTGGG + Intronic
1017796521 6:157849803-157849825 AATGCTGATGAGGCCTTGCTTGG + Intronic
1019986451 7:4659805-4659827 AAGGGTGAAGAAGTTTTGCTGGG - Intergenic
1022526372 7:31040266-31040288 AAGACTAATCAAGCTTTCCTTGG + Intergenic
1023148460 7:37176238-37176260 GATTCTGAGGAAGCTTTTCTAGG - Intronic
1023683002 7:42706884-42706906 AAGTCTGTTGGAGATTTTCTGGG + Intergenic
1025772924 7:64529735-64529757 AAGGCTGAGGAAGCTTTTCTCGG - Intronic
1026931013 7:74223008-74223030 CAGGCTGAGGATGCTTTGCTCGG - Intronic
1027701553 7:81476213-81476235 AAGGGTGAGGACCCTTTTCTGGG + Intergenic
1028663908 7:93317667-93317689 AATGTTGATGCAGCTTGTCTAGG + Intronic
1033671011 7:143493115-143493137 AAGGGAGATGACTCTTTTCTTGG - Intergenic
1034068621 7:148161021-148161043 AAAGCTGATGAACATTTTCGTGG - Intronic
1041868664 8:62607391-62607413 AAGGCTGATGCACCTTCTCTTGG + Intronic
1043953303 8:86333824-86333846 AAGACTGGTGAAGCTTTTCCAGG + Intergenic
1045309077 8:100984928-100984950 AAGGCTGAAAAAGCTTTTTGCGG - Intergenic
1045723853 8:105147172-105147194 AAGGCTGTGGAAGATTTTCCAGG - Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1052936040 9:34093934-34093956 AAGGCTGATGTGGGTTATCTGGG - Intronic
1055329118 9:75163649-75163671 AAGGCTGTTGAAATTTTTATAGG + Intergenic
1055665626 9:78550008-78550030 AAGGCTGATGCAGGTCTCCTGGG - Intergenic
1055901413 9:81242690-81242712 AAGGCTGTTGAAACTTTTTTTGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056224533 9:84482401-84482423 AAGGTTAATGATGCTTTTCAGGG - Intergenic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056689814 9:88798593-88798615 AAGGCAGATGAAGCTTCCCCTGG + Intergenic
1056802368 9:89701519-89701541 AAGGCTGAAGGAGCCTTTCTTGG + Intergenic
1057297816 9:93859704-93859726 AAGGGTGGCCAAGCTTTTCTGGG - Intergenic
1057588317 9:96349116-96349138 GATGCTGAAGAGGCTTTTCTTGG + Intronic
1058347267 9:103979220-103979242 AAGGCTGAAGAAGGTATTTTGGG - Intergenic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1060692155 9:125672442-125672464 AAGGAGGATGAATCTTCTCTAGG + Exonic
1061669923 9:132182901-132182923 GAGGCTGCTGAAGCTGGTCTGGG - Intronic
1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG + Intronic
1188993672 X:36855351-36855373 AATGCTAATGTAGCTTTTCAAGG + Intergenic
1192028472 X:67482797-67482819 AAGTCTGATGGAGATTTACTAGG - Intergenic
1197436101 X:126430315-126430337 AAGCATGATGAAGCTTGTTTGGG + Intergenic
1202114759 Y:21460990-21461012 AAGGAAAATGAAGCTTTTTTTGG + Intergenic