ID: 917394808

View in Genome Browser
Species Human (GRCh38)
Location 1:174581940-174581962
Sequence TGCCATTACCACAGTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917394803_917394808 14 Left 917394803 1:174581903-174581925 CCTAGATTTCTGGCTAGCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917394808 Original CRISPR TGCCATTACCACAGTGGGGT AGG Intronic
901080712 1:6582335-6582357 TGCCATTCCCACGTTGGGGGAGG + Intronic
901096114 1:6681691-6681713 TGCTTTAACCACAGTGGGGGGGG + Intronic
902073399 1:13762360-13762382 TGCCACCACCACACTGGGGAAGG + Intronic
902809976 1:18882487-18882509 TGCCATTATCGGAGTGAGGTTGG - Intronic
903760242 1:25692713-25692735 CGCCAAGAACACAGTGGGGTAGG + Intronic
904786583 1:32987533-32987555 TGCCATTGCCTCAGTGGGGCAGG - Intergenic
904808889 1:33150707-33150729 GGCAATTCCCACAGTGGGGTCGG + Intronic
904881531 1:33701140-33701162 GGCTACTGCCACAGTGGGGTGGG - Intronic
906798435 1:48715674-48715696 TGCCTTTAACACAGTGGGGAGGG + Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912760112 1:112359250-112359272 TTTCCTTCCCACAGTGGGGTAGG - Intergenic
915573104 1:156756434-156756456 TGGCAATACCACAGTGGGTGAGG + Intronic
917394808 1:174581940-174581962 TGCCATTACCACAGTGGGGTAGG + Intronic
919411258 1:197246003-197246025 TGACACTACCATAGTGGGGAGGG + Intergenic
921963576 1:221062914-221062936 TTCCATTGCCACATTGGGGTGGG - Intergenic
1063135494 10:3213155-3213177 TGGCCTTACCTCAGTGGGGTGGG - Intergenic
1066166091 10:32789721-32789743 TGCTATTATCACAGAGGAGTAGG + Intronic
1068267556 10:54672859-54672881 TGCCATTACCATAGCTTGGTAGG + Intronic
1068407246 10:56605585-56605607 TGTCACTTCCACGGTGGGGTGGG - Intergenic
1069484462 10:68812666-68812688 TGACACTACCTCAGTGGGGACGG + Intergenic
1069947777 10:71999551-71999573 GGCCAAGAGCACAGTGGGGTGGG - Intronic
1072301953 10:94070418-94070440 AGCCATTAGCAGAGAGGGGTGGG - Intronic
1074675915 10:115850916-115850938 TGTCCTTCACACAGTGGGGTTGG - Intronic
1078730666 11:13971167-13971189 TGCCAGTGCCACAGGGGCGTTGG + Intronic
1079576454 11:22009246-22009268 TTCCAATATCCCAGTGGGGTAGG - Intergenic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1087832080 11:102830166-102830188 TGGCATGACCACATTGGGGCTGG - Intergenic
1088505872 11:110526442-110526464 TGCCCTTTCCACTGTGGTGTTGG + Intergenic
1088577411 11:111285277-111285299 TGCCATTTACACAGTGGGGAAGG - Intronic
1090720432 11:129467455-129467477 TGGCTTTACCACACTGTGGTGGG - Intergenic
1090882213 11:130843495-130843517 TGCCTTTACCAGTGTTGGGTAGG - Intergenic
1093851621 12:24046209-24046231 GACTATAACCACAGTGGGGTGGG + Intergenic
1096979136 12:55718407-55718429 TACCATTACTACCATGGGGTTGG - Intronic
1099149863 12:79096841-79096863 TGCCATATTCACAGTGAGGTGGG + Intronic
1104031700 12:125069447-125069469 TGCCATAACCACAGGTTGGTTGG + Intronic
1109157619 13:58930377-58930399 GGCCATTACCACAGTGTAATAGG + Intergenic
1109989969 13:70041689-70041711 TGACACTACCCCAGTGGAGTGGG + Intronic
1112647055 13:101346007-101346029 ACCAATTACCACAGTTGGGTGGG - Intronic
1113701263 13:112390329-112390351 AGCCAGTGCCACAGTGGGGCAGG + Intronic
1117077432 14:52118410-52118432 TGCCAGTACCACGGTGGTCTGGG - Intergenic
1122267676 14:100554249-100554271 TGACGTCACGACAGTGGGGTGGG + Intronic
1125892929 15:43279552-43279574 GTCCATGAACACAGTGGGGTGGG - Intronic
1135296388 16:21283177-21283199 TGCCACTACCACAGTGAAGATGG + Intronic
1135485590 16:22862036-22862058 TCACATTACCACAGTTGGGGTGG - Intronic
1136285610 16:29238820-29238842 TGTGTTTTCCACAGTGGGGTGGG - Intergenic
1137845627 16:51684980-51685002 TGAAATTACCCCAGTGTGGTGGG + Intergenic
1141513455 16:84527214-84527236 TGTCATCTCCACAGTGGGATTGG - Intronic
1142090943 16:88208996-88209018 TGTGGTTTCCACAGTGGGGTGGG - Intergenic
1142121838 16:88390329-88390351 TGCCCTGACCTCGGTGGGGTTGG - Intergenic
1143916588 17:10298098-10298120 TGCCTTTGACACAGTGGGGTTGG - Exonic
1144637295 17:16918375-16918397 TGGCTTTGCCACAGTAGGGTGGG + Intergenic
1150160465 17:62893850-62893872 TGCCATTGCCAGAGTGGACTGGG - Intergenic
1151036853 17:70810626-70810648 TTCCCTTTCAACAGTGGGGTGGG + Intergenic
1158890907 18:61870969-61870991 TGCCATTATCAGGATGGGGTCGG - Intronic
1160721672 19:600007-600029 TGCCATTAACACTGGGGGCTAGG - Intronic
1161501490 19:4618456-4618478 TGCCAGATCCACAGTGGCGTGGG - Intergenic
1163534475 19:17869281-17869303 GGCCATCACCACCCTGGGGTGGG + Intergenic
1165034500 19:33022988-33023010 TGTCATTGCCACATTGGGGCTGG - Intronic
1167309840 19:48730638-48730660 AGCCTTTACCATGGTGGGGTGGG - Intronic
1167802289 19:51752033-51752055 TGGCATTAGGACAGTGGGCTGGG + Intronic
925744651 2:7033708-7033730 GGCTATGACCAGAGTGGGGTGGG - Intronic
928108893 2:28490588-28490610 TGCCACTGCCACGGTGGGGAAGG + Intronic
932038835 2:68277098-68277120 TGCGTTTACCACAGGGGTGTTGG - Intergenic
932825975 2:74940555-74940577 TGCTATTACCTCAGGGGGATGGG - Intergenic
937761775 2:125613065-125613087 TGCTTTAAACACAGTGGGGTGGG - Intergenic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1173691313 20:44963298-44963320 TGTCATTACCACTGTGGAGGGGG - Intergenic
1174202123 20:48814056-48814078 TGCCCTTACCACACTGGGGAGGG - Intronic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1175564009 20:59958528-59958550 TGCATTTATCAGAGTGGGGTGGG - Exonic
1181972578 22:26703247-26703269 TGTCACTACCACAGTGGGACTGG - Intergenic
1183668230 22:39257230-39257252 CTCCATTACCCCAGTGGGGTAGG - Intergenic
1184197429 22:42939550-42939572 TCCCATTCCCTCTGTGGGGTTGG - Intronic
959803103 3:110519213-110519235 AACCATTCCCACATTGGGGTAGG + Intergenic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG + Intronic
963266948 3:143249375-143249397 TGATAGCACCACAGTGGGGTTGG - Intergenic
964217664 3:154305310-154305332 TCCCATTACCCCATTGTGGTAGG - Intronic
966912283 3:184566235-184566257 TGGCAGGGCCACAGTGGGGTGGG + Intronic
968518875 4:1026785-1026807 GGCCACCACGACAGTGGGGTGGG - Exonic
968963299 4:3756629-3756651 TGGCATCACAACAGTGGGATGGG - Intergenic
970113778 4:12669846-12669868 TGCCATAACCACAGTGCAGTTGG + Intergenic
976619664 4:87114987-87115009 TGCCGCTGCCACTGTGGGGTGGG - Exonic
981099218 4:140811925-140811947 TGCCATCTCCACAGCGAGGTTGG + Intergenic
982756088 4:159220350-159220372 TGAAATTCCCACAGTGGGGTGGG + Intronic
986282176 5:6332649-6332671 TGCCATTATCAAAGAGGGGAAGG - Intergenic
993094870 5:83470749-83470771 TGCTGTTTACACAGTGGGGTGGG + Intergenic
994604451 5:101949404-101949426 TGCCATTTTCAGAGTTGGGTAGG + Intergenic
998737704 5:145161516-145161538 CGCCATGAGCACAGTGGGTTGGG - Intergenic
1001307514 5:170586103-170586125 TCACATGACCACTGTGGGGTGGG - Intronic
1002971160 6:2021731-2021753 AGTCATTTCCACAGTTGGGTGGG - Intronic
1003972504 6:11312758-11312780 GGCCAATAACCCAGTGGGGTGGG + Intronic
1008046738 6:46858998-46859020 TGCCAACAACACAGGGGGGTGGG - Exonic
1008876285 6:56332619-56332641 TTCCATTAGCAGAGTAGGGTCGG + Intronic
1012606421 6:101163399-101163421 TCTCATTATCACAGTGGGGCTGG + Intergenic
1016499968 6:144708996-144709018 TGTCATTATCACAGTGGGAGTGG - Intronic
1017252971 6:152301866-152301888 TACCATGACCACAGAGGGGTGGG + Exonic
1018394757 6:163369806-163369828 TGCCACTGCCACACAGGGGTAGG - Intergenic
1018673470 6:166198565-166198587 TTCCAATACCACACTGGGCTGGG - Intergenic
1018963152 6:168463048-168463070 TCCCATTCCCACAGGGGAGTTGG + Intronic
1022492229 7:30829946-30829968 AGCCATTAGCAAAGAGGGGTCGG - Intronic
1023992173 7:45134824-45134846 TGCCAGTATCACACTGGGATTGG + Intergenic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1032128542 7:129211622-129211644 TTCCATTCCCACAGCGGGCTTGG + Exonic
1034405836 7:150901918-150901940 TGCCATGATGACAGCGGGGTGGG + Intergenic
1039328934 8:36515091-36515113 TGTCCTTACAAGAGTGGGGTAGG + Intergenic
1040581694 8:48703848-48703870 TGCCATCACCACAGTTTGCTAGG - Intergenic
1040955278 8:52973793-52973815 TGCCATCACCAGTGTGGGATGGG + Intergenic
1045690695 8:104757195-104757217 TGGCATTTCCACTGTGGTGTGGG - Intronic
1047180094 8:122579211-122579233 TGCCAGAACCAAAGTGCGGTAGG - Intergenic
1047957527 8:129986855-129986877 TGCCATTACCAGAAGGGGCTTGG - Intronic
1048220347 8:132535201-132535223 TGCCATGACAAGGGTGGGGTGGG - Intergenic
1049283412 8:141762047-141762069 TGCCTTTACCACATCGGGGAAGG - Intergenic
1049637901 8:143699054-143699076 TGTCCTTTCCACAGAGGGGTCGG + Intronic
1056145764 9:83727677-83727699 GGGCATTCCCACAGTGGAGTGGG + Intergenic
1062026695 9:134343916-134343938 TGGCCCTACCACAGTGGGGTGGG + Intronic
1062145586 9:134988015-134988037 TGCCATTCCCAGGGTGGGGAAGG - Intergenic
1062179046 9:135180806-135180828 TGCCCTTCCCACTGTGGGGCTGG + Intergenic
1187106435 X:16247728-16247750 TGCCATTAAAACTGTAGGGTGGG + Intergenic
1189346312 X:40244087-40244109 CGCCACTACCACAGCGGAGTAGG + Intergenic
1190143093 X:47865283-47865305 TGACATTCCCACTTTGGGGTCGG - Intronic
1192341433 X:70266955-70266977 TGCAGGTACCACAGTGGGATAGG - Intergenic
1198540076 X:137628759-137628781 TGCAATTACCAAGGTGGGATTGG - Intergenic