ID: 917397037

View in Genome Browser
Species Human (GRCh38)
Location 1:174604346-174604368
Sequence AGGGAGAGGACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 28, 2: 89, 3: 206, 4: 501}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917397037_917397045 27 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397045 1:174604396-174604418 TGCCATGCAGCTAATGCTAGGGG 0: 1
1: 1
2: 2
3: 23
4: 128
917397037_917397044 26 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397044 1:174604395-174604417 GTGCCATGCAGCTAATGCTAGGG 0: 1
1: 1
2: 4
3: 15
4: 114
917397037_917397043 25 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397043 1:174604394-174604416 TGTGCCATGCAGCTAATGCTAGG 0: 1
1: 1
2: 2
3: 26
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917397037 Original CRISPR AGGGAGAGGACAGTGATTGT GGG (reversed) Intronic