ID: 917397037

View in Genome Browser
Species Human (GRCh38)
Location 1:174604346-174604368
Sequence AGGGAGAGGACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 28, 2: 89, 3: 206, 4: 501}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917397037_917397043 25 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397043 1:174604394-174604416 TGTGCCATGCAGCTAATGCTAGG 0: 1
1: 1
2: 2
3: 26
4: 164
917397037_917397045 27 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397045 1:174604396-174604418 TGCCATGCAGCTAATGCTAGGGG 0: 1
1: 1
2: 2
3: 23
4: 128
917397037_917397044 26 Left 917397037 1:174604346-174604368 CCCACAATCACTGTCCTCTCCCT 0: 1
1: 28
2: 89
3: 206
4: 501
Right 917397044 1:174604395-174604417 GTGCCATGCAGCTAATGCTAGGG 0: 1
1: 1
2: 4
3: 15
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917397037 Original CRISPR AGGGAGAGGACAGTGATTGT GGG (reversed) Intronic
900537929 1:3187953-3187975 AGGCAGAGGACAGTGTGTGTGGG + Intronic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
901223521 1:7597588-7597610 AGAGAGAGGAGCATGATTGTGGG + Intronic
901423912 1:9169089-9169111 AGAGAGAGGACAGCGCTTGGTGG - Intergenic
901751447 1:11412460-11412482 GGGGAGGGGGCAGTGAGTGTGGG + Intergenic
902435053 1:16393133-16393155 AGGGAGAGGAAAGTGATGAGAGG + Intronic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
903316883 1:22515042-22515064 AGTGAGAGGACAGGGCTTGGGGG + Intronic
903335027 1:22618979-22619001 AGCGGGAGGACAGAGATGGTGGG - Intergenic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
903778921 1:25809582-25809604 AGGGAGAGGAGGCTGAGTGTGGG - Intronic
903900405 1:26640598-26640620 AGCGAGATGCCAGTGGTTGTGGG - Intergenic
903901265 1:26647440-26647462 AGCGAGATGCCAGTGGTTGTGGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904604824 1:31692561-31692583 AGGGATAGGGCAGGGATGGTGGG - Intronic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905227005 1:36485639-36485661 AGGGAGAGGAGAAGGATTGCAGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906108163 1:43307001-43307023 AGGCAGAGGGCAGAGGTTGTGGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907406816 1:54258771-54258793 AGTGAGGGGACAGTGAGTGAGGG + Intronic
907525644 1:55052524-55052546 AGGGAGGGGACAGTGACAGCTGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909299221 1:73989992-73990014 AGGGAGTGAAAATTGATTGTTGG - Intergenic
909472124 1:76040626-76040648 AGGGAGAGGACTGTGCTTACTGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911046297 1:93631509-93631531 TGGCAGAGGACAGTGACTATTGG + Intronic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911678920 1:100691832-100691854 TGGGTGAGGCCAGTGACTGTTGG - Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
912969024 1:114262985-114263007 AGGAAGAGGAAAGTCATTGCAGG + Intergenic
913498596 1:119450268-119450290 GGGGATAGGACAGGGATTGGTGG - Intergenic
913507449 1:119530678-119530700 AGGTAGAGGACAAAGATTTTAGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915087440 1:153397992-153398014 AGTGAGGGGGAAGTGATTGTTGG - Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917970978 1:180207517-180207539 AGAGAGAGGACAGAGAATATAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920071132 1:203304180-203304202 AGGGAGAGGACAGAGCCGGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920872231 1:209804704-209804726 TGGGAGAGGACAGTTATGCTCGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922531565 1:226349134-226349156 TGGGAGAGGACAGTGCTTTGTGG + Intergenic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923918051 1:238530566-238530588 AGGGAGAGGCCAGGGAGTGAGGG + Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062929890 10:1345683-1345705 AGGGACAGGACAAGAATTGTAGG + Intronic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1064717279 10:18189879-18189901 AGGCAAAGAAAAGTGATTGTTGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065916573 10:30358445-30358467 TGGGAGAGGCCAGTGTGTGTAGG + Intronic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066253172 10:33653833-33653855 AGGGACAGGAAAGGGATTTTTGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067052020 10:43026991-43027013 AGGGAGAGGAGCGAGATTGGTGG - Intergenic
1067263193 10:44712641-44712663 TGGGACAGGAAAGAGATTGTTGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068031614 10:51711712-51711734 AGGAAGCTGTCAGTGATTGTGGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069006221 10:63320466-63320488 ATGGGGCTGACAGTGATTGTGGG - Intronic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070220800 10:74442150-74442172 AGGGAGAGGAAAGTGGGGGTGGG - Intronic
1071280297 10:84095448-84095470 AGGTTGAGGTCAGTGATAGTTGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071757148 10:88555814-88555836 AGGGAGATGCCAGTGAGTGAGGG - Intronic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075643196 10:124080044-124080066 AGTGAGAGGACAGGGATGTTGGG + Intronic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076193998 10:128502306-128502328 TGAGAGGAGACAGTGATTGTAGG - Intergenic
1076363468 10:129906545-129906567 AGGGAGAGGACAGTCCCTATGGG + Intronic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1076806689 10:132862422-132862444 AGGGAGAGGACAGGGTGGGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080115530 11:28617591-28617613 AGGAAGAGGAAAGCCATTGTAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081282497 11:41226975-41226997 AAGCAGAGGACTGTGGTTGTGGG - Intronic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1082631442 11:55546858-55546880 AGGAGGAAGAAAGTGATTGTTGG + Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1085026245 11:73238229-73238251 AGGGACAGGACAGGGATGGGAGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085862893 11:80255437-80255459 AGGAAGAGGACAGGCATTCTGGG - Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089618659 11:119709673-119709695 TGGGAGAGGAGAGTGATGCTCGG + Intronic
1089682859 11:120129159-120129181 AGGAAGAGGACACAGACTGTTGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1093699031 12:22196915-22196937 TGGGAGAGGACAGAGACTGACGG + Exonic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097216781 12:57420252-57420274 AGAGAGAGGACAGTAATTAGAGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1097981351 12:65741032-65741054 AGGGAGAGGACTGGGAATGTTGG - Intergenic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1102574606 12:113848433-113848455 AGTGTGAGGACAGTGATTTGAGG + Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1103221623 12:119251145-119251167 AGGGAGAGGAAGGTGTTGGTGGG - Intergenic
1106486793 13:30179542-30179564 AGGGAGGGGTCAGTGCTTGCTGG - Intergenic
1106920949 13:34562479-34562501 AGGGATAGGACAGTTCTTGCTGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1108961281 13:56234293-56234315 AGAGGAAGGACAGTGATTGAAGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110538601 13:76681888-76681910 AGGGAGTGGGCAGTGGGTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113571010 13:111357818-111357840 AGGGAGAGGACCAGGTTTGTGGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114656249 14:24317306-24317328 ATGGAGAGGACAAAGATTATTGG - Exonic
1114740872 14:25095949-25095971 AGGAAGAGGAGAGTGTGTGTGGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115467161 14:33728124-33728146 AGGGAGAAGAGAGTGTTTGCTGG - Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116015439 14:39401755-39401777 AGAGAGATGACAGTGATGTTGGG + Exonic
1116019217 14:39441120-39441142 AGGGAGAGGCCAGGGAGAGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117733338 14:58745757-58745779 ATGGAGAGGACAGAGCTGGTGGG + Intergenic
1117912774 14:60650101-60650123 GGGGGGAGGACAGTGGTAGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118806308 14:69240155-69240177 AGGGAGAGGAGAGTGTGTGTGGG + Intronic
1119475569 14:74925441-74925463 AGGGAGGGGACAGTGTGTATGGG + Intergenic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1120143120 14:80950693-80950715 AGGGAGAGGAAAGTGATAAGGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120724336 14:87921018-87921040 AGGGAGAGGAAAATGGATGTTGG - Intronic
1120860967 14:89254690-89254712 AGGCAGAGGACACAGATTGATGG - Intronic
1121165054 14:91787100-91787122 AGGGAGAGAAAAGTGTTTCTAGG + Intronic
1121197507 14:92087083-92087105 AGGGAGAGGAAAGTGCTTAAAGG + Intronic
1121509069 14:94498941-94498963 AAGGAGAGGAGAGTGATAGAGGG + Intronic
1122753544 14:103958380-103958402 AGGGAGTAGACAGTGGGTGTGGG + Intronic
1123157010 14:106236824-106236846 AGGGAGAGGCAAGTTCTTGTAGG + Intergenic
1124439802 15:29677733-29677755 AGGGAGAGGAGACTGCTTCTGGG + Intergenic
1124820015 15:33035560-33035582 AGGGAGAGGTAAGGGAATGTAGG - Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1125920124 15:43520419-43520441 AAGGAGAGGACAGCCAGTGTGGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128248898 15:66151401-66151423 AGGGAGAGAACCCTGAGTGTGGG + Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129210417 15:74064904-74064926 TGGGAGAGGCCAGTGTGTGTGGG + Intergenic
1129403597 15:75300469-75300491 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130485467 15:84396031-84396053 TGGGAGAGGCCAGTGTGTGTGGG - Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132148268 15:99441469-99441491 AGGAGAAGGAAAGTGATTGTGGG - Intergenic
1132203307 15:99969782-99969804 GGGGGGAGGTCAGTGATGGTGGG + Intergenic
1132589079 16:718519-718541 AGAGAAAGGACCGTGTTTGTGGG - Exonic
1132950569 16:2560012-2560034 GGGGAAAGGACAGTGATAGGAGG + Intronic
1132963780 16:2640158-2640180 GGGGAAAGGACAGTGATAGGAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134090677 16:11390209-11390231 AGGGAGGGGACAGTGAGAGCTGG + Intronic
1134249791 16:12566300-12566322 AGGGAGAGGACATAGCTTGGAGG - Intronic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1136591282 16:31219262-31219284 AGGGATGGGGCAGTGATTGAAGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139286744 16:65821992-65822014 AGGGAAAGGACTGTGAGTTTAGG + Intergenic
1139662566 16:68431086-68431108 AGTGGGAGGACAGGGATTGAGGG + Intronic
1141180806 16:81752362-81752384 AGGGAGGGGACTGTGAGGGTTGG + Intronic
1141742646 16:85904256-85904278 GGGGAGGGGAGAGTGAGTGTGGG + Intronic
1142189748 16:88712446-88712468 AGGGAGAGGCCAGTGAGGCTGGG - Intronic
1142714470 17:1740231-1740253 AGGCACAGGACAGTGAGGGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145296669 17:21598407-21598429 AGTGAGGGGACAGTGGCTGTTGG - Intergenic
1145367110 17:22273671-22273693 AGTGAGGGGACAGTGGCTGTTGG + Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146260537 17:31417418-31417440 GGGGAAAGGACAGTGCCTGTGGG - Intronic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149427681 17:56570514-56570536 AGGGAGAGGCCAGTGTTCGGAGG + Intergenic
1150239191 17:63618617-63618639 AGCTAGAGGACAGTGATGGAGGG + Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150575276 17:66425277-66425299 AGGGAGAGGTCTGTGGATGTTGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1152512780 17:80801809-80801831 AGGGGGAGGTGAGTGATTGGCGG + Intronic
1152643255 17:81457843-81457865 AGGGGGAGGGCAGGGGTTGTTGG + Intronic
1153201193 18:2649414-2649436 AGGGCAAGGAAAGTGATTTTGGG - Intergenic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156966747 18:43103729-43103751 AGGTAGATGACAGTGATGGAAGG + Intronic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158592892 18:58792256-58792278 AGGGAGAGGACAATGATTCCGGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159890477 18:73948586-73948608 AGGGAGAGGTCTGGGCTTGTTGG + Intergenic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1163113974 19:15178329-15178351 AGGGTGAGGATGGTGATTGGGGG - Intronic
1163763701 19:19150778-19150800 AGGGAGAGGACAGAGTGAGTGGG + Intronic
1164623529 19:29712080-29712102 AGGGAGAGGACTGTGCTTACTGG - Intronic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
1167430353 19:49450721-49450743 AGGGAGAGGACAGAGAGAGGAGG - Intronic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925338138 2:3113851-3113873 AGCAAGAGAACAGTGGTTGTGGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926374836 2:12216228-12216250 AGGGAGAGGATAATGCTTATTGG + Intergenic
926439103 2:12869184-12869206 ATGGAGAGGACAAAGTTTGTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927442113 2:23126376-23126398 GGGAAGAGGACTGTGAGTGTGGG - Intergenic
927615503 2:24589609-24589631 AGGGAGAGGAAAGAGGTTGGTGG + Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928342661 2:30458629-30458651 TGGGAGTGGAGAGTGATGGTGGG + Intronic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929486771 2:42361578-42361600 GGGGAGAGGGCGGTGATTGGTGG + Exonic
929506946 2:42535698-42535720 AGGAAGAGGAGAATGAATGTTGG + Intronic
929531228 2:42754324-42754346 AGTGAGAGAACTGTGTTTGTGGG + Exonic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932449164 2:71798697-71798719 AGGGAGAGGACAGTGGGCCTTGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933207277 2:79521642-79521664 AGGAAGAGGTAAATGATTGTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
937296054 2:120810522-120810544 AGGGAGAGGAGAGAGGCTGTTGG - Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942499829 2:176577904-176577926 AGGAAGATGACAGTGATTCCTGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944365453 2:198913738-198913760 AGGGAGATGACAGTGGGTGATGG + Intergenic
944375918 2:199042048-199042070 ATGGAGGGGAGAGTGAATGTAGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948402613 2:237694525-237694547 AGGCACAGGAAAGTGGTTGTGGG + Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1168941732 20:1718635-1718657 AGGGAGGTGGCAGTCATTGTTGG - Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173521788 20:43705377-43705399 AGGGAGAGGACGGCGAAGGTTGG - Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174845689 20:53941004-53941026 AGGGAAAGGACACAGATTCTTGG + Intronic
1175483249 20:59326546-59326568 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175483314 20:59326811-59326833 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178732843 21:35120613-35120635 AGGGTGAGGCCTGTGATTGCTGG + Intronic
1178748205 21:35274160-35274182 AGGGAGAGGCCATTGCTTGCAGG - Intronic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1179536311 21:42055122-42055144 AGGCAGAGGAAAGTGTTTGGAGG - Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181751685 22:24993259-24993281 AGGGTGAGGAAGGTGATTCTGGG + Intronic
1184385426 22:44171588-44171610 GGGGAGAGGACGGTTACTGTGGG + Intronic
1184990825 22:48168749-48168771 ATGGAGAGGACAGTGTTCCTTGG + Intergenic
1185034360 22:48463840-48463862 AGGGAGAGGACAGCTGTTGGTGG - Intergenic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952249967 3:31643644-31643666 AGGGAGAGGACAGAGAAATTAGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954568747 3:51622816-51622838 GGGGACAGGAAAGTGGTTGTTGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955688150 3:61564552-61564574 AGGGAAAGGACAGTGGTGGGAGG + Intronic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956953569 3:74310976-74310998 GGAGAGAGGACAGTGAGTTTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
957977087 3:87460578-87460600 AGGGACAGAAAAGTAATTGTAGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961161521 3:124730642-124730664 AGGGAAAGGACAGGGCTTGGTGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964488141 3:157206905-157206927 AGGGAGAGGAAGGAGAGTGTAGG + Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966257263 3:177931049-177931071 AGTGATAGGACAGTAATTGAGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968577779 4:1375967-1375989 AGGGAGAGGAGGGTGGCTGTGGG + Intronic
969197783 4:5576849-5576871 AGGCACAGGACAGTGATTTCAGG - Intronic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
970570104 4:17371763-17371785 AGTGACAAGACAGTGATTCTGGG - Intergenic
970920768 4:21391781-21391803 AGGGAAAGGAATGTGATTGCAGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975685334 4:76915413-76915435 AGAGTGAGGAGAGTGATTATTGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977992748 4:103464610-103464632 AATGAGAGGACAGTGAGTGATGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978765485 4:112400936-112400958 AGGGAGGTGAGAGTGAGTGTTGG + Intronic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981432046 4:144672498-144672520 AGGAAGAGGAGAGTAGTTGTAGG + Intronic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982160848 4:152568047-152568069 AGGGAGAGGGCTGTGTATGTGGG - Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983461584 4:168030377-168030399 AGGAAGAGGACTGTGTTTGCTGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984838107 4:184040889-184040911 TGGGACAGGAGAGTGATTGATGG - Intergenic
986066714 5:4241113-4241135 AGTAAGAGGACAGTGATTCCAGG + Intergenic
986069144 5:4265288-4265310 AGGGAGCGGCCAGTGATGCTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986091491 5:4512561-4512583 AGCGACAGGACAGAGACTGTAGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
986986978 5:13511507-13511529 AGAGAGACGACTGTGAATGTAGG + Intergenic
987069061 5:14318690-14318712 ATTGAGAGGACAGACATTGTGGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990251430 5:53919524-53919546 AGTGAGAAGAAAGTGATTGAGGG + Intronic
990681634 5:58251146-58251168 AGGAAGGGGACAGAGAATGTGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992179962 5:74185969-74185991 GTGGAGAGGACAGGGCTTGTCGG + Intergenic
992313306 5:75525588-75525610 AGGGAGATGAGAGAGATTATAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992642461 5:78779970-78779992 AGGGAGCAGACAGTGATTAATGG - Exonic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994002192 5:94793110-94793132 AGGGAGGGGACAGTGGTGGGGGG + Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994885491 5:105556074-105556096 ATGGAGAGGACAGTGAAGGCAGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998412887 5:141924518-141924540 AGGCAGATGACAGTGATTCCTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000209496 5:159096993-159097015 ATCGAGAGGACAGCGTTTGTGGG - Exonic
1000419409 5:161021238-161021260 AGGGAGAGGATAGTGATGAGTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002073130 5:176692521-176692543 GTGAAGAGGACAGGGATTGTGGG + Intergenic
1002201357 5:177530504-177530526 AGGGAGAGATGATTGATTGTGGG - Intronic
1004671261 6:17799930-17799952 GGTGAGAGGACAGTGATGGGAGG - Exonic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1004984609 6:21067186-21067208 GGGGAGAGGACAGTAAATGGAGG - Intronic
1005008503 6:21313507-21313529 GGGGAGAGGATAGTGTTTGATGG + Intergenic
1005279854 6:24261941-24261963 GGGGGGTGGACAGTGATTGCTGG - Intronic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1005871195 6:29975345-29975367 AGGGAGAGGACAGGGCTTCAGGG + Intergenic
1005931985 6:30491033-30491055 AGGAAGAGGACAATTATAGTAGG - Intronic
1006502770 6:34468781-34468803 AGGGAGAGGACACTGCATGATGG - Intronic
1006643440 6:35500177-35500199 AGGGAGAGGACAGTTAGAGATGG + Intronic
1007783965 6:44270108-44270130 GGGGAGAGGAAATTGATTCTTGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010065306 6:71675752-71675774 GGGGAGAGGAAAGGCATTGTAGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012506370 6:99951127-99951149 AGGGAGAGGAAAGTGGTGTTGGG + Intronic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015543389 6:134338583-134338605 AGGGAGAGGAGAGGGCTGGTGGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1017865000 6:158435485-158435507 AGGGAGATGACAGCGATGGGAGG - Intronic
1018219593 6:161565039-161565061 AGAGAGAGGACAGGGAAAGTTGG - Intronic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020566169 7:9798487-9798509 ATGAATAGGACTGTGATTGTTGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021179599 7:17490201-17490223 AGGGAAAGGACAGTCAGTCTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1021940485 7:25674092-25674114 AGGGAGAGGACTGTCAATCTCGG - Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022536512 7:31101921-31101943 AGGAAGAGGACCATGAGTGTGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023315776 7:38934854-38934876 ATGGACAGGACTGTGATTGAAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026399637 7:69996550-69996572 GTGGGGAGGACAGTGTTTGTAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028197727 7:87926769-87926791 AGGGTGAGGTCTGTGATTGCTGG + Intergenic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028739121 7:94251530-94251552 AGGGAGAGGACTGTATTTGCAGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030196854 7:106860905-106860927 AGGGAGAGGAGAGAGAATGAGGG + Intergenic
1030257852 7:107530803-107530825 AGGGAAAGGAAATTGATTGGAGG - Intronic
1030603935 7:111619180-111619202 AGGCAGAGGACTGAGATTGGGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034261072 7:149755983-149756005 TGGGAGAGGACAGTGCTGGGTGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035961401 8:4142381-4142403 AGGGAGAGGACAGTTTTCTTTGG + Intronic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1036531805 8:9596955-9596977 AGGAAGAGGACATTGAATATAGG + Intronic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038941956 8:32314862-32314884 ACAGAGAGGACAGTGTTTGATGG - Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039339300 8:36629302-36629324 GTGGAGAAGACAGTGATTTTTGG + Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1040991986 8:53362051-53362073 GGGGAAAGGACAGTCAGTGTAGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1042148811 8:65759522-65759544 AGGGAGAGGCCACTGTTTTTTGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043322647 8:79009342-79009364 AGGGAGTGGACAGTGAAGGAAGG - Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043578321 8:81683247-81683269 AGGGATAAGACATTGATTGAAGG + Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046196092 8:110864242-110864264 AGGGAGAGGATAGTCAGTGGGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048797914 8:138168249-138168271 AGTTAGAGGACATGGATTGTAGG + Intronic
1049415242 8:142492017-142492039 AGGGTGAGGACAGTTAGTGGGGG + Intronic
1049466507 8:142753377-142753399 AGACAGGGGACAGTGATTTTGGG + Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050604789 9:7289574-7289596 AGGGAGAGGACATTTATGGCTGG + Intergenic
1050857218 9:10374610-10374632 AGGGAGAGGACACTAAACGTAGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051570641 9:18554809-18554831 TGGGACAGGACATTGATAGTGGG - Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053071704 9:35105860-35105882 AGGGACAGGACAGTCAAGGTTGG + Intronic
1053345144 9:37372542-37372564 GGGGAGAGGACAGAGAGAGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056387690 9:86112581-86112603 AGGGGGAGGATGGAGATTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059910672 9:119040559-119040581 AAGGAGGGGACAGTGGTGGTTGG - Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061164887 9:128916520-128916542 AGCGAGAGGACAGTATCTGTGGG + Exonic
1061284516 9:129614461-129614483 AGCTAGAGGACATTGACTGTTGG + Intronic
1061502608 9:131012659-131012681 AAGGAGAGGCCTGGGATTGTCGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061852416 9:133423909-133423931 TGGGAGAGGACAGTGAGGGCTGG + Intronic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186494960 X:10005765-10005787 GGGTAGAGGACACTGATTATAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1187731758 X:22262632-22262654 AGGGAGTGGACAGAGCTTGCTGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189666630 X:43362095-43362117 TGAGAGAGGACAGAGAATGTTGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1190648280 X:52543742-52543764 AAGCAGAGGACAGTGAGTGCAGG + Intergenic
1190877135 X:54467988-54468010 AGGGTGAGGGCAGTATTTGTGGG + Intronic
1191593322 X:62913011-62913033 ATGTAAAAGACAGTGATTGTGGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1191909314 X:66131064-66131086 AGGGTGAGGCCTGTGACTGTCGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196186632 X:112751164-112751186 GGGGAGAGGACAGTGGTGATGGG - Intergenic
1196189307 X:112778467-112778489 AGGGTGAGGACAAGGGTTGTGGG - Exonic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic