ID: 917400036

View in Genome Browser
Species Human (GRCh38)
Location 1:174637641-174637663
Sequence CAACCGAAAAGTCACCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917400036_917400044 29 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400044 1:174637693-174637715 GGCGCAGCATAGCCTCAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 672
917400036_917400038 1 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400038 1:174637665-174637687 ATGTTTCGTGCCTCCTCATGAGG 0: 1
1: 0
2: 0
3: 8
4: 322
917400036_917400041 8 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400041 1:174637672-174637694 GTGCCTCCTCATGAGGGAGGAGG 0: 1
1: 1
2: 1
3: 13
4: 222
917400036_917400039 2 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400039 1:174637666-174637688 TGTTTCGTGCCTCCTCATGAGGG 0: 1
1: 0
2: 1
3: 5
4: 83
917400036_917400040 5 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917400036 Original CRISPR CAACCGAAAAGTCACCTTCT GGG (reversed) Intronic
903478750 1:23638114-23638136 AAACAGAAATGTCACCTGCTTGG - Intronic
905847744 1:41246861-41246883 CCACTCAAATGTCACCTTCTTGG - Intergenic
907630778 1:56079765-56079787 CAACGGAAAAAGCACCGTCTGGG - Intergenic
909648006 1:77938721-77938743 CACCTTAAATGTCACCTTCTTGG - Intronic
911045969 1:93628605-93628627 CCACTCAAAAGTCACCTTCTTGG + Intronic
914411761 1:147436054-147436076 CAACTGAACAGACACCCTCTGGG + Intergenic
917400036 1:174637641-174637663 CAACCGAAAAGTCACCTTCTGGG - Intronic
917475055 1:175362217-175362239 CAAGAGCAAAGGCACCTTCTTGG + Intronic
917559470 1:176132293-176132315 CAACTTAAATGTCACCTCCTTGG + Intronic
917836732 1:178946993-178947015 CAACTGAAATATCACCTCCTGGG - Intergenic
920931541 1:210393563-210393585 CAGCTCAAAAGCCACCTTCTCGG - Intronic
922416334 1:225426784-225426806 CAACAGAAAGGCCACCTTCCTGG + Intronic
923121550 1:230997134-230997156 CAACCGTAAGCTCTCCTTCTTGG + Exonic
923133879 1:231100466-231100488 CAACTGAAAAATCCCCCTCTTGG - Intergenic
1065793917 10:29289182-29289204 CAACTGAGAAGTCAGCCTCTGGG + Exonic
1065974442 10:30829993-30830015 GAACCCCAATGTCACCTTCTGGG - Intronic
1067155449 10:43777370-43777392 TTGCCCAAAAGTCACCTTCTTGG + Intergenic
1075140253 10:119827389-119827411 CAACAGAACAGACACCTTCTCGG + Exonic
1079896543 11:26126457-26126479 CAACTGAAAAATTACCTTTTAGG - Intergenic
1085734408 11:79026813-79026835 CAGCAGAAAAGCCAGCTTCTTGG + Intronic
1087004104 11:93452097-93452119 CAACTCAAAATTCAGCTTCTGGG - Intergenic
1087250719 11:95896151-95896173 CAACTGAAATATCACCTCCTTGG + Intronic
1090994635 11:131854447-131854469 CAACTGAAATGTCACATCCTCGG - Intronic
1099000446 12:77172821-77172843 CAACCGACAAGTCACTTTTATGG - Intergenic
1104625297 12:130348475-130348497 CAACTGAAAAACCACCTGCTGGG + Intronic
1109295348 13:60524164-60524186 CAACTGAAAAGGCAGCTCCTTGG - Intronic
1117110527 14:52448331-52448353 CCACTGAAAAGTCAGCTGCTAGG - Intronic
1130898972 15:88192813-88192835 CCACTCAAAAATCACCTTCTCGG + Intronic
1133985018 16:10661867-10661889 CATCCTGGAAGTCACCTTCTAGG - Intronic
1134220717 16:12351761-12351783 CAACTCAAATGTCACTTTCTTGG + Intronic
1134412376 16:14013830-14013852 CAATAGAAAAGTCACGTTCAGGG - Intergenic
1136028993 16:27489195-27489217 CAACAGAAAAGAGCCCTTCTTGG + Intronic
1141114814 16:81299499-81299521 CAACAAAAAAGTCACCATTTGGG + Intergenic
1145105069 17:20108469-20108491 CAACCAAAAAGAAACCTTCTGGG - Intronic
1146039734 17:29439974-29439996 CAACCTAAAAGTAATCTTTTAGG + Intronic
1147445578 17:40473402-40473424 CAACTCAAATGTTACCTTCTTGG + Intergenic
1152844444 17:82591209-82591231 CAACCCCAGAGTCACCTTCCAGG - Intronic
1153191067 18:2539413-2539435 AAACTGAAAAGTCACCTAGTAGG - Intronic
1154284386 18:13038315-13038337 CAACAGAAAAGTGACTTGCTGGG + Intronic
1161909274 19:7180639-7180661 CAGCTTAAAAGTCACCTCCTTGG - Intronic
1161979585 19:7623638-7623660 CACCCATAATGTCACCTTCTAGG - Intronic
1162564311 19:11436716-11436738 CAACTGAAACCTCACCTCCTTGG - Intronic
1164772351 19:30819346-30819368 CAACAGAAAGTTCAACTTCTTGG + Intergenic
1164883233 19:31754208-31754230 GTACCAAAAAGTCACCTTTTTGG - Intergenic
1165781665 19:38438190-38438212 CAACTCAAATGTCACCTCCTTGG + Intronic
930037247 2:47094310-47094332 GAACAGAATAGTCACCTTCCTGG + Intronic
933582527 2:84143649-84143671 CAACTGAACAGGCCCCTTCTTGG + Intergenic
933582633 2:84144603-84144625 AAATCCAAAAGTAACCTTCTGGG - Intergenic
937421967 2:121764606-121764628 CAACCCAAGACTCCCCTTCTCGG - Intronic
937760759 2:125600592-125600614 CAACCAAAAAGTAACATTTTTGG + Intergenic
939014162 2:136882193-136882215 CAACCTAACAGTCACTTGCTGGG + Exonic
943492690 2:188575860-188575882 CTACTGAAATGTCTCCTTCTGGG - Intronic
945546401 2:211158117-211158139 CATCCAAAAAGTCCACTTCTTGG + Intergenic
946371014 2:219281346-219281368 TAGCCTAAATGTCACCTTCTCGG - Intronic
947441800 2:230129253-230129275 CAACACAAAACTCACCATCTTGG + Intergenic
948022330 2:234745262-234745284 AAACGTAAAAGACACCTTCTTGG + Intergenic
1171947511 20:31391607-31391629 CATCCCAAATGTCACCTCCTTGG + Intergenic
1172208553 20:33181707-33181729 GAACTGGAAAGTCACATTCTGGG + Intergenic
1172434433 20:34919125-34919147 GAGCTGAAATGTCACCTTCTTGG - Intronic
1172771112 20:37383222-37383244 CAACTCAAAAGTCCCCTCCTTGG - Intronic
1174539118 20:51275423-51275445 CTACCCAAATGTCACCTCCTCGG - Intergenic
1175553676 20:59832833-59832855 CAACTAAAGTGTCACCTTCTGGG + Intronic
1177501718 21:21965247-21965269 CAACTAATAAATCACCTTCTTGG - Intergenic
1181982715 22:26777170-26777192 TCACTGAAAAGGCACCTTCTTGG - Intergenic
1184901944 22:47451703-47451725 CAACTGCAAATTCACCTCCTCGG + Intergenic
1185042292 22:48511275-48511297 CACAGGAAAAGCCACCTTCTCGG + Intronic
950160100 3:10754079-10754101 CAACTGAGGAGTCACCTTCAGGG + Intergenic
953107434 3:39897952-39897974 GAACAGAAATGTCACCTTCCAGG + Intronic
953393915 3:42551238-42551260 AAACTGAAAATTCACCTGCTGGG + Intronic
956924079 3:73963566-73963588 CAACCGGGAAGTCACCCACTTGG + Intergenic
958071267 3:88616212-88616234 CCATCGAAAAGCCACCTACTTGG - Intergenic
962157595 3:132964889-132964911 AAAACAAAATGTCACCTTCTAGG + Intergenic
964866838 3:161271465-161271487 CAACCCAACAGTCACATTCCTGG - Intergenic
970853085 4:20625001-20625023 CAGCTGCAAAGTCACATTCTTGG + Intergenic
971629067 4:28965404-28965426 CAACCAATAAGTGACCTTGTGGG + Intergenic
971718901 4:30218752-30218774 CAACTTAAAACTCACCTTATAGG + Intergenic
975190317 4:71452797-71452819 TTACCCTAAAGTCACCTTCTTGG + Intronic
975658268 4:76663068-76663090 AAACCGCAAAGTCCCCTTATAGG - Intronic
983498639 4:168474203-168474225 CATCTGAAATGTCACTTTCTTGG - Intronic
989542050 5:42628918-42628940 CAACCGAATGGACCCCTTCTTGG - Intronic
992201130 5:74384947-74384969 CAACTGAAAAGTTGACTTCTTGG - Intergenic
994989200 5:106978186-106978208 CATCCAAAAACTCACCATCTTGG - Intergenic
995378768 5:111509233-111509255 AAACCCAAAGGTCACCTGCTAGG + Intronic
998650493 5:144115126-144115148 AAACTGAAAAGTCACCTTACAGG + Intergenic
1000373991 5:160562428-160562450 CAGCTGAAATGTCTCCTTCTTGG + Intergenic
1000452039 5:161401206-161401228 CAAGTGAAAACCCACCTTCTGGG - Intronic
1001849717 5:174952750-174952772 CACCTGAAAAATCACTTTCTTGG - Intergenic
1002987078 6:2200896-2200918 CATCCGAAATGTAACCATCTAGG + Intronic
1004407639 6:15349242-15349264 CCAACAAAAAGTCACCATCTTGG - Intronic
1005163364 6:22891232-22891254 AAATGGAAAAGTCACCTTCATGG + Intergenic
1005434455 6:25793378-25793400 CAACACAAATGTCACCTACTGGG - Intronic
1007120077 6:39372274-39372296 CAACAAAAAAGTAACCTTCAGGG + Intronic
1008697400 6:54055803-54055825 TTACTGAAATGTCACCTTCTCGG - Intronic
1011112298 6:83852187-83852209 CAACCCAAATCTCACCTTCCTGG + Intergenic
1015515629 6:134080184-134080206 TAACTGAACAGACACCTTCTTGG + Intergenic
1016831703 6:148440441-148440463 GGACCTAAAAGACACCTTCTTGG - Intronic
1018030270 6:159836280-159836302 CTACCAAAAAGTCAAATTCTTGG + Intergenic
1019133849 6:169896322-169896344 CCACTGAAATGTCAGCTTCTGGG + Intergenic
1020550766 7:9601458-9601480 CAAAAGAAAAGTCACCTCCCAGG + Intergenic
1022129186 7:27388370-27388392 CAACCCCAAAGCCACCTGCTTGG + Intergenic
1024064352 7:45720156-45720178 CAACAGACAGGTGACCTTCTTGG + Exonic
1030722586 7:112886421-112886443 CAACCTAAAACTCCACTTCTGGG + Intronic
1035723357 8:1809722-1809744 CAACAGCACAGGCACCTTCTGGG + Intergenic
1038069906 8:24002353-24002375 GAACAGAGAAGTCATCTTCTTGG - Intergenic
1045920498 8:107523316-107523338 AAACCTAAAAGTCACATTTTAGG + Intergenic
1047719620 8:127627473-127627495 CACCCAAAAAGCCACCTCCTCGG + Intergenic
1054865737 9:69999210-69999232 CAGCTCAAATGTCACCTTCTTGG - Intergenic
1056739642 9:89243309-89243331 CAACCAAATAGACACTTTCTGGG - Intergenic
1061087608 9:128408534-128408556 CCACAGCCAAGTCACCTTCTGGG + Intergenic
1061087843 9:128409550-128409572 CCACAGCCAAGTCACCTTCTGGG + Intergenic
1186202281 X:7166732-7166754 CAACTGAAAAATCTCTTTCTAGG - Intergenic
1187138806 X:16573777-16573799 CAACAAAGAAGTCACATTCTGGG + Intergenic
1192220382 X:69193827-69193849 CATCCCAAATGTCACCTTCTCGG + Intergenic
1193244459 X:79211981-79212003 CAACCGAAATGTGAACATCTAGG - Intergenic
1193619243 X:83731114-83731136 AACCCAAAAAGTCACCTTCAAGG - Intergenic
1193834829 X:86329322-86329344 CAACAGACAAGTCACCTCCTTGG - Intronic
1195422337 X:104689418-104689440 CTACCAGAAAGTGACCTTCTGGG - Intronic
1195493826 X:105506367-105506389 CAACCCATAACTCACATTCTTGG + Intronic
1196591269 X:117487655-117487677 CAACCCCCAAGTCAGCTTCTGGG + Intergenic
1200024690 X:153247388-153247410 CATCCTAATAGTCACCTCCTTGG - Intergenic
1200755543 Y:6986683-6986705 CCACCGAGATGTCAACTTCTAGG - Intronic