ID: 917400037

View in Genome Browser
Species Human (GRCh38)
Location 1:174637642-174637664
Sequence GCAACCGAAAAGTCACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917400037_917400041 7 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400041 1:174637672-174637694 GTGCCTCCTCATGAGGGAGGAGG 0: 1
1: 1
2: 1
3: 13
4: 222
917400037_917400039 1 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400039 1:174637666-174637688 TGTTTCGTGCCTCCTCATGAGGG 0: 1
1: 0
2: 1
3: 5
4: 83
917400037_917400038 0 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400038 1:174637665-174637687 ATGTTTCGTGCCTCCTCATGAGG 0: 1
1: 0
2: 0
3: 8
4: 322
917400037_917400044 28 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400044 1:174637693-174637715 GGCGCAGCATAGCCTCAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 672
917400037_917400040 4 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917400037 Original CRISPR GCAACCGAAAAGTCACCTTC TGG (reversed) Intronic
907564878 1:55425435-55425457 GCAACTGCATAGCCACCTTCAGG - Intergenic
907630779 1:56079766-56079788 GCAACGGAAAAAGCACCGTCTGG - Intergenic
917400037 1:174637642-174637664 GCAACCGAAAAGTCACCTTCTGG - Intronic
918944445 1:191044069-191044091 GCAACCGGAAATTAACCTACAGG - Intergenic
1068807618 10:61216592-61216614 GAGGCCGAAAAGTCACCTTCTGG - Intergenic
1068844905 10:61661025-61661047 GCAAATTAAAAGTAACCTTCAGG + Intergenic
1074965526 10:118487686-118487708 GCACCCGAAAAGTTGCCTTTTGG - Intergenic
1076542479 10:131223005-131223027 GGAAGGGAAAAGTCACCATCAGG - Intronic
1077707552 11:4502486-4502508 GCAAGAGAAAAGTCACCTATCGG - Intergenic
1079697938 11:23507431-23507453 GCACCCAAAAAGTCACTTTTTGG + Intergenic
1089251708 11:117167930-117167952 ACAACTAAAAAGTCCCCTTCTGG - Exonic
1094365579 12:29676620-29676642 TCAAACGAAAGGTCACCTCCAGG + Intronic
1099113799 12:78597554-78597576 CCAACCTAATAGTAACCTTCAGG + Intergenic
1100754197 12:97732329-97732351 ACAACTAAAAAGTCTCCTTCTGG + Intergenic
1108581494 13:51832099-51832121 GCAACCCAAAAGCCACCCTGAGG - Intergenic
1112414153 13:99190388-99190410 TCATCCAAAAAGTCAGCTTCTGG - Intergenic
1114829080 14:26117192-26117214 GCAAACCAATAATCACCTTCAGG + Intergenic
1115632335 14:35257596-35257618 GCAACCCAAATGTCAATTTCTGG - Intronic
1130002308 15:80058605-80058627 GCAACACAGAAGTCACCTTGGGG - Intergenic
1134412377 16:14013831-14013853 CCAATAGAAAAGTCACGTTCAGG - Intergenic
1141445623 16:84055989-84056011 GCAGCCGAGAACTCACCTCCAGG + Exonic
1144485365 17:15660004-15660026 GTAAGCGAACAGACACCTTCAGG + Intronic
1145105070 17:20108470-20108492 ACAACCAAAAAGAAACCTTCTGG - Intronic
1145997414 17:29112643-29112665 TCCACAGAAAAGGCACCTTCAGG - Intronic
1156364158 18:36409815-36409837 GCCACCCCAAAGCCACCTTCAGG - Intronic
1157719593 18:49913723-49913745 GCAACCAAAAAGTTGCCTTTTGG + Intronic
931087869 2:58853712-58853734 GCAACTGAAAATTCACCATTAGG + Intergenic
939014161 2:136882192-136882214 GCAACCTAACAGTCACTTGCTGG + Exonic
947526087 2:230877503-230877525 GCAACGGGAAAGACACCTACCGG + Exonic
1172208552 20:33181706-33181728 GGAACTGGAAAGTCACATTCTGG + Intergenic
1172486523 20:35301508-35301530 CCAACCAAAAAGCCCCCTTCTGG - Intergenic
950160099 3:10754078-10754100 GCAACTGAGGAGTCACCTTCAGG + Intergenic
950753685 3:15154167-15154189 GTAAACCAAAAGTCAACTTCAGG - Intergenic
953874404 3:46657818-46657840 ACAACAGGAAAGGCACCTTCTGG - Intergenic
957135242 3:76279459-76279481 GCAAGCGAAAAGTTACATTTTGG + Intronic
967070930 3:185961668-185961690 GCACCCCAAAAGTTGCCTTCTGG - Intergenic
967464577 3:189789293-189789315 GTAACTGAAAAGTAAACTTCAGG - Intronic
970244771 4:14049096-14049118 GCCATCAAAAAGTCCCCTTCTGG + Intergenic
977071524 4:92394925-92394947 ACAACTGAAAAGTCAACTTTTGG - Intronic
981335170 4:143561313-143561335 GCAACAGAGAAGTCAGCTACTGG + Intergenic
981526503 4:145711371-145711393 ACAATGGAAAAGTCACCTTTGGG + Intronic
983257982 4:165423573-165423595 GCAACAGGGAATTCACCTTCTGG - Intronic
988943125 5:36166570-36166592 GCAACCGACCAGTCACATCCGGG - Exonic
990957238 5:61354590-61354612 GCAAAAGAAAACTCACTTTCTGG + Intronic
997617873 5:135264745-135264767 GCAACTGAAAATTCAAATTCAGG - Intronic
1004127814 6:12890373-12890395 GCAACTGAAAAGGCTCCCTCTGG - Intronic
1007120076 6:39372273-39372295 ACAACAAAAAAGTAACCTTCAGG + Intronic
1008372543 6:50750605-50750627 GCAGCAGAAAAGTTACCTTGAGG + Intronic
1011091223 6:83602706-83602728 GCAATAGAAAAGTCAGCTTTGGG - Intronic
1012459704 6:99447001-99447023 GTAACTGAAAAGTCTCCTTTGGG - Intronic
1016082184 6:139869728-139869750 GCATCAGCAAAGTCACCTTCAGG - Intergenic
1017554212 6:155545471-155545493 GCAACAAAAAAGACACATTCAGG - Intergenic
1018724781 6:166603513-166603535 GCTACCGACCAGTCACCTTCTGG + Intronic
1030273669 7:107696737-107696759 CCAACCAAAAAACCACCTTCAGG - Intronic
1042132072 8:65597140-65597162 GCAATGGAAAAGGCACTTTCAGG - Intergenic
1050449310 9:5763208-5763230 TAAACAGAAACGTCACCTTCTGG + Exonic
1060072947 9:120565995-120566017 GCAACACATAGGTCACCTTCTGG - Intronic
1061087606 9:128408533-128408555 GCCACAGCCAAGTCACCTTCTGG + Intergenic
1061087841 9:128409549-128409571 GCCACAGCCAAGTCACCTTCTGG + Intergenic
1187138805 X:16573776-16573798 GCAACAAAGAAGTCACATTCTGG + Intergenic
1188008010 X:25030466-25030488 ACAACTAAAAAGTCCCCTTCTGG - Intergenic
1192039597 X:67604430-67604452 GAACCCCAAAAGTAACCTTCGGG - Intronic