ID: 917400040

View in Genome Browser
Species Human (GRCh38)
Location 1:174637669-174637691
Sequence TTCGTGCCTCCTCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917400037_917400040 4 Left 917400037 1:174637642-174637664 CCAGAAGGTGACTTTTCGGTTGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
917400036_917400040 5 Left 917400036 1:174637641-174637663 CCCAGAAGGTGACTTTTCGGTTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72
917400034_917400040 18 Left 917400034 1:174637628-174637650 CCTCAGTACTGATCCCAGAAGGT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917400040 Original CRISPR TTCGTGCCTCCTCATGAGGG AGG Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG + Intergenic
911017274 1:93346323-93346345 TTCGTGTCTCCTCAGAGGGGCGG - Exonic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920993988 1:210969189-210969211 TTCATCCATCCTCATGAGTGAGG + Intronic
1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG + Intronic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1083921310 11:65782441-65782463 TTCCTGCCTCACCGTGAGGGTGG - Intergenic
1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG + Intergenic
1092712516 12:11353537-11353559 TTCTTGCCTCCTTGTGGGGGTGG + Intronic
1095976374 12:47943214-47943236 TCCTTTCCTCCTCAGGAGGGTGG - Intergenic
1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG + Intronic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1112228364 13:97563618-97563640 TTCATGCAACCCCATGAGGGAGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1121692765 14:95889651-95889673 TAAGTTCCTCCTCACGAGGGAGG - Intergenic
1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG + Intronic
1124934958 15:34161368-34161390 GGCGTGCCTCCTCATGGGAGAGG + Intronic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1135959161 16:26981424-26981446 CTCGTGCCTCCTGCTGAGGTGGG + Intergenic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1137594777 16:49716301-49716323 TTGGTGCTGCCTCATGATGGGGG - Intronic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1149974084 17:61248577-61248599 TTTGTGCTTCCTCAGCAGGGAGG + Intronic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG + Intronic
1165105462 19:33467217-33467239 TAGGAGCCTCCTCTTGAGGGAGG + Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG + Intronic
934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG + Intergenic
937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG + Intronic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
948675918 2:239596637-239596659 TTCCTCCTTCCTCATGAGGTAGG - Intergenic
1171750029 20:29039715-29039737 TTCCTGCCACCTCATGAAGAAGG - Intergenic
1172184423 20:33022444-33022466 ATCGTTCCTTCTCATGGGGGCGG - Intronic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1176315190 21:5236201-5236223 TTCCTGCCACCTCATGAAGAAGG + Intergenic
1177151450 21:17459234-17459256 CTCCTGCCACCTCATGAGGAAGG - Intergenic
1179972776 21:44845667-44845689 TTCCCGCCTGCTCAGGAGGGAGG + Intergenic
1182561284 22:31161246-31161268 TCCGTGCCTCCTTTCGAGGGAGG + Intronic
1183216980 22:36487066-36487088 GACGTGCCTCCTCATGGGAGAGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949450630 3:4181144-4181166 ATTGTGCTTCCTCATGATGGTGG + Intronic
954998718 3:54906421-54906443 TTCATGTCACCTCATCAGGGAGG - Intronic
960898052 3:122526940-122526962 TGCATCCCTCCTCCTGAGGGTGG - Intergenic
963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG + Intergenic
969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG + Intergenic
973135494 4:46700809-46700831 TTTCTGCTTCATCATGAGGGAGG - Intergenic
983671124 4:170238966-170238988 TTCACACCTCCTCATGAGGAAGG + Intergenic
986671422 5:10146368-10146390 TTTGTCCCTCCTGATGACGGAGG - Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG + Intergenic
999553901 5:152720488-152720510 AACGTGTCTCCTCATGAGAGGGG - Intergenic
1000516115 5:162237857-162237879 TTCCTGCCGCCTCATGAAGAAGG - Intergenic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1017103228 6:150866158-150866180 TTGGTGCCAACTCATTAGGGGGG + Intronic
1019743607 7:2687935-2687957 TTCGTGCCTCCCCAGGTGAGAGG - Intronic
1021542034 7:21770541-21770563 CTGGTCCCTCCTCATGAGGCTGG - Intronic
1022047827 7:26637212-26637234 TTTGTGCATTCTCATGAGTGGGG - Intergenic
1023798112 7:43810710-43810732 GGCGCGCCTCCTCATGAGAGAGG - Intergenic
1026258309 7:68732111-68732133 TTCTTGCCTCCACATGACCGAGG - Intergenic
1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG + Intergenic
1030787841 7:113684511-113684533 CTCTTGCCTCGTCATGTGGGTGG + Intergenic
1033044136 7:137945793-137945815 CACCCGCCTCCTCATGAGGGTGG + Intronic
1034848415 7:154470277-154470299 TTCCTTCCTCCTCATTATGGTGG + Intronic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1039723347 8:40188483-40188505 TGAGTGCTTCCTGATGAGGGAGG - Intergenic
1045309826 8:100991469-100991491 TTCATGCTTCCTCATAAGTGTGG - Intergenic
1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG + Intronic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1054931911 9:70643923-70643945 TTCATGCCTCCTTATATGGGAGG + Intronic
1057949551 9:99359012-99359034 TTCTTGCCTGCTCAGCAGGGCGG - Intergenic
1060748234 9:126151767-126151789 ATTGTGCCTCCCCAGGAGGGAGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic