ID: 917401725

View in Genome Browser
Species Human (GRCh38)
Location 1:174656834-174656856
Sequence CAGAACTCCTTGGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 8, 3: 32, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917401725 Original CRISPR CAGAACTCCTTGGCAAAGAC TGG (reversed) Intronic
900866581 1:5273271-5273293 CAGAACTGATTGGGAAAGAAAGG + Intergenic
901923530 1:12552345-12552367 CAGAACTCCATGACACACACTGG + Intergenic
902945280 1:19831859-19831881 CAGAGCCCCTTGACAAAGATTGG + Intergenic
904798251 1:33073755-33073777 CAGACCTCCTTGCCAGAGAGGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907627476 1:56044164-56044186 CATATCTCCTTGGCAAGGACTGG - Intergenic
909892243 1:81022003-81022025 CAGGATTCCATGGCTAAGACAGG - Intergenic
910454899 1:87387080-87387102 CAGAACTTCTTGGTTAAGATGGG - Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917765849 1:178216103-178216125 TAGAAGTCCTTAGGAAAGACTGG + Intronic
917801173 1:178572027-178572049 ACGAAGCCCTTGGCAAAGACTGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
923349638 1:233091345-233091367 AAGAAATGCTTGGCACAGACAGG + Intronic
923630540 1:235646781-235646803 AAGAACTCCTTGGCAATTAGAGG + Intronic
1065234206 10:23631099-23631121 CAGAGCTCCTTGGCAAAGGCTGG + Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1066056244 10:31682975-31682997 CAGAACTTCTTTGCAAGGAGTGG + Intergenic
1067150298 10:43727021-43727043 CACAATCCCTTGGCAACGACTGG + Intergenic
1071085123 10:81861348-81861370 CAGAACCACCTGGCAAAGATTGG - Intergenic
1071559483 10:86633794-86633816 CAGAAATCCTTATCAAAGACTGG + Intergenic
1074487682 10:113902751-113902773 CATAACCTCTTGGCAAAGAAAGG - Intronic
1074982768 10:118633037-118633059 CTGATCTCCTAGGCAGAGACTGG + Intergenic
1076160460 10:128240499-128240521 AAAAATTCCTTGACAAAGACAGG - Intergenic
1078119130 11:8488536-8488558 TAGAGTTCCTTGGCAAAGAATGG + Intronic
1078455177 11:11469421-11469443 CAGATCTCCATGGCAGAGACAGG + Intronic
1078743959 11:14093313-14093335 CCCAATTCCTTGGCAAAGAATGG - Intronic
1078746843 11:14123829-14123851 CAGAAAGCCTGGGCAAACACGGG + Intronic
1078944971 11:16055427-16055449 CACAAGTCCATGACAAAGACTGG + Intronic
1080419008 11:32093776-32093798 CAAAACTCATTGGGAAAGTCAGG + Intronic
1086231864 11:84578926-84578948 AAGAATACCTTGGGAAAGACCGG - Intronic
1086650927 11:89289103-89289125 CAAAAATCTTTGGCAAAGAAGGG + Intronic
1088286748 11:108198048-108198070 CAGACCCCCTTGGCAAACAATGG + Intronic
1088683092 11:112261179-112261201 CAGAAGTGCTTAGCAAAGACTGG + Intronic
1089325354 11:117653115-117653137 CAAAACTACTCGGCAAAGCCAGG - Intronic
1089760351 11:120718265-120718287 CAGAAAGCCTGGGTAAAGACGGG - Intronic
1089828394 11:121300828-121300850 CACAGCACCTTGGCAAAGGCTGG + Intronic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1091192915 11:133709121-133709143 CAGCAGTTCTTGGCAATGACAGG - Intergenic
1092609762 12:10159739-10159761 CAGAACTCCTTTGCAGAAACTGG - Exonic
1093267343 12:17018935-17018957 CAGAACTCGTTTACAAAAACAGG - Intergenic
1094492598 12:30970349-30970371 CAGAACTCCAAGCCAAAGACAGG - Intronic
1095494546 12:42770941-42770963 AAGGACTCCTAGGAAAAGACTGG - Intergenic
1096561842 12:52441139-52441161 AAGAATTCCTAGGCCAAGACTGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098225974 12:68324758-68324780 CAGTACTTCTAGGCATAGACAGG - Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1102198027 12:111038039-111038061 CCAAACTCCTTGGAAAAGTCCGG - Intronic
1106564016 13:30870269-30870291 CATAACTCCTTGGCCTACACGGG + Intergenic
1109458020 13:62618953-62618975 CACACCTACTTTGCAAAGACTGG + Intergenic
1110568099 13:76976431-76976453 CACCACTCCTTGGCGAAGAAGGG + Intergenic
1112700135 13:101998422-101998444 CAGAACTCTTTGGGAGAGAATGG + Intronic
1116605299 14:46985191-46985213 AAGAACTCATTGATAAAGACAGG - Intronic
1118172488 14:63401691-63401713 AAGAAAGCCTTGGCATAGACAGG + Intronic
1119181090 14:72605751-72605773 CAGACCCCCTTGGCAAAAGCCGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121248346 14:92481033-92481055 CAGAGTCCCTTGGCAAAGACTGG - Intronic
1124147817 15:27144833-27144855 CAGAGCAACTTGGCAAAGGCTGG + Intronic
1124245274 15:28065123-28065145 CAGAGCCACTTTGCAAAGACTGG - Intronic
1124403119 15:29367710-29367732 CAGACCCCCTTGTCAAAGACTGG + Intronic
1124792000 15:32736574-32736596 CAGAGCTCCTTGGCAGAGACTGG + Exonic
1125750567 15:42024775-42024797 CAGAGTTTGTTGGCAAAGACTGG - Intronic
1126324746 15:47464477-47464499 CAGGAGTCCTTGGCATGGACTGG - Intronic
1126846683 15:52766754-52766776 CAGAGGGCCTTGGCAAAGCCAGG + Intronic
1127346354 15:58104574-58104596 CAGAGCCCCTAGGCAAAGACTGG - Intronic
1127627858 15:60797890-60797912 CCTAACTCCTGGGAAAAGACTGG - Intronic
1128206764 15:65859434-65859456 CAGAAATCCTTGCCTTAGACTGG - Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1131581273 15:93646181-93646203 CAAAAATCCTTGGCACAGATAGG - Intergenic
1131748846 15:95482972-95482994 CAGAACCAGTTTGCAAAGACTGG + Intergenic
1138012499 16:53396147-53396169 CAGAGGCCCTTGGCAAAAACTGG + Intergenic
1138049710 16:53763976-53763998 AAGAACTAAGTGGCAAAGACAGG - Intronic
1139274351 16:65713697-65713719 CACAACTACTAGGCAAAGAGAGG + Intergenic
1139324607 16:66142577-66142599 CAGACCTCGTTGGCAAAAGCTGG + Intergenic
1139661532 16:68424185-68424207 CAGTACTCCTGGCCAAAGAGAGG - Intronic
1141887316 16:86901478-86901500 CAGCACTCCTGGGTCAAGACTGG - Intergenic
1141963226 16:87423483-87423505 CAGGTTTCCTTGGCAAAGGCTGG - Intronic
1144468804 17:15518664-15518686 AAGAATTCCATGGCTAAGACTGG + Intronic
1144730543 17:17523459-17523481 CAGAGCTCCTTGGCAGTGGCAGG + Intronic
1145007937 17:19348035-19348057 CAGAAGTCTTTGGCACAGTCTGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146364712 17:32213440-32213462 GAGAACTCTTTGTCAATGACAGG + Intronic
1152026900 17:77815807-77815829 CAGAGCTACTTGCCAGAGACGGG + Intergenic
1156658020 18:39310406-39310428 CAGTACTCCAAGGCAAAAACTGG + Intergenic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1157686428 18:49646203-49646225 CAGGCCTCCTTGGCAATGGCAGG + Intergenic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1162838077 19:13334660-13334682 CAGGACTTCTGGGAAAAGACTGG + Intronic
1164379470 19:27719714-27719736 TAGAACTCCTGGGCAAACCCAGG - Intergenic
1164567953 19:29341887-29341909 CAGAGCTCCTTGCAACAGACTGG + Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
925710675 2:6736634-6736656 CAGAAATCCTGAGCAAAGGCTGG - Intergenic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
927238167 2:20897153-20897175 CAGAGCCCCTAGGCAAAGACTGG - Intergenic
931559620 2:63545771-63545793 CACACCTCCTTGGCAAAAAACGG + Intronic
935702462 2:105824434-105824456 CAGAAGTACTTGGGAAAGGCAGG + Intronic
938784477 2:134612574-134612596 CACAGCTCCTTGGCAAAGGATGG + Intronic
939434506 2:142156639-142156661 TAGAACACCTTGGCAAAGGCTGG - Intergenic
940142350 2:150506571-150506593 CAGAACACCCTGGCAAATGCAGG + Intronic
942100575 2:172578878-172578900 CAGAGTCCCTTGGCAAAGACTGG - Intronic
942395753 2:175547691-175547713 CAGCACCCCTTGTCAAAGACTGG - Intergenic
943596003 2:189857459-189857481 CAGAACTCCAAGATAAAGACAGG - Intronic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
946428523 2:219612769-219612791 CCAAACTCCTTGGCAGACACAGG - Intronic
947798456 2:232909793-232909815 CAGATCTCATTGGCAAAGAGTGG - Intronic
948231512 2:236352301-236352323 GAGAGCTCCTTCACAAAGACGGG + Intronic
1169528958 20:6463820-6463842 CAGACCTCCTTCAAAAAGACTGG + Intergenic
1170412688 20:16107897-16107919 CAGATGGCCTTGGCAAAGCCAGG - Intergenic
1171059704 20:21944397-21944419 CAGGACTGCTTGGCAGAGCCTGG + Intergenic
1173167130 20:40693142-40693164 GAGGGCTCCTTGGAAAAGACAGG - Intergenic
1173535608 20:43810439-43810461 CAGAGCCCCTTAACAAAGACTGG - Intergenic
1175109578 20:56637748-56637770 CAGAACTTCTCAGCCAAGACCGG + Exonic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1177520608 21:22217833-22217855 CAGTACTCCTTGAAAGAGACTGG - Intergenic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1181008957 22:20029052-20029074 CAGAACGCCTGGGCAAAGATGGG - Intronic
1183807264 22:40221838-40221860 CAGAACACCTGGGTAAGGACAGG - Intronic
1184466377 22:44670744-44670766 CAGAACTGCCTGGCAGAGGCGGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951771440 3:26262040-26262062 CAGAATTCCTTGGCTAAGTTGGG + Intergenic
952460340 3:33518185-33518207 CAAAACTCCTTGGTAACCACTGG - Intronic
953522584 3:43657146-43657168 TAGAGCTCCTTGGAGAAGACAGG - Intronic
953892509 3:46763388-46763410 CAGAGCTCCTTAGCACAGGCTGG + Intronic
956514221 3:70028506-70028528 CACAACTCTGTGGCATAGACAGG - Intergenic
957661846 3:83166541-83166563 CAGAACTCCTTTTCAAACAGTGG - Intergenic
957874224 3:86124562-86124584 TGGAACTCCTAGGCAAAGACTGG - Intergenic
958137452 3:89514457-89514479 CAGAGCCTCTTAGCAAAGACTGG - Intergenic
959403463 3:105931869-105931891 CAGAAGTACTTTTCAAAGACTGG + Intergenic
959934674 3:112016822-112016844 CAAAGCTCCTTGGAAAACACAGG + Intergenic
960688989 3:120323729-120323751 GATGACTGCTTGGCAAAGACAGG - Intergenic
961048847 3:123729234-123729256 CAGAGCCCCTTGGCAAAGGCTGG + Intronic
962017042 3:131452440-131452462 CAGAACTACCTGGAAAAGGCAGG + Intergenic
962168552 3:133076790-133076812 CTGAGCCCCATGGCAAAGACGGG - Intronic
962431954 3:135328119-135328141 CAGGACTCCATGCCAAAGAGGGG + Intergenic
962728747 3:138259948-138259970 AAGAACACCTTGGGAATGACAGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966099697 3:176252231-176252253 CAGAATAAGTTGGCAAAGACTGG - Intergenic
968183255 3:196612769-196612791 CATAACTCCTTGGCAAGGAAAGG - Intergenic
970133168 4:12893389-12893411 AAGAACTCCTTGGGGAAGGCAGG - Intergenic
970268933 4:14321958-14321980 CAGGAATCCTTTGCAAGGACAGG - Intergenic
970372938 4:15426702-15426724 CTGAGCTCCCTGGCAGAGACTGG + Intronic
970676488 4:18456114-18456136 CAAATCTACTTTGCAAAGACAGG - Intergenic
971804022 4:31331630-31331652 TTGTACTCATTGGCAAAGACTGG - Intergenic
972673353 4:41235199-41235221 CAGAGCCCCTTGCCAAAGATTGG - Intergenic
972798757 4:42449867-42449889 CAAAACACCTTAGCAATGACAGG - Intronic
974340309 4:60606152-60606174 CAGTATTCCTTGGCAACGAAAGG - Intergenic
976054540 4:81048062-81048084 CAAAAATCCTTGGGAAAGAAGGG - Intronic
977138927 4:93341732-93341754 CACAACTCCTAGGCAAATCCAGG - Intronic
979759037 4:124376654-124376676 GAGAACACCATGGGAAAGACTGG + Intergenic
979884034 4:126001726-126001748 CAGAAATTCTTTTCAAAGACTGG + Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
984450610 4:179896645-179896667 AAGAAATACTTGGCAAAGTCCGG + Intergenic
986794031 5:11191761-11191783 CAGAGTTCCGTGGCAAAGAGCGG + Intronic
987326127 5:16813059-16813081 CATTACTCCTTAGCAAAGAATGG + Intronic
987726917 5:21715176-21715198 CAGTACTCCTGGGCATAGATGGG + Intergenic
990946683 5:61256610-61256632 CAGACCTCCTTGGCTAAGATTGG + Intergenic
991190117 5:63861550-63861572 CAGATCCCCTTGGCAAAGGGTGG - Intergenic
992743365 5:79795711-79795733 CAGGACTCCTTGCCCCAGACTGG - Intronic
994497519 5:100532694-100532716 CAGCAGTCCTTGGCAATAACTGG + Intergenic
999030373 5:148284045-148284067 CAGATCTCCTTGGCAAAAATGGG + Intronic
999573812 5:152950845-152950867 AAGAACCCCTCAGCAAAGACAGG + Intergenic
1001748639 5:174111138-174111160 CAGAACTTCTTGCCACACACAGG - Intronic
1004352022 6:14898384-14898406 CAGGACTCCTGGTCAAAGAAAGG - Intergenic
1004528557 6:16431965-16431987 CAAAACTCCTGCGCAGAGACTGG - Intronic
1005771283 6:29075086-29075108 AAGATCTCCTAGGAAAAGACAGG - Intronic
1008328460 6:50216292-50216314 CAGAAATCCATGGCCAAGAAGGG + Intergenic
1009669705 6:66731015-66731037 CAGAACCCCTCAGCAAAGGCTGG - Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1013275548 6:108581352-108581374 CAGAATACCTTGGCAGAGGCTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017556642 6:155578774-155578796 CAGAAGTCCAAGGCAAAGATTGG - Intergenic
1017562384 6:155642732-155642754 GAGAACTCCTCTGCAAAGCCTGG - Intergenic
1018598923 6:165517697-165517719 CAGAAGTCATTGCCAAGGACGGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021287520 7:18799094-18799116 CAGAGCCCCTCGGCAAAGGCTGG + Intronic
1021976226 7:26013373-26013395 CAGAGCTCCTTGGAGAACACAGG - Intergenic
1022425652 7:30266481-30266503 CAGAACCCCTTTGCAAAAACTGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023647361 7:42331679-42331701 CAGAGGTCCTTGACAAAGACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025860455 7:65322035-65322057 CTGAAATCTTTGGCAGAGACAGG - Intergenic
1026054488 7:66972605-66972627 CAGAAAGCCTTTGCTAAGACAGG - Intergenic
1026706892 7:72701839-72701861 CAGAGCCCCTTGACAAAGGCTGG - Intronic
1027990562 7:85355065-85355087 CAGAAGTCCTGGACAAACACAGG - Intergenic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1029726601 7:102410070-102410092 CAGAGCTCCTAGGCAAAGACTGG - Intronic
1030981326 7:116187898-116187920 CAGAATTCCTCAACAAAGACTGG + Intergenic
1031151826 7:118062671-118062693 CATAAAACCTTGACAAAGACTGG - Intergenic
1031984414 7:128153988-128154010 CACAACTCCTAGGCTAAGAAAGG + Intergenic
1031984451 7:128154241-128154263 CACAACTCCTAGGCTAAGAAAGG - Intergenic
1032958128 7:136997614-136997636 CAGAATTCATTGCCAATGACAGG - Intronic
1033322313 7:140350940-140350962 CAGAGCTCTTTGGCCAAGTCTGG + Intronic
1034744652 7:153513252-153513274 CAGAATTATTTGGCAAAGATTGG - Intergenic
1034910900 7:154997869-154997891 CAGAACACCTTGCCACAGTCGGG + Intronic
1035362525 7:158322837-158322859 CAGATCTCCCTGGCAAGGGCTGG + Intronic
1035705781 8:1673381-1673403 CAGAAATCCTGGGCATAGAGAGG - Intronic
1035834734 8:2737139-2737161 CAGAACTCTGTGGCAAAGACTGG + Intergenic
1036800080 8:11784325-11784347 CAGAGCTGCTTGGAAAACACTGG - Intronic
1039487648 8:37924218-37924240 CAGAGCCCCTTGGCAAAGACTGG - Intergenic
1040548580 8:48421156-48421178 CAGAACCCCTCTGCAGAGACTGG - Intergenic
1041950997 8:63501854-63501876 AAGAACCCCTCAGCAAAGACTGG - Intergenic
1042259867 8:66847296-66847318 AAGAACTCCTAGAAAAAGACAGG + Exonic
1042347401 8:67741438-67741460 CAAAACTCCTGGCCACAGACCGG + Intronic
1045960453 8:107961918-107961940 CAGAAATCCTTGGCATGCACAGG + Intronic
1046244705 8:111543806-111543828 CAGAGGACCTTAGCAAAGACTGG + Intergenic
1046253411 8:111664810-111664832 TAGAACTACTTGGAAAAGGCCGG + Intergenic
1047334000 8:123919111-123919133 GAGAACTCCTTGGGAAGGAAGGG + Intronic
1048961177 8:139579638-139579660 CAGATTCCCTTGGCAAAGGCTGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056835372 9:89950923-89950945 CATAATTCCTTGGCAAACTCAGG + Intergenic
1057190699 9:93085753-93085775 CAGTTCTCCTTGGCCAAGACAGG + Intergenic
1059016753 9:110526113-110526135 AAGAACTCTTTGGCTAATACTGG - Intronic
1059846733 9:118287885-118287907 CACAACTACTTGGCAAAGGCAGG + Intergenic
1061954427 9:133954203-133954225 CAGAAATCCCTGGAAATGACTGG - Intronic
1062343895 9:136106007-136106029 CAGAGCCCCTTGGCCAAGTCAGG + Intergenic
1062566621 9:137166539-137166561 CAGACCTCCAGGGCACAGACAGG + Intronic
1187548274 X:20275013-20275035 CAAAACTCCTTGAGAAATACAGG - Intergenic
1188412155 X:29886059-29886081 TAGAACTCTGTGGCAATGACTGG - Intronic
1189358060 X:40326663-40326685 CAGAAGTCATTGGCAAGTACAGG + Intergenic
1190211469 X:48451982-48452004 CAAATCCCCTTGGCAAAGACTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1190976716 X:55411098-55411120 CAGAGCTTCTTGGTAAAGGCTGG - Intergenic
1192187132 X:68955333-68955355 CAGAACCCTTTGGCAAAGACTGG + Intergenic
1192593284 X:72379944-72379966 CAGAGCATCTTGGTAAAGACTGG - Intronic
1192636337 X:72823242-72823264 CAGAGCCCCATGGCAATGACTGG - Intronic
1192645377 X:72897572-72897594 CAGAGCCCCATGGCAATGACTGG + Intronic
1196038143 X:111169899-111169921 CAAAACTCCTTGGCAATGCAAGG - Intronic
1196051100 X:111305008-111305030 CAGAGCCCCTCGGCAAAGGCTGG + Intronic
1197391417 X:125871178-125871200 CAGAGCCCCTTGACAAGGACTGG - Intergenic
1197398482 X:125958220-125958242 GAAATCTCCTTGACAAAGACTGG + Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1200236521 X:154470346-154470368 CAGAAAGGCTTGGCAAAGAGAGG - Intronic