ID: 917402812

View in Genome Browser
Species Human (GRCh38)
Location 1:174669807-174669829
Sequence AAGAAACAGAATAGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 24, 3: 133, 4: 995}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917402812_917402818 20 Left 917402812 1:174669807-174669829 CCAGGCCCTCTATTCTGTTTCTT 0: 1
1: 0
2: 24
3: 133
4: 995
Right 917402818 1:174669850-174669872 ATGCCAATCCCATGCTGTTTGGG 0: 1
1: 60
2: 862
3: 3187
4: 16863
917402812_917402817 19 Left 917402812 1:174669807-174669829 CCAGGCCCTCTATTCTGTTTCTT 0: 1
1: 0
2: 24
3: 133
4: 995
Right 917402817 1:174669849-174669871 TATGCCAATCCCATGCTGTTTGG 0: 1
1: 11
2: 85
3: 202
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917402812 Original CRISPR AAGAAACAGAATAGAGGGCC TGG (reversed) Intronic
900324660 1:2102625-2102647 AACAAACAAAAACGAGGGCCGGG - Intronic
900860514 1:5226036-5226058 AAGAATTAGAATTGAAGGCCAGG - Intergenic
901098725 1:6702699-6702721 AAGCAGCAGAAAAGATGGCCAGG - Intergenic
901143557 1:7050926-7050948 AACACACAGTACAGAGGGCCGGG - Intronic
901472096 1:9464566-9464588 ATGGAACAGAATAGAGAACCCGG - Intergenic
901571839 1:10167142-10167164 AACAATAATAATAGAGGGCCGGG + Intronic
901575504 1:10197696-10197718 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
901583375 1:10264954-10264976 AAGAAAAAGAAAAAAAGGCCGGG - Intronic
901917662 1:12512319-12512341 AAGAAACAGCAAAGGAGGCCGGG + Intergenic
902072920 1:13756272-13756294 AAAAAAAAGAATTGAGGGCTTGG + Intronic
902387975 1:16086846-16086868 AAGAAACAAAATGGGAGGCCGGG + Intergenic
902521674 1:17021446-17021468 AAAAAACAGATGAGAGGGGCCGG + Intronic
902606599 1:17572692-17572714 AAGAAACAAAAGAGAGTTCCGGG - Intronic
902754572 1:18540546-18540568 ATGGCACAGAATACAGGGCCTGG - Intergenic
902799856 1:18822463-18822485 AAGAAAAAAAAAAAAGGGCCGGG - Intergenic
902902061 1:19524524-19524546 AAGAAAGAGAATATCTGGCCTGG - Intergenic
902972560 1:20064596-20064618 AGGAAACAGAATACAAGGTCAGG + Intronic
903011758 1:20336273-20336295 GAGAAACAGAAAAGAGGGCTAGG - Intronic
903834635 1:26195480-26195502 AAGAAAAAGAAAAAAGAGCCTGG - Intronic
903865461 1:26394369-26394391 AAAAAACAGAGAATAGGGCCAGG + Intergenic
903869712 1:26425036-26425058 ATAAAATAGAACAGAGGGCCGGG - Intronic
903994244 1:27295747-27295769 AACAAACAAAATAGAAGGTCAGG - Intronic
904146265 1:28394584-28394606 AAAAAAAAGAAAAGATGGCCAGG - Intronic
904174752 1:28619054-28619076 AACAAACAAAAAAAAGGGCCTGG + Intronic
904587346 1:31587611-31587633 AAGAATAAGAATACAGGGCTGGG - Exonic
904683323 1:32243760-32243782 AAGAAAAAGAATAGAGGAATAGG + Intergenic
904817464 1:33216304-33216326 AAGAAACAGAAAAAAGGGCCGGG + Intergenic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905433534 1:37941641-37941663 AAAAAATAAAATAAAGGGCCGGG + Intronic
905547450 1:38811078-38811100 AAGAAAGATAACAGAGGGCCAGG - Intergenic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
905649126 1:39644861-39644883 AAAAAACAAAAAAGAGGGGCAGG + Intergenic
906129228 1:43446153-43446175 AAGAAACAAAAAAGGGGGCAAGG - Intronic
906254715 1:44339374-44339396 AAAAAAAAGAACAGAGAGCCTGG + Intronic
906337266 1:44944159-44944181 AAGAAACATAGTTTAGGGCCAGG + Intronic
906386430 1:45372741-45372763 AAAAAAAAGAAAAGAAGGCCAGG + Intronic
906570953 1:46839723-46839745 ATGGAACAAAATAGAGAGCCCGG - Intergenic
906601655 1:47134903-47134925 AAGAAACAGAACAGAGGCCTCGG - Intergenic
906750671 1:48256545-48256567 AAAAAGCTGAATAGAGGGCAGGG + Intergenic
906817942 1:48898614-48898636 ATGAAACAGAATAGAGAATCCGG - Intronic
906887822 1:49671150-49671172 ATGGAACAGAATAGAGAGCCCGG + Intronic
906999624 1:50837249-50837271 AAGAAACATAACATATGGCCGGG - Intronic
907875263 1:58480368-58480390 AAGAAACAGAATTGGGGGAGAGG - Intronic
907934871 1:59033083-59033105 AGGAAACAGAAATGAGTGCCGGG + Intergenic
907952978 1:59201970-59201992 AAGAAGCAGAACAGAGATCCTGG + Intergenic
908726989 1:67186914-67186936 AAAAAAAGGAATAAAGGGCCAGG - Intronic
908795039 1:67822600-67822622 AAGAAACAGAGCACTGGGCCTGG + Intronic
909053336 1:70794413-70794435 ATGGAACAGAATAGAGAGCCTGG + Intergenic
909236544 1:73159992-73160014 AAGAAACAAAATAAAAGGACAGG + Intergenic
909512116 1:76465064-76465086 TAGAAACAGAGTAGAGGGCATGG + Intronic
909614358 1:77590075-77590097 TAAAAACAAAAAAGAGGGCCAGG + Intronic
909891315 1:81010924-81010946 TAGAATAAGAATAGAAGGCCGGG + Intergenic
910108588 1:83657823-83657845 TACAGACAGAATTGAGGGCCAGG + Intergenic
910499748 1:87876408-87876430 AAGAAAGAGAAAAGAGGGAATGG - Intergenic
910589730 1:88917862-88917884 AAGAAAAAAAGTAGAGTGCCAGG - Intergenic
910611344 1:89146115-89146137 ATGGAACAGAATAGAGAGCCAGG + Intronic
910623163 1:89278153-89278175 AAGAAACAGGAGAGAGGATCAGG - Intergenic
910672400 1:89786364-89786386 AAGAAACAGCATAGAAAGGCCGG - Intronic
910742883 1:90540593-90540615 ATGGAACAGAATAGATGGCTCGG + Intergenic
911109491 1:94167285-94167307 AAAAAAGTGAATGGAGGGCCAGG + Intronic
911168906 1:94750275-94750297 AAGGAAAAGAAAAGAAGGCCCGG + Intergenic
911728101 1:101263741-101263763 AAAAAAAACAAAAGAGGGCCTGG - Intergenic
912499748 1:110114036-110114058 AAAGAACAGAGTAAAGGGCCTGG - Intergenic
912613050 1:111068004-111068026 AGAAAACAGTATGGAGGGCCAGG - Intergenic
912766219 1:112414068-112414090 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
912823283 1:112884226-112884248 AAGAAAAAGAAAAGCGGGCCAGG + Intergenic
913088146 1:115458041-115458063 AAGAAACAGAAGAGAAGCACAGG + Intergenic
913300024 1:117360716-117360738 AAGAAAGAGACAAAAGGGCCAGG - Intergenic
913696279 1:121328914-121328936 AAAAAACAAAACAGAGGGCTGGG + Intronic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
914141284 1:144951141-144951163 AAAAAACAAAACAGAGGGCTGGG - Intronic
914193756 1:145432741-145432763 AACAAACAAAATAGAAGGCCGGG - Intergenic
914265064 1:146031528-146031550 AAGAAACTTAATAGAGAGTCAGG - Intergenic
914404378 1:147356575-147356597 AATTAACAGATTACAGGGCCAGG - Intergenic
914724903 1:150319326-150319348 ACAAAAGAGAATAGAGGGTCGGG - Intergenic
914864755 1:151417355-151417377 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
915032904 1:152899425-152899447 AAGAATGAGAAGAGAGGGCTTGG - Intergenic
915126081 1:153666038-153666060 AAGAAAAAGGATAGAGGCCGTGG - Intronic
915201332 1:154231594-154231616 TAGAAATAGAAAACAGGGCCGGG - Intronic
915394085 1:155568819-155568841 AAGAAAAAGAAAAAAAGGCCGGG - Intergenic
915404544 1:155649544-155649566 AAAAAATAGTATATAGGGCCAGG - Intergenic
915703189 1:157817339-157817361 ATGAAACAGAATAGAGAGCCCGG + Intronic
915830918 1:159129157-159129179 GAGACACAGAAAAGATGGCCAGG + Intronic
915935143 1:160086071-160086093 TACAAAGAGAAAAGAGGGCCGGG - Intronic
916229044 1:162520890-162520912 AAGATACAGAATAGAGAGACAGG + Intronic
916758000 1:167791588-167791610 AAGGAACAGAGAAGAGGGGCTGG + Exonic
917058898 1:171015574-171015596 ACCAAACAGAATAGAAGGCAAGG - Intronic
917172891 1:172197236-172197258 ATGGAACAGAATAGAAAGCCAGG - Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917763023 1:178184650-178184672 ATGAAACAGAATAGAGAGACTGG - Intronic
918595537 1:186288603-186288625 AAAAAACAAACTAGAGGGCCAGG + Intergenic
918749528 1:188255638-188255660 ATGGAACAGAATAGAGAACCTGG - Intergenic
918994314 1:191736610-191736632 ACAGAACAGAATAGAGAGCCCGG - Intergenic
919160528 1:193824561-193824583 AAGGAACAGAATATAGAACCCGG + Intergenic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
920281373 1:204846201-204846223 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
920778486 1:208964725-208964747 AAGAAATTAAAGAGAGGGCCAGG - Intergenic
921026207 1:211284907-211284929 CAGAAGCAGAATAGAGAGCCAGG - Intronic
921960009 1:221024604-221024626 CAGACACAGAAAAGAGAGCCAGG - Intergenic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
922302144 1:224311026-224311048 AAGGAATAGAATAAAAGGCCAGG - Intronic
922608248 1:226904632-226904654 AACAAACAGAAAAGAAGTCCAGG - Intronic
922642738 1:227250754-227250776 AAGAAATACTAAAGAGGGCCAGG + Intronic
922822144 1:228492017-228492039 AAGAAGCAGAATGGAGGTCAGGG + Intronic
923342756 1:233021725-233021747 AAAAAACAGAGTGGAGGGCATGG + Intronic
923515892 1:234697829-234697851 AAGCAAAAGAATAGAGTGACTGG - Intergenic
923799275 1:237191240-237191262 ATGGAACAGAATAGAGAGCCTGG - Intronic
924228838 1:241946209-241946231 AAGAAATGGAAGACAGGGCCAGG - Intergenic
1063342254 10:5277217-5277239 AAGAAATACAATAGAAGCCCAGG - Intergenic
1063403675 10:5772459-5772481 AAGTAACAGTCTAGAAGGCCAGG + Intronic
1063621147 10:7650438-7650460 GAGAAAAACAATACAGGGCCGGG + Intronic
1063669664 10:8089823-8089845 AAGAAATATAATGGGGGGCCGGG - Intergenic
1064012376 10:11744792-11744814 AAGAAAGAGAGGAGAGGGCCAGG + Intronic
1064074573 10:12258588-12258610 AAGAAAAAGAGTATATGGCCGGG - Intergenic
1064330117 10:14385685-14385707 AAGAAACAACATAAAGGGGCAGG - Intronic
1064909923 10:20389375-20389397 AAGTTACAGAATAAAGAGCCAGG + Intergenic
1065181815 10:23133832-23133854 AAAAAAAAGAATAGTGGGCATGG + Intergenic
1065293193 10:24251442-24251464 AAAAAACAGATCAGAGGCCCTGG + Intronic
1065546634 10:26827886-26827908 AAGAAAGAGAAAAGCTGGCCGGG - Intronic
1065914236 10:30339189-30339211 AAGAGACAGAATCTTGGGCCGGG + Intronic
1066038172 10:31515797-31515819 AAGAAACAGAATATTGTGGCAGG - Intronic
1066669122 10:37818209-37818231 AAAATACAGACTAGAAGGCCGGG - Intronic
1068725903 10:60302873-60302895 ATGGGACAGAATAGAAGGCCCGG + Intronic
1069167695 10:65183911-65183933 ATGAAACAGAATAGAGAGGCAGG + Intergenic
1069386477 10:67887165-67887187 AAAAAACAGAAAAGATAGCCGGG - Intronic
1069466514 10:68644196-68644218 AAGAAACAAAATCAAAGGCCAGG - Intronic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069582999 10:69577863-69577885 AACAAAGGGAAGAGAGGGCCCGG + Intergenic
1069958682 10:72067205-72067227 CAGACCCAGAATAGAGGGCTGGG - Intronic
1070000528 10:72373156-72373178 AACAAACAAAATAAAGTGCCAGG - Intronic
1070154431 10:73824835-73824857 CAGAAACAGGAAAGAGGGCTGGG - Intronic
1070230949 10:74566495-74566517 AAGAAAGAGAAAACAGGCCCAGG - Intronic
1070378728 10:75860062-75860084 ACGGAACAGAATAGAGAGTCTGG - Intronic
1070491294 10:76979315-76979337 GAGAAACAGAAAAGAGAGCTGGG + Intronic
1070551873 10:77496299-77496321 AAGAAAGAGAGGACAGGGCCGGG + Intronic
1071275373 10:84049318-84049340 TAGAAACAGAGGAGAGGGCAAGG - Intergenic
1071279859 10:84091215-84091237 AAAAAAAAGAATAAAGGGGCTGG + Intergenic
1071303816 10:84279713-84279735 AATCTACAGAATAGAGGGCCAGG + Intergenic
1071440928 10:85693597-85693619 ATGAAACAGAATAGAGAACATGG + Intronic
1071521916 10:86336837-86336859 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1071932121 10:90484486-90484508 ATGAAACAGAATAGAGAATCCGG - Intergenic
1072502100 10:96027800-96027822 ATGGAACAGAATAGAGAACCCGG + Intronic
1072672132 10:97438210-97438232 AAAAAAAAGAAAAAAGGGCCGGG - Intronic
1073018768 10:100423426-100423448 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1073310278 10:102535189-102535211 AAGAAAGAGACAACAGGGCCGGG + Intronic
1073434661 10:103508899-103508921 AAGAAACCAAATACAGGGTCAGG + Intronic
1073624290 10:105080822-105080844 ATGAAACAGAATAGAGAGCATGG + Intronic
1073856472 10:107680968-107680990 ACGTAACAGAAGTGAGGGCCCGG + Intergenic
1073897735 10:108182860-108182882 ATGAAACAGAATAGAAAACCCGG - Intergenic
1074307746 10:112294704-112294726 AAAAACCAGATTAGAGGCCCTGG + Intronic
1074371600 10:112905029-112905051 AAGAAATAGCAGACAGGGCCCGG - Intergenic
1074466343 10:113684730-113684752 ACGGAACAGAATAGAGAGTCTGG - Intronic
1074629572 10:115236678-115236700 AAGACACATAATAGAGGACCTGG - Intronic
1074983231 10:118636041-118636063 CAGAAACAGAATAGAGACCTGGG - Intergenic
1075186011 10:120258076-120258098 ATGAAACAGAATGGAGAGCCCGG - Intergenic
1075774433 10:124971118-124971140 AACAAACAGAATTCAAGGCCAGG - Intronic
1076039391 10:127230591-127230613 ATGAAACAGGATAGAGAGCCTGG - Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076113818 10:127881494-127881516 CAGGACCAGAGTAGAGGGCCAGG - Intronic
1076241240 10:128909518-128909540 AAGAAACAAAAGAGAGTGTCAGG - Intergenic
1076309827 10:129497381-129497403 CAGAAACAGGAGAGAGGACCAGG - Intronic
1076399562 10:130172644-130172666 CATAAAAAGAATATAGGGCCAGG + Intronic
1077082711 11:731935-731957 TAAAAACAGTGTAGAGGGCCGGG - Intergenic
1078265166 11:9750040-9750062 AAGAAACAGCTTTGGGGGCCGGG + Exonic
1078438922 11:11348080-11348102 AAGAAAGAGAAGAGAGGGCCGGG + Intronic
1078656382 11:13244441-13244463 AAGAAAGGAAAGAGAGGGCCAGG - Intergenic
1078878713 11:15425843-15425865 GAGAACCAGACTAAAGGGCCTGG - Intergenic
1079196058 11:18328213-18328235 AAAAAAAAGAATATGGGGCCAGG + Intronic
1079339830 11:19602739-19602761 AAGATACAGAGGAGGGGGCCAGG - Intronic
1079567352 11:21899249-21899271 AGAAAACAGAATCAAGGGCCAGG + Intergenic
1079764645 11:24376432-24376454 AAGAAACTCAATACAGGGTCTGG + Intergenic
1079823130 11:25156945-25156967 ATGCAACAGAATAGAGAACCTGG - Intergenic
1081696504 11:45113280-45113302 ATGGAACAGAATAGAGAACCCGG - Intronic
1081928193 11:46848217-46848239 AAGAAAAAAAAAAAAGGGCCGGG - Intergenic
1081985970 11:47304523-47304545 AAAAAATACAATAGAGGGCCAGG - Intronic
1082086125 11:48051388-48051410 AAAAAACAGAAAACACGGCCAGG - Intronic
1082217416 11:49589324-49589346 AAAAAACAGATTTGAGGGCTTGG + Intergenic
1082685630 11:56235687-56235709 ACGGAACAGAATAGGGAGCCTGG - Intergenic
1082692272 11:56321190-56321212 GAGAAAGAGAATATAGAGCCAGG - Intergenic
1082836842 11:57657415-57657437 AGGAAACAGAAGGGAGGCCCGGG - Exonic
1082881912 11:58046232-58046254 AGGAAGCAGAATAGAGTTCCAGG - Intronic
1083175797 11:60949562-60949584 AAGAAAGAAAAGAGATGGCCAGG + Intronic
1083352270 11:62038676-62038698 ATGGAACAGAATAGAGAACCCGG - Intergenic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1083911017 11:65710078-65710100 AAAAAAAAGAATTGAGGGCGAGG - Intergenic
1083919731 11:65775881-65775903 AAGAAAAAAAAGAAAGGGCCTGG - Exonic
1083953217 11:65968241-65968263 TTTAAACAGAATAGAGGGCTGGG - Intronic
1084157785 11:67324107-67324129 AAAAAAAAGAATAGAGAGTCTGG - Intronic
1084286625 11:68135601-68135623 AAGAAAAAAAAAAAAGGGCCAGG + Intergenic
1085171117 11:74450762-74450784 AAGAAACAGAATAGAATTCCAGG - Intergenic
1086049738 11:82576551-82576573 AAAAAACAGAATAGAATGCAAGG - Intergenic
1086372958 11:86173217-86173239 AAGAAAGAGAGGAAAGGGCCAGG + Intergenic
1086386678 11:86316213-86316235 AGGAAAAAGAAAAGAAGGCCGGG + Intronic
1086671716 11:89556232-89556254 AGGAAACATAATAGAGGTTCTGG + Intergenic
1086923236 11:92611688-92611710 AAGAAATAGAAGGGTGGGCCAGG - Intronic
1087068630 11:94051967-94051989 ATGGAACAGAATAGAGAACCTGG - Intronic
1087119913 11:94562958-94562980 AAGGAACAGGAGAGAGGGCCTGG + Intronic
1087282286 11:96225168-96225190 AAGGAACAAAATAGAGGGGAAGG + Intronic
1087483207 11:98728295-98728317 ATGGAACAGAATAGATAGCCCGG + Intergenic
1087646296 11:100812094-100812116 AAGAAACTGAAGAGAGGGACAGG - Intronic
1088177017 11:107065176-107065198 AAGAAACAGCATAAAGGGAGAGG - Intergenic
1088197474 11:107291424-107291446 ATGAAACAGAATAGAGAACCGGG - Intergenic
1088248056 11:107838618-107838640 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1088406462 11:109485218-109485240 ATGGAACAGAATAGAGAACCTGG - Intergenic
1088515908 11:110633353-110633375 GTGCAACAGAATAGAGAGCCTGG - Intronic
1088745788 11:112803219-112803241 ATAGAACAGAATAGAGAGCCTGG + Intergenic
1088874966 11:113927852-113927874 AAAAAAGAGAAAACAGGGCCGGG - Intronic
1089252847 11:117177829-117177851 AATAAACAGTATATAGAGCCAGG - Intergenic
1089485427 11:118841898-118841920 AAGAAACAAAATAGAGATCATGG - Intergenic
1089546816 11:119233527-119233549 AATTAACACAAAAGAGGGCCAGG - Intronic
1089579915 11:119475197-119475219 GAGAAGCAGAATAGAGAGCCAGG - Intergenic
1089933278 11:122336073-122336095 AAGAAACAGAATAAAGGCATGGG + Intergenic
1089940105 11:122407234-122407256 AAAAAAAAGAATGAAGGGCCGGG + Intergenic
1089962682 11:122629774-122629796 AAGAAAAAAAAAAAAGGGCCAGG - Intergenic
1090010738 11:123043762-123043784 AAAAAAAAGAAAAGAGGGTCGGG + Intergenic
1090232485 11:125118500-125118522 AAGAAACAGACCTTAGGGCCGGG - Intergenic
1090483852 11:127094060-127094082 ATGAAACAGAAGAGAGAACCTGG + Intergenic
1090542745 11:127727086-127727108 AACAAACAAAATAGTGGCCCTGG + Intergenic
1090816434 11:130301042-130301064 AAGACACAGAAAAGAGGGAAAGG + Intronic
1091231442 11:133990543-133990565 AAGAAACAGAAAAGGAAGCCAGG - Intergenic
1091470431 12:721545-721567 AAGAAAGAAAATAGAGGGCCAGG + Intergenic
1091656606 12:2351013-2351035 AGGGAACAGACCAGAGGGCCTGG - Intronic
1091720647 12:2810870-2810892 AAGAAAAAGAAAAAAGGGGCCGG + Intergenic
1091895084 12:4096082-4096104 ATAAAACAGAATAGAGAACCTGG + Intergenic
1092207653 12:6625424-6625446 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1092922016 12:13240693-13240715 AAGAAACAGAAAAAAAGTCCAGG - Intergenic
1092933152 12:13336315-13336337 AAGAAACAGCATGCGGGGCCAGG - Intergenic
1093040922 12:14378391-14378413 AAAATACTGAATATAGGGCCGGG - Intronic
1093102600 12:15046010-15046032 AAGAAAAATAATAAAGGGACTGG - Intergenic
1093576287 12:20734067-20734089 AGGAAACAGAATATAGTGTCAGG - Intronic
1093582657 12:20801677-20801699 ATGGAACAGAATAGAGAGTCTGG + Intergenic
1093948832 12:25140873-25140895 ATGGAACAGAATAGAGAACCTGG + Intronic
1094577571 12:31701292-31701314 AAGAAATAAAAAATAGGGCCAGG - Intronic
1095229058 12:39715389-39715411 ATGGAACAGAATAGAGAACCCGG - Intronic
1095319621 12:40810563-40810585 TAGAAACAGAATAGAAGGTTAGG - Intronic
1095355420 12:41267441-41267463 AAAAAACAGAAGAGAGAACCAGG + Intronic
1095458699 12:42418202-42418224 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1095566827 12:43634062-43634084 AAGAAGCAGAGTGGAGGGCTGGG - Intergenic
1095972001 12:47908496-47908518 AACAAACTGAAAAGATGGCCTGG - Intronic
1096645979 12:53036077-53036099 AATAAAAAAAATAGAAGGCCAGG - Intronic
1097049776 12:56215423-56215445 AAAGAAGAGAAGAGAGGGCCGGG + Intronic
1097261419 12:57722391-57722413 AAGAAAAGGGATAGAGGGGCCGG + Intergenic
1097391405 12:59019336-59019358 AAGAAAAAGAATACAGGGACAGG - Intergenic
1097436783 12:59559768-59559790 AAGAAACATAATAGTGGGGTAGG - Intergenic
1097569466 12:61314866-61314888 GAAAAACAGTATATAGGGCCGGG - Intergenic
1097824216 12:64158068-64158090 AAGAAAAAGAACCCAGGGCCGGG + Exonic
1097833281 12:64248157-64248179 ATGAAACAGCATAGAGAACCCGG - Intergenic
1098146620 12:67504087-67504109 AAGGAACAGAATGGGGAGCCTGG + Intergenic
1098334323 12:69386840-69386862 AAAAAACAGTATATAGGGCTTGG - Intronic
1099035861 12:77586216-77586238 AAGATACAGAATAGAGTACCAGG - Intergenic
1099713937 12:86265491-86265513 ATGGAACAGAATAGAGAACCCGG - Intronic
1100061215 12:90578118-90578140 ATGGAACAGAATAGAGAACCCGG + Intergenic
1100061411 12:90580896-90580918 ATGGAACAGAATAGAGAACCCGG + Intergenic
1100664375 12:96735326-96735348 AAGGAACAGCATCGGGGGCCAGG + Intronic
1101953563 12:109194864-109194886 CTGAGACAGAATAGTGGGCCCGG + Intronic
1102070593 12:110015844-110015866 AAGAAAGTGAACAGATGGCCGGG - Intronic
1102198924 12:111044163-111044185 AAGAAACAGACTTGAAGGCAGGG - Intronic
1102449277 12:113028744-113028766 AAAAAAAAAAATAGGGGGCCAGG + Intergenic
1102639121 12:114350935-114350957 AAGAAACACATTTGTGGGCCAGG - Intergenic
1103082360 12:118035335-118035357 AAGAAACAGGATGGCAGGCCTGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103384086 12:120518100-120518122 AAGAAAGGAAATATAGGGCCAGG - Intronic
1103438161 12:120942882-120942904 AAGAAAGAAGAAAGAGGGCCAGG + Intergenic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103610752 12:122122840-122122862 AAGAAAAAGAAAAGAAGGCCGGG - Intronic
1103643234 12:122369865-122369887 TAGAAACAGCAAAGGGGGCCAGG + Intronic
1103652500 12:122443864-122443886 AAGAAATAGAAGAAAAGGCCGGG - Intergenic
1103812037 12:123622813-123622835 AAGCCACAGAAAAGCGGGCCGGG + Intronic
1103995229 12:124825373-124825395 CAAAAAAAGAACAGAGGGCCAGG + Intronic
1104143428 12:126009752-126009774 AAGAAACAGGAAGGATGGCCAGG + Intergenic
1105341561 13:19530818-19530840 AAGAAAAAAAATTTAGGGCCGGG - Intronic
1105946197 13:25192093-25192115 AAGATACAGTACACAGGGCCAGG + Intergenic
1106638812 13:31560932-31560954 ATGGAACAGAACAGAGGCCCCGG - Intergenic
1106649702 13:31677085-31677107 AAGGAACAGAACAGAGGCCTTGG + Intergenic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1106990650 13:35415562-35415584 ATGGAACAGAATAGAGCCCCTGG - Intronic
1106994953 13:35470793-35470815 AATAAACACAAAGGAGGGCCTGG + Intronic
1107083492 13:36400103-36400125 ATTAAACAGAATAGAGAACCTGG - Intergenic
1107085675 13:36425603-36425625 ATGTAACAGAATAGAGAACCTGG + Intergenic
1107502586 13:40995529-40995551 ATGGAACAGAATAGAGAGCACGG + Intronic
1107810751 13:44197622-44197644 GAGAAACAGAACAGCTGGCCAGG + Intergenic
1108420103 13:50240070-50240092 AAAAAAAAAAATAGTGGGCCGGG - Intronic
1108941474 13:55961288-55961310 ATGAAACAGGGTAGAGGACCTGG - Intergenic
1108973644 13:56408309-56408331 ATGAAACAGAATACAGAACCTGG + Intergenic
1109804049 13:67414761-67414783 AAGAAACAGAAAAGAAGGAAAGG + Intergenic
1109879017 13:68446681-68446703 AAGACTGAGAAGAGAGGGCCAGG + Intergenic
1110087797 13:71404381-71404403 AAGAAAGAGAAAAGAGGGGAAGG - Intergenic
1110445649 13:75576647-75576669 AAGAAATAAAATTCAGGGCCAGG - Intronic
1110485325 13:76034602-76034624 AATAAATACAATTGAGGGCCAGG + Intergenic
1110627264 13:77665261-77665283 GAGAAAAAGAAGAGAAGGCCAGG - Intergenic
1111021243 13:82455203-82455225 ATGGAACAGAATAGAGAGCCCGG + Intergenic
1111095632 13:83511456-83511478 GAGAAACAACCTAGAGGGCCTGG - Intergenic
1111107213 13:83662386-83662408 TAGAAACAGACTAGAGGAACTGG - Intergenic
1111156095 13:84328284-84328306 AAGAAATATAAAAGAAGGCCGGG - Intergenic
1111282041 13:86039203-86039225 AGGAAACAGACAAGTGGGCCTGG - Intergenic
1111392105 13:87609541-87609563 AAAAGAAAGAAAAGAGGGCCAGG - Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1112107781 13:96260611-96260633 AAAGAAAAGAAAAGAGGGCCGGG - Intronic
1112137354 13:96595883-96595905 AAGAAACTGAATAGAGAGCTTGG - Intronic
1112620565 13:101050181-101050203 AAGAAGAAGAATAGAGGTGCTGG - Intergenic
1112916711 13:104560110-104560132 ATGGAACAGAATAGAGAGCCCGG - Intergenic
1113244487 13:108379086-108379108 ATGAAACAAAATAGAGATCCAGG - Intergenic
1113288578 13:108880691-108880713 ATGGAACAGAATAGAGCCCCCGG - Intronic
1113404059 13:110021796-110021818 AGCAAAGAGAAAAGAGGGCCTGG + Intergenic
1113656441 13:112070859-112070881 AAGAAAAAGAAAAGAGGGGGGGG - Intergenic
1113754609 13:112802381-112802403 ATGAAACATCATAGAGAGCCTGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114288960 14:21272035-21272057 AACAAACAAAAGACAGGGCCTGG - Intergenic
1114433413 14:22682611-22682633 ATGGAACAGAATAGAGCCCCCGG + Intergenic
1114507294 14:23226936-23226958 AAGAAACAGACTGAAGGGCCGGG - Intronic
1114719658 14:24867466-24867488 ATGCAACAGAATAGAGAGGCTGG + Intronic
1115429600 14:33300917-33300939 TAGAAATAGGATTGAGGGCCAGG + Intronic
1115530825 14:34325353-34325375 AAGAAAGGGAGTTGAGGGCCAGG - Intronic
1115661632 14:35500572-35500594 AAGAAAAGAAATAAAGGGCCAGG + Intergenic
1116194762 14:41709972-41709994 AAAAAACTGAATACAGGCCCTGG - Intronic
1116722379 14:48515118-48515140 ATGGAACAGAATAGAGAGCCCGG - Intergenic
1117345906 14:54832154-54832176 ATGAAACCGAATAGAGAACCCGG - Intergenic
1117461499 14:55949779-55949801 ATGAAACAGAGTAGAGAGCCCGG + Intergenic
1117660592 14:58000340-58000362 TAGAAAAAGAATAGAAGGCTGGG - Intronic
1117856350 14:60038094-60038116 ATGGAACAGAATAGAGCCCCTGG - Intronic
1117983650 14:61366384-61366406 AAGAAACAGAAAAGGATGCCTGG - Intronic
1118083163 14:62385651-62385673 ATGGAAAAGAATAGAGAGCCTGG - Intergenic
1118223434 14:63876779-63876801 AAGAAACATATTTGGGGGCCAGG - Intronic
1118255337 14:64200596-64200618 AAGTAACAGAATCCAGGACCAGG - Intronic
1118289497 14:64506235-64506257 AAGAAACAGGAAACTGGGCCGGG + Intronic
1118591881 14:67407990-67408012 ATAAAATAAAATAGAGGGCCGGG + Intronic
1118827004 14:69393019-69393041 AAGAATTAGAGTAGATGGCCTGG + Intronic
1118846965 14:69554786-69554808 AAGAACCCCAAAAGAGGGCCTGG - Intergenic
1119173043 14:72549223-72549245 AAAAAACAGAAAAGAAGGCAAGG - Intronic
1119517282 14:75258204-75258226 AAGAAACAGAGGAGAGGGCCAGG - Intronic
1119735763 14:76980765-76980787 AGGACACAGAAGAGAGGGGCTGG - Intergenic
1119869954 14:78008536-78008558 GAGAAAAAAAATACAGGGCCAGG - Intergenic
1120541982 14:85762066-85762088 AAGAAACAGAATGGAGCCTCAGG - Intergenic
1120959255 14:90109703-90109725 AAAAAAAAAAATAAAGGGCCAGG - Intronic
1120998183 14:90432574-90432596 AAGAAAAAAAAAAGGGGGCCAGG - Intergenic
1121400400 14:93671475-93671497 AAAAAACAAAAAACAGGGCCAGG + Intronic
1121686143 14:95836650-95836672 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1121703132 14:95971405-95971427 AAGAAAAATATTTGAGGGCCGGG - Intergenic
1122510918 14:102266875-102266897 ATGAAATGGAAAAGAGGGCCGGG - Intronic
1122607535 14:102957373-102957395 CATTAACAGAGTAGAGGGCCCGG - Intronic
1123450369 15:20356165-20356187 AAGAAAGAGAAGAAAAGGCCGGG - Intergenic
1123587694 15:21773794-21773816 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123624332 15:22216359-22216381 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123684020 15:22784809-22784831 AAGAAATATAAAATAGGGCCGGG - Intronic
1123852314 15:24371649-24371671 AAGAAAAAGAAGTGAAGGCCAGG - Intergenic
1124131463 15:26991247-26991269 ATGGAACAGAATAGAGGACCTGG - Intronic
1124553303 15:30702756-30702778 AAGGAACAGAATAGAGAACCCGG - Intronic
1124677940 15:31702912-31702934 AAGGAACAGAATAGAGAACCCGG + Intronic
1125461659 15:39913247-39913269 TAGAAACAGAAAGTAGGGCCAGG + Intronic
1125845674 15:42850928-42850950 AAGAAACTGAAAATATGGCCAGG + Intronic
1126365604 15:47891017-47891039 AAGCAACTGAATAGATGGCTTGG + Intergenic
1126389541 15:48131818-48131840 GGCAAACAGAATAGAGGGCCTGG + Intronic
1126652545 15:50938846-50938868 AGGAGACAGAGTAGAGAGCCTGG + Intronic
1126828670 15:52576984-52577006 AAAAAACAGATTATAGGGCTGGG - Intergenic
1126919153 15:53501348-53501370 ATGGAACAGAATAGAGAACCCGG - Intergenic
1127300592 15:57649817-57649839 AAGAAAGAGGATAGAGGGGATGG - Intronic
1127537814 15:59907007-59907029 AAGAAACAGAAGGCAGGACCAGG - Intergenic
1127765598 15:62183269-62183291 AAGAAAGAGAAGAGAGGGAGGGG - Intergenic
1128070435 15:64792731-64792753 AAAATACAGCATACAGGGCCAGG + Intergenic
1128404486 15:67321605-67321627 AAGAAAGAGAAGAGAGGGAAAGG - Intronic
1128527425 15:68421992-68422014 AAGAAACCAACCAGAGGGCCAGG - Intronic
1129096513 15:73214601-73214623 ATGGAACAGAATAGAGAACCTGG - Intronic
1129177486 15:73850523-73850545 AAGTGAGAGAATAGAGGGCTTGG - Intergenic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1129928676 15:79389418-79389440 ATGGAACAGAATAGAGAACCCGG - Intronic
1129965095 15:79727899-79727921 ATGGAACAGAACAGAGAGCCTGG - Intergenic
1130157595 15:81365375-81365397 AAGAAACAGAAAAAAGGGCCGGG + Intronic
1130524476 15:84692325-84692347 TAGAAAAGTAATAGAGGGCCGGG - Intronic
1130824451 15:87529833-87529855 AAGAAAGAGAAAAGAGGGGAGGG + Intergenic
1131185134 15:90267396-90267418 TAAAAAAAGAATTGAGGGCCAGG - Intronic
1131717941 15:95133756-95133778 ATTAAACAGAAAAGAGGGCCGGG + Intergenic
1132003598 15:98205365-98205387 ATGCAAAAGAATAGAGAGCCTGG + Intergenic
1132318483 15:100908142-100908164 AGAAAAAAGAAGAGAGGGCCAGG - Intronic
1132542357 16:516579-516601 AACGAACAGAAAAGAGGGCCGGG + Intronic
1133082775 16:3336654-3336676 AAGAAAAAGAAACTAGGGCCGGG - Intergenic
1133208029 16:4245797-4245819 AAGAAAAAGAAAAAATGGCCAGG - Intergenic
1133465293 16:6021357-6021379 AAAAAAAAGATGAGAGGGCCTGG + Intronic
1133719334 16:8479870-8479892 AAGAGAGAAAATAGTGGGCCGGG + Intergenic
1133820317 16:9230165-9230187 ACAAAACAGAATAGAGAACCCGG - Intergenic
1134144047 16:11745756-11745778 TAGAAAAAGTATAGTGGGCCGGG - Intergenic
1134475533 16:14570352-14570374 AAGAAAAAGGAAAGAGGGCCGGG + Intronic
1134505798 16:14805912-14805934 AGGAAACAGAGTGGAGGGGCAGG - Intronic
1134574783 16:15323035-15323057 AGGAAACAGAGTGGAGGGGCAGG + Intergenic
1134727662 16:16433439-16433461 AGGAAACAGAGTGGAGGGGCAGG - Intergenic
1134815194 16:17199924-17199946 AAGAAACAGCATTTAGGGGCCGG + Intronic
1135240607 16:20804367-20804389 AAGAAACAAAAGATAGGGCCAGG + Intronic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1135740576 16:24971900-24971922 AAGACACTGAACAGAGGCCCGGG - Intronic
1135779807 16:25290470-25290492 AAGAAAAAGAAAAGCAGGCCAGG - Intergenic
1135813628 16:25611935-25611957 AAGGAAAAGAAAAGAGGGACAGG - Intergenic
1136471825 16:30485827-30485849 AAGAAATATCAGAGAGGGCCGGG - Intronic
1136523565 16:30813555-30813577 AAAAAAAAGAAAAGAGGGCCAGG + Intergenic
1137367561 16:47873823-47873845 ACCAAACAGAACAGAGGTCCAGG - Intergenic
1138603127 16:58069404-58069426 AAGAAACAGAACATGAGGCCAGG - Intergenic
1138649709 16:58452745-58452767 AAGAAAAAGAACAGAGACCCTGG + Intergenic
1139190819 16:64860960-64860982 AAGAAAAAGAAAAAAAGGCCCGG + Intergenic
1139197302 16:64934490-64934512 AAGAAACACAGTAGTTGGCCAGG + Intergenic
1139574070 16:67830404-67830426 AAGACACAGAGCAGTGGGCCTGG - Exonic
1139604055 16:68005340-68005362 AAAAAACAAAAAACAGGGCCAGG - Intronic
1139656621 16:68391217-68391239 AAGCAGCAAAACAGAGGGCCTGG + Intronic
1139897662 16:70300502-70300524 AAGAAACAGAAAAAAGAGGCTGG - Intronic
1140382856 16:74506039-74506061 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1140643481 16:77003958-77003980 AAGCAAGAGAATTGAGGGCTGGG - Intergenic
1140921621 16:79543656-79543678 AAGAAAAAGAAAAGAGGGCCTGG - Intergenic
1141101949 16:81203892-81203914 ACAAAACAGAATAGAGTGCTCGG + Intergenic
1141322033 16:83020250-83020272 AATAACCAGAATAAAAGGCCAGG - Intronic
1141399208 16:83732521-83732543 GAGCAACAGAATAGAGGACCCGG + Intronic
1141485728 16:84339036-84339058 ATGGAACAGAATAGAGAACCCGG + Intergenic
1141571417 16:84936181-84936203 AAGAAAAAGAATAGCAGGCTGGG + Intergenic
1142047643 16:87935875-87935897 AAAAAAGAAAAAAGAGGGCCGGG + Intronic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1142663517 17:1447910-1447932 AAAAAAGGGAAAAGAGGGCCGGG - Intronic
1142689394 17:1596023-1596045 AAGAAAGTGAAAAGAGAGCCGGG + Intronic
1142871464 17:2823826-2823848 AAGAAACAGCACATGGGGCCGGG + Intronic
1143324638 17:6090747-6090769 GAGAAACTGATTAGGGGGCCTGG + Intronic
1144067221 17:11635474-11635496 AAAAAATTGAAAAGAGGGCCGGG - Intronic
1144328996 17:14207474-14207496 AAGAAACAGAATAGAGGGTGGGG - Exonic
1144399322 17:14880218-14880240 ATGGAACAGAATAGAGAACCCGG - Intergenic
1144519404 17:15944405-15944427 AGGAAAGAAAAAAGAGGGCCCGG + Intergenic
1144759971 17:17701588-17701610 AAGAAAGAAAAAAGAGGGGCTGG - Intronic
1145034100 17:19528177-19528199 TAAAAAGAGAATCGAGGGCCGGG + Intronic
1145092180 17:19995112-19995134 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1145232856 17:21187328-21187350 AAAAAACAAAACAGAAGGCCGGG + Intronic
1146597235 17:34180163-34180185 ATGGAACAGAATAGAGGGCCCGG + Intergenic
1147255545 17:39179291-39179313 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1147404281 17:40199893-40199915 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1147433988 17:40395448-40395470 AAGAAACAGAAAAGAGAACCAGG - Exonic
1147902067 17:43793820-43793842 ATGGAACAGAATAGAGCCCCCGG - Intergenic
1147962900 17:44178466-44178488 AAAGAAAAGAAAAGAGGGCCAGG - Exonic
1148430312 17:47637593-47637615 AAGAAGCATTACAGAGGGCCGGG - Intergenic
1148433200 17:47659744-47659766 AAGAAACAGGATATATAGCCAGG + Intronic
1148520226 17:48266803-48266825 AAGAAAAGGAAAACAGGGCCGGG - Intronic
1148612836 17:48975916-48975938 AAGAAAAAGAAAAGAAAGCCAGG + Intergenic
1148839049 17:50483046-50483068 AAGAAAAAGAAAAAAGGGCCTGG + Intronic
1148972603 17:51497636-51497658 ACCAAACAGAATAGAGGGCCAGG - Intergenic
1149048696 17:52278651-52278673 AAGAAACATAAGAATGGGCCGGG - Intergenic
1149404424 17:56332619-56332641 ATGACACAGCATAGAGAGCCAGG - Intronic
1149786073 17:59436175-59436197 AAAAAATAGAATGGTGGGCCAGG - Intergenic
1150216434 17:63473517-63473539 AAGAAAATGAAAAGACGGCCAGG - Intergenic
1151265522 17:72952335-72952357 AAGAAACAGCATGGAGGGAGAGG + Intronic
1151715603 17:75829586-75829608 AAAAAAAAAAAAAGAGGGCCAGG - Intronic
1151800245 17:76375054-76375076 AAAAAACAAAATTGAGGGGCTGG - Intronic
1152015247 17:77746498-77746520 AGGGAACAGGATAGAGGGCCTGG - Intergenic
1152402800 17:80078606-80078628 ACGGAACAGAATAGAGAGTCTGG - Intronic
1152576204 17:81142247-81142269 AAGAAAAAAAAGAGCGGGCCTGG - Intronic
1152804008 17:82346316-82346338 ACGAAAGAGCAAAGAGGGCCGGG + Intergenic
1203161233 17_GL000205v2_random:52413-52435 ATGAAACAGAATAGACATCCTGG - Intergenic
1153094750 18:1388101-1388123 ATGGAACAGAATAGAGAACCAGG + Intergenic
1153114198 18:1634680-1634702 AAGAAACAGAATAGAAAGTCCGG + Intergenic
1153672469 18:7425209-7425231 ATGGAACAGAATAGAGAGTCCGG - Intergenic
1153732362 18:8027885-8027907 AAGAGACAGAAGACAGGGGCTGG - Intronic
1154085488 18:11301050-11301072 ATGAAACAGAATAGAGAACACGG - Intergenic
1154238656 18:12631089-12631111 AAGAAACAGAATAGGGAGGTAGG - Intronic
1154241128 18:12655054-12655076 AAGAAAAAGAAAAGAGAGACTGG + Intronic
1154362681 18:13677058-13677080 AAAAAAAAAAATAGAGGGACAGG - Intronic
1154374630 18:13798913-13798935 GAGAAACAGAGCAGAGGACCAGG - Intergenic
1154396295 18:13992972-13992994 AACAAACAGCAGAGAAGGCCGGG - Intergenic
1155764778 18:29614754-29614776 ATGAAACAGAATAGGGAACCTGG + Intergenic
1155907344 18:31467965-31467987 AAGAAAGATCAGAGAGGGCCGGG + Intronic
1156330270 18:36115144-36115166 AAAAAACTGAAGAGGGGGCCGGG + Intronic
1156954861 18:42950217-42950239 ATGGAACAGGATAGAGAGCCCGG + Intronic
1157249889 18:46085634-46085656 AAAAAACAGAATACAGGGCCGGG + Intronic
1157707147 18:49816694-49816716 TAGAAAAAGAATAATGGGCCAGG - Intronic
1158342351 18:56480390-56480412 AAGAAAAAGAAAAAAGGGCCAGG + Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158403233 18:57139710-57139732 AAGAAAAAGAGGAGAGGGGCAGG + Intergenic
1158434282 18:57424287-57424309 AAGAAACAGAACAGAGAGAGAGG - Intergenic
1158577668 18:58652884-58652906 CAGAAACATAATACATGGCCGGG - Intergenic
1159048362 18:63392741-63392763 AAAAAACAAAAAATAGGGCCAGG - Intronic
1160596806 18:79981374-79981396 AATAAACAGAGTGCAGGGCCAGG + Intronic
1161048130 19:2147598-2147620 AAGAAAAAGAATATATGGGCTGG + Intronic
1161215540 19:3093603-3093625 AAAAAAAAAAAAAGAGGGCCGGG - Intergenic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1161338193 19:3725956-3725978 GAGAAACAGAGCAGAGGGCAGGG - Intronic
1161373879 19:3928948-3928970 AAAAAACAGAAAAGAAGGCCGGG + Intergenic
1161417545 19:4156042-4156064 AAGAAAGAGAAAAAAGGGCCGGG - Intronic
1161616796 19:5275363-5275385 AAGAAAAAGAAAAGAAGGCTGGG - Intronic
1161636298 19:5391364-5391386 ATGAAACAGAAAGGAGGGCCAGG - Intergenic
1161803837 19:6430781-6430803 AAGAAAAGGAAAAGAAGGCCAGG - Intronic
1161895832 19:7079533-7079555 AAGAAACAAAAAAATGGGCCGGG - Intronic
1162216414 19:9137624-9137646 AAGGAACAGAACAGAGAGCCTGG + Intergenic
1162319386 19:9961851-9961873 AAGTAAAAGAATTCAGGGCCAGG - Intronic
1162355082 19:10178259-10178281 AAAAAATAAAATAAAGGGCCAGG + Intronic
1162569318 19:11461759-11461781 AAGAAACAGAAAATAGAGGCTGG - Intronic
1162704133 19:12542706-12542728 AAGGAAAAGAAAAAAGGGCCGGG + Intronic
1163047618 19:14656048-14656070 AAGAAAAAGAAAAGAGGGCAGGG + Intronic
1163285082 19:16341660-16341682 AAGAAAGAGATTATAGGGCCGGG + Intergenic
1163309556 19:16505202-16505224 AACAGACAGAAGACAGGGCCGGG - Intronic
1163407022 19:17129100-17129122 AAGAAACAGCATCAAGGGACCGG + Intronic
1163715657 19:18870668-18870690 AAGAAGCGGGAAAGAGGGCCAGG - Intronic
1164253684 19:23508377-23508399 AAATAACAGGATACAGGGCCAGG + Intergenic
1164278779 19:23749987-23750009 AAGAAAAAAAAAAAAGGGCCGGG + Intronic
1164498123 19:28787999-28788021 AAAAAAAAAAATGGAGGGCCGGG + Intergenic
1165245658 19:34497156-34497178 AAGATTCAGAAAAGAAGGCCTGG - Intronic
1165535847 19:36443808-36443830 ATGGAACAGAATAGAGAACCTGG - Intergenic
1165688682 19:37845110-37845132 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1165885158 19:39072794-39072816 AAAAAACAAAATACATGGCCAGG + Intergenic
1166061808 19:40330531-40330553 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1166184448 19:41130760-41130782 AAAAAAAAGAAAAGAGGGGCTGG - Intergenic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166568319 19:43778532-43778554 AGAAAAGACAATAGAGGGCCGGG - Intronic
1166839229 19:45686414-45686436 AAGAAACAGAAAAAAGGGCCGGG - Intergenic
1167075786 19:47248204-47248226 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1167129824 19:47577154-47577176 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1167245829 19:48372655-48372677 AAAAAACAGACGAGAGGGACAGG + Intronic
1167298878 19:48667864-48667886 AAAAAAAGAAATAGAGGGCCGGG + Intronic
1167302657 19:48687735-48687757 AAAAAACAGAAAGTAGGGCCGGG - Intergenic
1167308942 19:48725283-48725305 AAGAAAAAGAATGGAGAGTCAGG + Intronic
1167347240 19:48954358-48954380 AACAAACAGAAAAGCAGGCCTGG + Intergenic
1167481918 19:49737910-49737932 AAGAAACAGAAAAATAGGCCGGG - Intergenic
1167620755 19:50559137-50559159 AAGAAAAAGAAAAGAGGGCCGGG + Intronic
1167897709 19:52594487-52594509 AAAAAACAGAACAAAAGGCCAGG - Intronic
1168218020 19:54940529-54940551 AAGTACCAGAAATGAGGGCCAGG + Intronic
1168529909 19:57119373-57119395 AAGAGACAGAAGAGAGGGTGCGG - Intronic
925462565 2:4075884-4075906 AAGAAAGAGAAGAGAGGGGAGGG - Intergenic
925898740 2:8493714-8493736 AACAAACAGAATTGGGGGGCTGG - Intergenic
926038027 2:9650171-9650193 AAGAAAGAAACTAGAGGGCAAGG + Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
926287602 2:11502210-11502232 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
926432269 2:12800187-12800209 ATGGAACAGAATAGAGAGCCCGG + Intergenic
926950197 2:18234467-18234489 AAGAGTCAGAATAGAAAGCCGGG - Intronic
927396610 2:22658530-22658552 ATAAAACAGAATAGAAAGCCTGG + Intergenic
927475100 2:23408072-23408094 ATGAAACAGAATAAACAGCCTGG - Intronic
927790354 2:26004691-26004713 AAGAAACAGAACACAAGGCTGGG + Intergenic
927790793 2:26007893-26007915 AAAAAAAAAAATAGAGGGCTGGG - Intergenic
928090132 2:28368861-28368883 AAGGGACAGAAAGGAGGGCCAGG - Intergenic
928672926 2:33621138-33621160 AAGAAAGCAAATACAGGGCCAGG + Intergenic
929397896 2:41544481-41544503 AAGAAAGAGAATATAAGGCTGGG - Intergenic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929523857 2:42681223-42681245 AAGACAAAGAATAGATGGCCAGG - Intronic
929530377 2:42747293-42747315 AAGAATCTGAACAGGGGGCCAGG - Intronic
929580739 2:43080443-43080465 AAGGAACAGTATGGAGGGACTGG + Intergenic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
930182199 2:48371436-48371458 ATGGAACAGAATAGAGAACCTGG - Intronic
930211213 2:48639361-48639383 ATGGAACAGAATAGACAGCCAGG + Intronic
931169785 2:59790680-59790702 AAGAAGAAGAAAAGAGGGACAGG + Intergenic
931532499 2:63231993-63232015 ATGCAACAGAATAGAGCCCCCGG + Intronic
931537167 2:63291836-63291858 AAGAAAAAGAAAAGAAGGCCGGG + Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931736936 2:65204046-65204068 ATGAAACAGAATAGTGAACCCGG + Intergenic
931798502 2:65735437-65735459 ATGGAACAGAATAGAGAACCTGG - Intergenic
932139447 2:69262684-69262706 AAGAAACACAATGTAGGGCCTGG + Intergenic
932253403 2:70263952-70263974 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
932601750 2:73132075-73132097 CAGAAACAGAATAGAAAGTCTGG + Intronic
932652922 2:73579353-73579375 AAGAAAAAAAAAAGAAGGCCAGG - Intronic
932824426 2:74926653-74926675 AAAAAAAAAAATACAGGGCCGGG - Intergenic
932926053 2:75976170-75976192 ATGGAACAGAATAGAGAACCAGG - Intergenic
933281637 2:80338282-80338304 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
933297993 2:80512312-80512334 AAGAAAAGGAATATAGGGCATGG + Intronic
933518521 2:83338236-83338258 ACGAAACAGAATAAAAAGCCAGG + Intergenic
933524731 2:83421549-83421571 ATGGAACAGAATAGAGAACCCGG + Intergenic
933627281 2:84615362-84615384 ATGGAACAGAATAGAGAACCTGG - Intronic
933790094 2:85876751-85876773 AGGAAACAGTGTAGAGGGTCGGG - Intronic
933832092 2:86219222-86219244 AAGACACAGCATATAGTGCCTGG - Intronic
933844364 2:86313688-86313710 AAAATACAGAATCAAGGGCCAGG + Intronic
933870356 2:86559969-86559991 CATAAAAAGAAAAGAGGGCCGGG + Intronic
934314666 2:91906141-91906163 ATGAAACAGAATAGAGCCCTCGG + Intergenic
934694851 2:96392335-96392357 GAGAAAGAGAGTAGGGGGCCAGG + Intergenic
934925481 2:98379380-98379402 AAGAAACAGAATGGAGTCTCTGG + Intronic
934948450 2:98559330-98559352 AACAAACAGAAAAGAGGTCTGGG - Intronic
935032671 2:99337508-99337530 GAGAGACCGAATAGAGGGGCTGG + Exonic
935209591 2:100927359-100927381 TAGAAAAAGAATGGAGTGCCAGG - Intronic
935251598 2:101266913-101266935 TAGATACAGATTAGATGGCCAGG + Intronic
935484399 2:103635332-103635354 TAAAAATAGAATAGGGGGCCGGG - Intergenic
936395903 2:112129776-112129798 AAGAAAAAGAAAAAAGAGCCGGG + Intergenic
936406227 2:112206703-112206725 AAGAAAGATAATAGAAGCCCAGG - Intergenic
936597480 2:113862723-113862745 AAGAAAAAGTAAATAGGGCCAGG + Intergenic
936851259 2:116900730-116900752 AAGAAAAAGAAAAAAAGGCCAGG - Intergenic
937341154 2:121091444-121091466 AAGGAAAAGAAGAGAGGGGCTGG + Intergenic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
937699166 2:124844340-124844362 ATGGAACAGAATAGAGAACCTGG - Intronic
937880082 2:126858340-126858362 AAGAAACAGAATGGAGGAATGGG - Intergenic
938897050 2:135762840-135762862 AAGGTACAGAGTAGTGGGCCTGG - Intronic
938991297 2:136632655-136632677 GAGGAACAGAATTGAGGGTCTGG + Intergenic
939188495 2:138888001-138888023 AGGAAACAGACAAGAAGGCCAGG - Intergenic
940193921 2:151072277-151072299 GAGTAAAAGAATAGAGGGCAGGG - Intergenic
940782461 2:157947109-157947131 AAAAAACAGAAGTGAGTGCCAGG - Intronic
941272481 2:163448342-163448364 TTGAAACACATTAGAGGGCCAGG + Intergenic
941452418 2:165675685-165675707 AAGACAAAGAACAGAGGGCAGGG - Intronic
941680942 2:168398472-168398494 ATGGAACAGAATAGAGAACCTGG - Intergenic
941731364 2:168921837-168921859 AAGAAAAAGAAAAGAGGTCAAGG - Intergenic
941975247 2:171397216-171397238 ATGAAATAGAAAACAGGGCCAGG + Intronic
942140300 2:172970746-172970768 AAAAAACAGAATAGAGCTTCAGG + Intronic
942242045 2:173971833-173971855 AAGAAACAAAATATAGGGCTGGG + Intergenic
942454108 2:176125721-176125743 AAGAAAAAGCATAGGGGGGCTGG + Intergenic
943338252 2:186645412-186645434 AATAAACAGAAAAAAAGGCCAGG + Intronic
943733973 2:191333524-191333546 AAGAAAAGGAAGAGAGAGCCTGG - Intronic
944165682 2:196717593-196717615 AAGAAGCAGGATAAAGGGGCGGG + Intronic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944558787 2:200914459-200914481 AAGAAATAAAAAAGCGGGCCGGG - Intronic
944630265 2:201617370-201617392 ATGGAACAGAATAGAGCCCCCGG + Intronic
944730811 2:202515592-202515614 AAGAAAAAGAAAATATGGCCAGG + Intronic
945378135 2:209104032-209104054 ATGGAACAGAATAGAGAACCCGG + Intergenic
945548448 2:211188141-211188163 AATCAACAAAATAGAGGGCTGGG + Intergenic
945760397 2:213906678-213906700 ATGAAACAGCTTAGAGAGCCTGG + Intronic
945940933 2:215949262-215949284 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
946091984 2:217235051-217235073 AAGGCACAAAATAGAGAGCCAGG - Intergenic
946177044 2:217928412-217928434 AGGAAACAGACTAGCAGGCCAGG - Intronic
946205468 2:218103910-218103932 ATGGAACAGAATAGAGCCCCCGG - Intergenic
946237975 2:218336774-218336796 AAAAAAAAGAATTGAAGGCCAGG - Intronic
946408618 2:219505691-219505713 TAGAAGCAGAAGAGAGGCCCTGG - Intronic
946693586 2:222329625-222329647 AAAAAAAAAAATAGAGAGCCCGG - Intergenic
947041422 2:225925282-225925304 AAGTAACAGCATAGACTGCCAGG - Intergenic
947486757 2:230557340-230557362 AAAAAAAAAAATAGAGGGCACGG + Intergenic
947640284 2:231703802-231703824 AAGAAACAGAGAGGACGGCCAGG - Intergenic
948722244 2:239908408-239908430 AAGAAAAAGAAAAGATGTCCTGG + Intronic
948969942 2:241417616-241417638 AAGAAACACCACAGAGGGCCGGG - Intronic
949007876 2:241660330-241660352 AAGAAACAGAATGGAGAGGCAGG - Intronic
949030450 2:241794435-241794457 AAGAAAGAGAAGAGAGGCCTGGG - Intronic
1168920809 20:1534226-1534248 ATGAAACAGAAGAGAGAACCTGG + Intergenic
1169084542 20:2818573-2818595 AAGAAACAGAAAGGAAGGACTGG - Intronic
1169116573 20:3070166-3070188 AAGAAACCAATTACAGGGCCAGG + Intergenic
1169133336 20:3179618-3179640 TTGAAAAAGAATAGAGGGGCTGG - Intergenic
1169211967 20:3770947-3770969 ATTAAAAAGAATAGAGGGCTGGG - Intergenic
1169245480 20:4021249-4021271 AAAGAAAAGAAAAGAGGGCCAGG - Intergenic
1169735412 20:8832670-8832692 AAGAATCAGAATCGAAAGCCTGG + Intronic
1170322107 20:15111463-15111485 AGAAAACACACTAGAGGGCCAGG - Intronic
1170583566 20:17716883-17716905 AAGAAAAAGAAAAGAGAGACGGG + Intronic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171749564 20:29035679-29035701 AAGAAAGAGAAAAGCAGGCCGGG + Intergenic
1172161409 20:32871145-32871167 AAGAAGAAGTAGAGAGGGCCGGG - Intronic
1172246033 20:33445513-33445535 AAGAAAAAAAAGAGGGGGCCAGG + Intergenic
1172304722 20:33872661-33872683 AAGAAAAAGCACAGATGGCCGGG + Intergenic
1172725138 20:37033921-37033943 AAGAAAAAAAAAAGGGGGCCCGG - Intronic
1173443121 20:43095579-43095601 AAGAAAGAGAGGAGAGGGCAAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1174203462 20:48823267-48823289 TCGAAAGAGAAGAGAGGGCCTGG - Intronic
1174627240 20:51925992-51926014 AACAAACAGGATACAAGGCCAGG + Intergenic
1174628711 20:51937617-51937639 AAGAAAGAAAATTAAGGGCCAGG - Intergenic
1174679273 20:52389565-52389587 AAGAAACAGAAGAGTGGTCCAGG - Intergenic
1174807687 20:53618705-53618727 TTGAAACAGAATAGAGGGCCAGG - Intergenic
1174854900 20:54034947-54034969 ATGGAACAGAATAGAGAACCCGG + Intronic
1174954667 20:55084203-55084225 AAAAAAAAAAAGAGAGGGCCGGG - Intergenic
1175776860 20:61659144-61659166 AAGAGACAGGAAGGAGGGCCTGG + Intronic
1176315672 21:5240324-5240346 AAGAAAGAGAAAAGCAGGCCGGG - Intergenic
1177053764 21:16273516-16273538 AAATAACTGAATAAAGGGCCGGG + Intergenic
1177336225 21:19732012-19732034 AAGAAAGAAAAAAGAAGGCCGGG - Intergenic
1177454520 21:21318900-21318922 AAGAAACAGAATACAGAAGCAGG + Intronic
1177493303 21:21856213-21856235 ATGGAACAGAATACAGAGCCCGG - Intergenic
1177556002 21:22689456-22689478 AAAAAACAGAATTGAGGGTGAGG - Intergenic
1177753171 21:25311479-25311501 ATAAAACAGAATGGAGAGCCTGG + Intergenic
1177812376 21:25938067-25938089 AATAAACAGTATAAAAGGCCAGG - Intronic
1177896902 21:26863945-26863967 AACAGACAGAATAGAGGGGTTGG + Intergenic
1177907039 21:26984229-26984251 TAGGAAAAGAATAGAGGGCAAGG + Intergenic
1178071613 21:28974634-28974656 AAGAACCAGGAAAGAAGGCCAGG + Intronic
1178364387 21:31976760-31976782 AAAAAAAAAAAAAGAGGGCCAGG - Intronic
1178368691 21:32009220-32009242 AAACAAAAAAATAGAGGGCCTGG + Intronic
1178799144 21:35776321-35776343 CAGAAACAGTAAAGAGGGCGTGG + Intronic
1178842218 21:36146884-36146906 AAGAAAGAGAAAAAAAGGCCGGG - Intergenic
1179316171 21:40246219-40246241 AAGAAGCAGAAAAGAGGCTCTGG + Intronic
1179677916 21:42997174-42997196 AATAAACAGCATATGGGGCCAGG - Intronic
1180078957 21:45477722-45477744 AATAAACAGAACACAGGGCTCGG - Intronic
1180541431 22:16452025-16452047 ATGAAACAGAATAGAGCCCTCGG + Intergenic
1180977695 22:19858560-19858582 ATGGAACAGACTAGAGAGCCTGG - Intergenic
1181272706 22:21669004-21669026 AAAAAAAAAAATAGAGGGCCAGG - Intronic
1181379597 22:22490761-22490783 AAGAAATAGCAGGGAGGGCCAGG - Intronic
1181970053 22:26683091-26683113 AAGAAAAAAAAAAGAAGGCCAGG - Intergenic
1182137089 22:27916514-27916536 AAAAAAATAAATAGAGGGCCAGG + Intronic
1182595018 22:31412642-31412664 AAGAAAAGAAAGAGAGGGCCAGG - Intronic
1182698900 22:32216325-32216347 AAGAAACATGGAAGAGGGCCGGG - Intergenic
1182938252 22:34247564-34247586 AAGAAATAGGAAAAAGGGCCGGG - Intergenic
1182997947 22:34831709-34831731 AAGAAAAAGCACAGTGGGCCGGG + Intergenic
1183047563 22:35232344-35232366 AAGAAGCAGAAAATATGGCCAGG - Intergenic
1183218602 22:36497338-36497360 AAGAAAAAAAAAAGAGGGGCAGG + Intronic
1183644990 22:39120178-39120200 AAAAAAAAGAAGAAAGGGCCGGG - Intronic
1183775487 22:39961501-39961523 AAACCACAGAACAGAGGGCCAGG + Intronic
1183778184 22:39981568-39981590 AAAAAAAAAAATTGAGGGCCGGG - Intergenic
1184707331 22:46223646-46223668 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1184834407 22:47012553-47012575 AAGAAACAGAGTAGAGAAACAGG - Intronic
1184895387 22:47403618-47403640 AAAAAAAAAAATAGAGGGGCAGG - Intergenic
949181534 3:1137047-1137069 AAGAGACAGAATGGGGTGCCAGG - Intronic
949253709 3:2019674-2019696 AAGAAACAAAAGAGAGGGAAAGG - Intergenic
949449587 3:4170644-4170666 ATGAAACAGAGTAGAGAGTCTGG + Intronic
950161448 3:10764110-10764132 GCCAAACAGAATAGAGGGCTTGG - Intergenic
950704728 3:14772766-14772788 AAAGATCAAAATAGAGGGCCGGG - Intronic
950815765 3:15700478-15700500 AAAAAACACTATATAGGGCCGGG + Intronic
951316915 3:21198394-21198416 ATGGAACAGAATAGAGAGTCCGG - Intergenic
951504532 3:23428677-23428699 CAGAAACAAAAGAGAGGGCCAGG + Intronic
951885460 3:27519926-27519948 AAGAAAAAAAATAGAAGGCTGGG + Intergenic
952016787 3:28966394-28966416 AGGGAACAGAATAGAGAACCTGG - Intergenic
952129708 3:30346967-30346989 AGGAAATAAAATATAGGGCCAGG + Intergenic
952387934 3:32856310-32856332 AAGAAAACTATTAGAGGGCCAGG - Intronic
952543853 3:34397158-34397180 AAGAAACAGATGTGAGGGTCTGG + Intergenic
952867452 3:37863328-37863350 AGGAAACAGAATGGGGGGCTGGG - Intronic
953747286 3:45584979-45585001 AAAACAGAGAAGAGAGGGCCAGG - Intronic
954248861 3:49353027-49353049 AAGAAAAAGATTAGGGGACCTGG - Intergenic
954554472 3:51507129-51507151 AAGACACAGGGTACAGGGCCAGG - Intergenic
954703413 3:52464961-52464983 AAGAAAATGAAAAGATGGCCGGG - Intronic
954787701 3:53106604-53106626 AGGAGGCAAAATAGAGGGCCGGG + Intronic
955446852 3:59021007-59021029 AAGCAAAAGAAGAGAGAGCCTGG - Intronic
955658779 3:61274204-61274226 ATGGAACAGAATAGAGAACCCGG - Intergenic
955733896 3:62016523-62016545 AAGAAACAAAATAGATGGATTGG - Intronic
956203103 3:66728078-66728100 AAAAAGCAGAAGAGAGTGCCAGG - Intergenic
956302486 3:67787679-67787701 AAGATAGATAATAGAGAGCCAGG - Intergenic
956307263 3:67839268-67839290 AAGAAACTGTATAGAATGCCAGG - Intergenic
956339460 3:68205409-68205431 ATGAAAAAGAACATAGGGCCAGG + Intronic
956651915 3:71512221-71512243 TAGAGACAGGATATAGGGCCTGG + Intronic
956764890 3:72476354-72476376 AAGAAATAAAATCTAGGGCCAGG + Intergenic
957327231 3:78711782-78711804 TAGAAACAGCACAGGGGGCCGGG - Intronic
957668608 3:83270201-83270223 ATGAAACCGAATAGAGAACCTGG - Intergenic
957745411 3:84334702-84334724 ATGAAACAAAATAGAGAACCTGG - Intergenic
958028150 3:88073495-88073517 CAGAAAAGGAATTGAGGGCCTGG + Intronic
959035285 3:101355539-101355561 ATGAAACAGAATATAGAGCCTGG - Intronic
959062786 3:101631335-101631357 AAGAAGCAGAATAAAGAGTCTGG + Intergenic
959621554 3:108403517-108403539 AGGAAACTGAATAGAATGCCAGG - Intronic
959676365 3:109040532-109040554 AAGAAAGAAAAAAGAAGGCCAGG + Intronic
959719014 3:109466364-109466386 ATGAAACAGAACAGAGAACCTGG + Intergenic
959841282 3:110979079-110979101 AAGAAAGAAAAAAGAGGGCCGGG + Intergenic
961221396 3:125203401-125203423 AAGGAACAGAATAGAGAATCTGG + Intronic
961598467 3:128039601-128039623 AAGAAAGTGAAAAGATGGCCGGG + Intergenic
961634554 3:128324728-128324750 ACCAAAAAGAATTGAGGGCCTGG - Intronic
961732298 3:128974824-128974846 AAAAAAAAGAAGAGAAGGCCAGG + Intronic
961754205 3:129118011-129118033 GAGTTACAGAATAGAGGACCTGG + Intronic
961987048 3:131145890-131145912 AAGGAACATAGAAGAGGGCCTGG + Intronic
962617732 3:137144242-137144264 ATGAAACAGAATAGGAAGCCTGG - Intergenic
962813620 3:138979553-138979575 AAGAAAAGGAACACAGGGCCAGG - Intergenic
962821218 3:139048982-139049004 ATGGAACAGAATAGAGAACCTGG - Intronic
962950418 3:140213489-140213511 AAGAATCAGCAGAGAAGGCCTGG - Intronic
963033567 3:141004246-141004268 AAGGAAGAGAAAACAGGGCCAGG - Intergenic
963295794 3:143544997-143545019 ATAAAACAGAATAGAGAACCCGG - Intronic
963864885 3:150349904-150349926 AAGAATCAGAAACAAGGGCCGGG + Intergenic
963881736 3:150536236-150536258 AACAAACAAAAAAGAGGGCCAGG + Intergenic
963906410 3:150777169-150777191 AAGAAAGAGAAGAGCTGGCCTGG + Intergenic
963958459 3:151281527-151281549 AATTAAAATAATAGAGGGCCTGG + Intronic
964166293 3:153709837-153709859 ATGGAACAGAATAGAGAACCTGG + Intergenic
964348741 3:155781780-155781802 AAAAAAAAAAATAGTGGGCCGGG + Intronic
964351933 3:155811714-155811736 AAGAAAAGGAAAAGAAGGCCGGG + Intergenic
964460182 3:156916088-156916110 ATGAAACAGAAGAGAGAGCTCGG - Intronic
965147134 3:164921450-164921472 ATGGAACAGAATAGAGCCCCCGG + Intergenic
965750105 3:171966850-171966872 TGGAAACAGAATTGAGGGCTAGG + Intergenic
966171903 3:177091002-177091024 AAGAAAAAGAAAAGAGGGAGAGG + Intronic
966189406 3:177258639-177258661 GAGAAACTGAAAAGAGGACCAGG - Intergenic
966387985 3:179422329-179422351 ATAAAACAGAATATAAGGCCAGG + Intronic
966502082 3:180654083-180654105 ATGGAACAGAATAGAGAACCCGG + Intronic
967032380 3:185620027-185620049 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
967255079 3:187582977-187582999 ATGGAACAGAATAGACAGCCCGG - Intergenic
967404140 3:189098155-189098177 AAGAAGAAGAAAAGAGAGCCGGG + Intronic
967605304 3:191438332-191438354 AAGAAAAAGAAGAGAGGGGAAGG - Intergenic
967704194 3:192630851-192630873 AAGAAAAAAAAAAGTGGGCCGGG - Intronic
967984184 3:195083081-195083103 ACAAAACAGGATAGAGCGCCCGG + Intronic
968259936 3:197312838-197312860 ATGGAACAGAATAGAGAACCTGG - Intergenic
968333615 3:197893546-197893568 AAGAAAATGAATGTAGGGCCGGG + Intronic
968955501 4:3716832-3716854 AAGACAGAGAACAGTGGGCCAGG - Intergenic
968958801 4:3732391-3732413 CAGAAACAGAAAAGAGAGCCGGG + Intergenic
969047897 4:4350887-4350909 AAAAAAAAGAGTACAGGGCCAGG + Intronic
969162067 4:5269048-5269070 AAGAGACAGAATTGAGAGTCTGG + Intronic
969695764 4:8733432-8733454 AAGAAAAAGAATACAAGGCCGGG + Intergenic
969819932 4:9712228-9712250 GAAAAACAAAATTGAGGGCCGGG - Intergenic
970567991 4:17351240-17351262 AAGAAACAGAATCTATGGACAGG - Intergenic
970597324 4:17612384-17612406 AAGAACCAGAAGAGACCGCCAGG - Intergenic
970827845 4:20298382-20298404 AATTAACAGAAAATAGGGCCGGG - Intronic
971359041 4:25919641-25919663 TAGAAATAGAACAGAAGGCCGGG - Intronic
971605005 4:28647533-28647555 ATGTAACAGAATAGAAAGCCCGG - Intergenic
971835693 4:31760190-31760212 AAGAAACAGAGTAGGGGGAGAGG - Intergenic
971984876 4:33808419-33808441 AGAAAACAGAACAGATGGCCAGG - Intergenic
973538580 4:51910200-51910222 ATGGAAAGGAATAGAGGGCCTGG - Intronic
974213860 4:58818737-58818759 AAGAAACCCCATATAGGGCCGGG + Intergenic
974515467 4:62902517-62902539 AAAAAAAAGAATGGAGGGTCTGG + Intergenic
974937438 4:68424988-68425010 ATGGAACAGAATAGAGCCCCCGG + Intergenic
975108340 4:70595176-70595198 AAAAAAAAGAATAGAGGGAAAGG - Intronic
975139930 4:70908321-70908343 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
975877559 4:78860969-78860991 AAGACACAGAATGTAAGGCCTGG - Intronic
976044375 4:80928111-80928133 AAGAAACAGAACAGAACGCTGGG - Intronic
976420615 4:84839560-84839582 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
976567550 4:86568607-86568629 ATGAGACAGAATAGAGAACCCGG + Intronic
977248770 4:94665186-94665208 AAGAGAATAAATAGAGGGCCAGG + Exonic
977522137 4:98098283-98098305 ACGAAACAGAATAGAGAACCCGG + Intronic
977584538 4:98760464-98760486 TAGAAACGATATAGAGGGCCGGG - Intergenic
978309720 4:107373155-107373177 ATGGAACAGAATAGAGAGCCTGG + Intergenic
978645443 4:110925460-110925482 AAGAAAGAGAAGAGAGTCCCAGG - Intergenic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
979444471 4:120794919-120794941 AAAAAATAGAATAGAAGGCTGGG - Intronic
979615043 4:122732983-122733005 AAGAATGAGAATCTAGGGCCTGG + Intronic
980132144 4:128826694-128826716 AATAAACATAACATAGGGCCAGG - Intronic
980540415 4:134186352-134186374 ATGGAACAGAATAGAGTCCCTGG + Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981181289 4:141748723-141748745 ATAGAACAGAATAGAGAGCCCGG + Intergenic
982122478 4:152156382-152156404 AAAAGACAGCACAGAGGGCCGGG - Intergenic
982128060 4:152201454-152201476 AAAGAATAGAATAGAGGACCAGG + Intergenic
982357095 4:154482983-154483005 ACTCAACAGAATTGAGGGCCTGG + Intronic
982411582 4:155083963-155083985 AAGAAACAGAGAAGAGGACAAGG + Intergenic
982550008 4:156785930-156785952 GCGATACAGAATAGAGGGGCAGG - Intronic
983318925 4:166169712-166169734 AAAAAACAAAATAGTGGACCAGG - Intergenic
983937386 4:173511405-173511427 AAAAAACGGTATAGAGGGCCAGG - Intergenic
984740421 4:183156319-183156341 AAAAAAAAGAACAAAGGGCCAGG - Intronic
984974069 4:185214933-185214955 AAGAACTAGAATAATGGGCCTGG + Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985279561 4:188271788-188271810 AAGAAGAAGAAGGGAGGGCCGGG - Intergenic
985431442 4:189885225-189885247 AAGAAAGAGAAAAGCAGGCCGGG + Intergenic
985483316 5:132721-132743 ATGGAACAGAATAGAGAACCCGG - Intergenic
985613705 5:906546-906568 AAGCAACTGAAAAGAGGACCTGG + Intronic
986321769 5:6637301-6637323 GGGAGACAAAATAGAGGGCCAGG - Intronic
986630766 5:9770238-9770260 ATTAAACAGAATAGAGAACCTGG - Intergenic
986834233 5:11616900-11616922 AAGAAACAGCAAACAGGGCTGGG - Intronic
986906205 5:12495896-12495918 ATGGAACAGAATAGAGAGCTTGG + Intergenic
987388094 5:17349228-17349250 AAGAGCCAGAATATAAGGCCTGG - Intergenic
987481356 5:18462669-18462691 ATATGACAGAATAGAGGGCCTGG + Intergenic
987622217 5:20349134-20349156 AAGGAATAGAATAAAGGGCTTGG + Intronic
988467748 5:31507017-31507039 AGTAAAAAGACTAGAGGGCCAGG + Intronic
989437067 5:41427200-41427222 AAGAAACAGAAGATAGGGAGTGG - Intronic
989751423 5:44898909-44898931 AAGAAAAAGAAAAAATGGCCGGG + Intergenic
990273944 5:54175628-54175650 AAGAAAGAGAAGAGAAGGCTGGG - Intronic
990454026 5:55967015-55967037 AAGAAAAAGACAAGGGGGCCAGG + Intronic
990555577 5:56931995-56932017 TATAAATATAATAGAGGGCCAGG + Intronic
990582665 5:57180441-57180463 AAGAAACAGAAAAGATGGTTTGG - Intronic
990670366 5:58122613-58122635 AAGAGAAAGAAAAGAGGGACTGG - Intergenic
990775744 5:59303718-59303740 ATGGAACAGAATAGAGAACCCGG - Intronic
990782949 5:59386655-59386677 AAGAAAAAGAAAAGAAGGGCAGG + Intronic
990847942 5:60165335-60165357 ATGGAACAGAATACAGAGCCTGG - Intronic
990997166 5:61744621-61744643 TAGAAACAGAACAGAGAGCCAGG - Intronic
991212400 5:64120840-64120862 ATGAATCAGACTAGAGGCCCAGG - Intergenic
991539440 5:67710157-67710179 AGAAAACAGACTAGAGAGCCTGG + Intergenic
991624494 5:68585959-68585981 AAGGAACAGCAAAGAGTGCCAGG + Intergenic
991633747 5:68682421-68682443 CGGAGACAGAACAGAGGGCCTGG + Intergenic
991720530 5:69491741-69491763 AAGAAATAGAATACAGCACCCGG + Intergenic
992257668 5:74937501-74937523 AAAAAACAGACTTTAGGGCCAGG - Intergenic
992682820 5:79169764-79169786 AAGAAATTGAATAGAGCACCTGG - Intronic
992687743 5:79214788-79214810 AAGAAACACAACTGGGGGCCGGG + Intronic
993186429 5:84627773-84627795 AAAAAGGAGAGTAGAGGGCCTGG + Intergenic
993435161 5:87883907-87883929 ACGGAACAGAATAGAGCCCCTGG - Intergenic
993590442 5:89789188-89789210 AACACACAGAAGAGAGGGCCAGG + Intergenic
993832302 5:92775414-92775436 AAGGAAGAGAATAGAGGGCAGGG + Intergenic
994032280 5:95157336-95157358 AAGAGACAGGATAAAGGGCCTGG + Intronic
994473122 5:100235134-100235156 ATGAAAGAGAATGGAGAGCCCGG - Intergenic
994607039 5:101980913-101980935 AAGAAATAGAATTGAGAGCATGG + Intergenic
994807023 5:104461169-104461191 ATGGAACAGAATAGAGGACCAGG - Intergenic
995031011 5:107481554-107481576 AAGAAACTGAAAAGAATGCCAGG + Intronic
995858016 5:116614274-116614296 AAGAAATACAATATACGGCCAGG + Intergenic
996073126 5:119157649-119157671 ATGGAACAGAATAGAAGGCACGG - Intronic
996146385 5:119981890-119981912 GAGGAACAGAATAGAGCACCTGG + Intergenic
996578451 5:125002400-125002422 AAGAAATAGATTGGAAGGCCAGG + Intergenic
996850604 5:127947312-127947334 ATGGAACAGAATAGAGAGCCTGG - Intergenic
996969456 5:129346062-129346084 CAGAAACAGAATTGAGGGGCTGG + Intergenic
997319368 5:132964509-132964531 AAGAAAAACATTAGTGGGCCGGG - Intergenic
997936185 5:138113252-138113274 AACAAACAAAAAAGATGGCCGGG - Intergenic
998117036 5:139546020-139546042 AAGAAATAGAATTTAAGGCCAGG - Intronic
998238949 5:140425551-140425573 AAAAAACAGAAAAGAGGCCTGGG - Intronic
998350274 5:141495770-141495792 GAGAAACAGAAAAGAGGTCCAGG - Intronic
998470500 5:142380180-142380202 AAGAAAAAGAAAACAAGGCCAGG + Intergenic
999159791 5:149485737-149485759 AAGGAAGAGAAGAGAGGACCAGG - Intergenic
999285993 5:150394619-150394641 AAGCAGCAGAAAAGTGGGCCTGG + Intronic
999446896 5:151647317-151647339 TAGAAAATGAATAGAGGGCCAGG - Intergenic
999911096 5:156200327-156200349 ATGGAACAGAATAGAGAGACTGG + Intronic
999966118 5:156811269-156811291 ATGTAACAGAATAGAGGCCACGG + Intergenic
1000622385 5:163500900-163500922 AAGAAACAGAAGAAAGGTCACGG - Intergenic
1000766238 5:165294070-165294092 AAAAAACTGAATAGATGGCCAGG + Intergenic
1000802961 5:165751644-165751666 AAGAATAAAAATAGTGGGCCAGG - Intergenic
1000861134 5:166457539-166457561 AAGAAAGTGAAGTGAGGGCCAGG + Intergenic
1000989145 5:167894274-167894296 AAGATACAGAGTATAGGGCAAGG + Intronic
1001616089 5:173044840-173044862 AAAAATCAAAATGGAGGGCCGGG - Intergenic
1002032867 5:176443657-176443679 AAAAAAAAGAAAAGAAGGCCAGG + Intergenic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1002371874 5:178761354-178761376 AATCAACAGAACAGAGGGTCTGG + Intergenic
1002506374 5:179681952-179681974 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1002652227 5:180707369-180707391 AAAAAACAAAATATGGGGCCGGG + Intergenic
1002942958 6:1733853-1733875 AAAAAAAAAAAAAGAGGGCCAGG + Intronic
1003650201 6:7952250-7952272 AAGAAACAGCAATGAGGGGCAGG + Intronic
1003735559 6:8874165-8874187 AAAGAATAGAATATAGGGCCGGG - Intergenic
1003765796 6:9235004-9235026 AACAAACAGAATAGACAGCTTGG + Intergenic
1003993888 6:11518447-11518469 ATGGAACAGAATAGAGAGCTCGG + Intergenic
1004133977 6:12948973-12948995 AAGAAATAGAAAAATGGGCCAGG + Intronic
1004217991 6:13720063-13720085 AAGAAACAAGAAAGAGGGTCAGG - Intergenic
1004224727 6:13775092-13775114 AAGAAAGAAAAAAGTGGGCCTGG - Intergenic
1004600277 6:17143206-17143228 ATGAAACAGAATTTAGGGCTGGG - Intergenic
1004921496 6:20380443-20380465 AAGAATGAGACTAGCGGGCCAGG + Intergenic
1004984752 6:21068560-21068582 AAGGAACAGAATAGATGCCCAGG - Intronic
1005022307 6:21429994-21430016 AAAAAAAAAAAAAGAGGGCCAGG - Intergenic
1005076531 6:21913608-21913630 AAGAAAAAGAATATAGTGGCCGG + Intergenic
1005159398 6:22841617-22841639 AATGAACAGAATAGAGAACCCGG + Intergenic
1006113823 6:31764576-31764598 AAGAAACAGAAAAAGGAGCCTGG - Exonic
1006487018 6:34351444-34351466 AAAAAAAAAATTAGAGGGCCAGG + Intronic
1006733312 6:36252883-36252905 ACGAAAGGCAATAGAGGGCCGGG + Intronic
1006970811 6:38043274-38043296 AATAAACAGAATAGAGGGCTGGG - Intronic
1007303353 6:40885352-40885374 AACAAAGAGAATAGAAGGGCAGG - Intergenic
1007333828 6:41136825-41136847 AAGAAACAGAATAAGTTGCCAGG + Intergenic
1007343512 6:41209203-41209225 AAGAGGCAGAAAAGAGGGTCAGG - Intergenic
1007537147 6:42602180-42602202 AAGAAAAAAAAAAAAGGGCCAGG - Intronic
1007655551 6:43449218-43449240 AAGAGACATTAGAGAGGGCCAGG + Intronic
1008328675 6:50218898-50218920 AAGAAAGAGAAGAAAGGGGCTGG - Intergenic
1008959430 6:57251078-57251100 AAGAAACAGAAAAGAAGACATGG - Intergenic
1009409873 6:63353808-63353830 ATGAAACAGAATAGAGAACCTGG + Intergenic
1009551310 6:65096660-65096682 ATCAAACAGAATAGACAGCCTGG + Intronic
1009720333 6:67460593-67460615 AAGAAAAAGAATAGAGCAGCAGG + Intergenic
1009926906 6:70130881-70130903 AAGACACAAAATAGTGAGCCTGG - Intronic
1010173861 6:73003224-73003246 AAGAAACAGAATTCAGGATCAGG - Intronic
1010389884 6:75324750-75324772 ATGGAACAGAATAGAGAACCTGG + Intronic
1010437016 6:75843462-75843484 TAGAAAAAGAATAGATGGCCGGG + Intronic
1010760711 6:79719119-79719141 CAGAAACAGCATAGAGTGCCAGG + Intergenic
1010806693 6:80245778-80245800 TAGAAATAAAAGAGAGGGCCGGG + Intronic
1011012928 6:82722265-82722287 AAGACACAGAATAAAGGGGGTGG + Intergenic
1011176147 6:84562871-84562893 GTGAAACAGAATAGAGAACCTGG + Intergenic
1011293077 6:85797481-85797503 AAAAAATAGAATAGAGAGGCAGG + Intergenic
1011826639 6:91314286-91314308 AACATACAGAAGAGAGGGCAGGG + Intergenic
1011829539 6:91354640-91354662 AAGAAACTTAGTATAGGGCCAGG - Intergenic
1012355032 6:98303617-98303639 ATGAAACAGAATAAAGATCCTGG - Intergenic
1012613850 6:101251000-101251022 ATGGAACAAAATAGAGAGCCTGG + Intergenic
1013051936 6:106544621-106544643 AAGAAGGAGAATACAGGGACTGG + Exonic
1013258681 6:108415583-108415605 ATGGAACAGAATAGAGCCCCCGG + Intronic
1013347875 6:109279518-109279540 AAGTGACAGAATAGAGGGCTGGG - Intergenic
1013551173 6:111209214-111209236 GAGAAAAAGAGTAGAGGTCCAGG + Intronic
1013620708 6:111885841-111885863 AAGAAACAGAAAGGAGGCCTGGG + Intergenic
1013713948 6:112935158-112935180 AAGAAAAAGAATAGAGTGTTAGG - Intergenic
1014061851 6:117081023-117081045 ATGGAACAGAATAGAGCCCCTGG - Intergenic
1014840418 6:126213098-126213120 ATGGAACAGAATAGAGAACCTGG - Intergenic
1015030117 6:128584916-128584938 AAAAAACATAATTAAGGGCCGGG - Intergenic
1015152656 6:130056221-130056243 AACAAACAAAAAAAAGGGCCAGG - Intronic
1015357617 6:132297476-132297498 AGGAAACAGAAAAGAGGGCCAGG + Intronic
1015770073 6:136759750-136759772 AAAAAAAAAAATAGAGGGCTGGG - Intronic
1016180680 6:141144137-141144159 ATGGAACAGAATAGAGAACCCGG - Intergenic
1016197061 6:141357139-141357161 ATGGAACAGAATAGAGAACCCGG - Intergenic
1016835926 6:148476877-148476899 ATGGAATAGAATAGAGAGCCCGG + Intronic
1017375536 6:153763393-153763415 ATGGAACAGAATAGAGAACCTGG + Intergenic
1017396598 6:154007547-154007569 ATGGAACAGAATAGAGAACCTGG + Intergenic
1017422137 6:154283299-154283321 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1017481726 6:154863643-154863665 AAGAAGCAGAAAAGAAAGCCAGG - Intronic
1017591431 6:155982070-155982092 AAGAAACAGAACTGAAGGACGGG + Intergenic
1017632343 6:156408801-156408823 AATAAACAGACTAATGGGCCTGG + Intergenic
1017877825 6:158538127-158538149 AAAAAACAGAGTAGGGGGCGGGG - Intronic
1018218936 6:161559589-161559611 AAGAAAAAGACTAGGGAGCCAGG - Intronic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1018693919 6:166374769-166374791 ATGGAACAGAATAAAGTGCCCGG - Intronic
1019678467 7:2330124-2330146 AAAAAAAAGAAAAAAGGGCCGGG - Intronic
1019706907 7:2501204-2501226 AAAAAAAAAAAAAGAGGGCCGGG + Intergenic
1020318234 7:6922075-6922097 GAAAAACAAAATTGAGGGCCAGG + Intergenic
1020599355 7:10252656-10252678 GTGAAACAGAATAGAGGACTCGG + Intergenic
1021175273 7:17442570-17442592 AAGAAACAGATAACAGGGGCTGG - Intergenic
1021374779 7:19892807-19892829 ATGGAACAGAATAGAGATCCAGG - Intergenic
1021585908 7:22208007-22208029 AACACACAGAAGAGAGGGCCAGG - Intronic
1021616387 7:22506910-22506932 AAGGAACAGAATAGACCACCAGG - Intronic
1022529153 7:31056464-31056486 AAGAAACAGAAGGCAGGACCTGG - Intronic
1022926183 7:35058122-35058144 AAGGAACGGAATAGAGCACCAGG - Intergenic
1023135822 7:37050393-37050415 AAGAAATAGAACTGGGGGCCAGG - Intronic
1023785366 7:43702423-43702445 ATGGAACAGAATAGAGAGCCTGG - Intronic
1024325540 7:48106605-48106627 AAAAAACAAAGTAGAGGGCTGGG - Intronic
1024778670 7:52820991-52821013 ATGAAACAGAATACAGAACCCGG + Intergenic
1024936647 7:54718248-54718270 AAGATTCAGAATAAAGGTCCAGG + Intergenic
1025166640 7:56718323-56718345 AAGAAAAAGAAAATAAGGCCGGG + Intergenic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1025992652 7:66507180-66507202 AAAAAACAGAAAAAGGGGCCAGG - Intergenic
1026054492 7:66972668-66972690 AAGAAAAAGAATATGGGACCCGG + Intergenic
1026144460 7:67734494-67734516 AAGAAAGAAAGAAGAGGGCCAGG - Intergenic
1026303024 7:69115459-69115481 AAGAAAAAGAACAGTGGTCCTGG - Intergenic
1026530261 7:71190972-71190994 AAGACACAAGATAGGGGGCCCGG + Intronic
1026559889 7:71439934-71439956 AAAAAAAAAAAAAGAGGGCCTGG - Intronic
1026569644 7:71518074-71518096 AAGAAAAAGAGGACAGGGCCAGG + Intronic
1026615699 7:71901582-71901604 ATGGAACAGAATAGAGAACCTGG + Intronic
1026642749 7:72141302-72141324 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
1026856263 7:73757168-73757190 AAAAAAAAGAAGAGAGGGCCGGG + Intergenic
1026899202 7:74027783-74027805 AGGAAGCAGAAGGGAGGGCCTGG - Intronic
1027264825 7:76488598-76488620 AAAAAAAAGAAAAGAGGGCTGGG + Intronic
1027316198 7:76986701-76986723 AAAAAAAAGAAAAGAGGGCTGGG + Intergenic
1027590796 7:80116447-80116469 AAGAACATGAATAGTGGGCCAGG + Intergenic
1027756040 7:82213194-82213216 AAGAACCAGGATATTGGGCCAGG - Intronic
1027802950 7:82778799-82778821 AAGAAACTGAGCAGATGGCCAGG - Intronic
1028036809 7:85994299-85994321 ATGGAACAGAATAGAGAACCTGG - Intergenic
1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG + Intronic
1028273721 7:88824632-88824654 AAGAAATAGATGAAAGGGCCAGG - Intronic
1028553202 7:92094537-92094559 AAAAAAGAAAAAAGAGGGCCGGG + Intronic
1028620650 7:92823960-92823982 AAGAAAAACAAAAGAAGGCCAGG - Intronic
1028690757 7:93647021-93647043 AAAAATCAGAAAAGGGGGCCGGG + Intronic
1028748783 7:94358408-94358430 ATTAAACAGAATAGAGAGCCTGG + Intergenic
1028942706 7:96541909-96541931 ATGAAACAGAATACAGAACCCGG - Intronic
1029004229 7:97190754-97190776 GTGGAACAGAATAGAGAGCCTGG + Intergenic
1029145470 7:98442761-98442783 TAGAATCAGAAAAGAGGGCAGGG - Intergenic
1029435419 7:100561635-100561657 AAGAAAAAGCACAGAGGGCAAGG - Intronic
1029534571 7:101149065-101149087 AAGAAATAAAGCAGAGGGCCGGG - Intergenic
1029674044 7:102054102-102054124 AAGAAACTGAAAAGAGAGGCTGG - Intronic
1029713141 7:102310675-102310697 AAGAAACACAATTAAGGTCCTGG + Intronic
1030026683 7:105331004-105331026 AAGAAAAAAAAAAGAAGGCCGGG + Intronic
1030633828 7:111925790-111925812 AAGAAAGAAAAAAGAGGGCCGGG + Intronic
1030821520 7:114098391-114098413 GTGGAACAGAATAGAGAGCCTGG + Intronic
1031472817 7:122187499-122187521 ATGAAACAGAACAGAGAACCCGG - Intergenic
1031792721 7:126129932-126129954 ATGGAACAGAATAGAGAACCCGG + Intergenic
1032458703 7:132093542-132093564 AAGAAAGAGATTAAAGGGCTGGG - Intergenic
1032522950 7:132560241-132560263 AACAAGCAGAACAGAGGCCCAGG + Intronic
1032567120 7:132957773-132957795 AAGAAAGAAAATTGAGGGCTGGG - Intronic
1033188204 7:139249994-139250016 TAGAAAGAGAAGAGAAGGCCAGG - Intronic
1033548177 7:142421260-142421282 AAGAAGCAGCAGAGAGTGCCTGG - Intergenic
1033816324 7:145077962-145077984 ATGAAACAGAATAGAGAACACGG - Intergenic
1034151988 7:148924264-148924286 AAGAGACTAAACAGAGGGCCTGG - Intergenic
1034171716 7:149067709-149067731 ATGAAACAGAATAAGTGGCCCGG - Intergenic
1034190384 7:149209021-149209043 AAAAAAAAAAAAAGAGGGCCGGG + Intronic
1034454507 7:151159723-151159745 CAGAAACAATATAGAAGGCCAGG + Intronic
1034675452 7:152889776-152889798 ATGGAAGAGAATAGAGAGCCCGG - Intergenic
1034720942 7:153292136-153292158 AAGAAAAAGAATAGGAGGCCAGG + Intergenic
1035248739 7:157582578-157582600 AGAAAACAGTATGGAGGGCCAGG + Intronic
1035365514 7:158347423-158347445 ATGGAACAGAATAGAGAGCCAGG - Intronic
1036118292 8:5985825-5985847 AAGAAACACAACTGAGGGCCGGG + Intergenic
1036200204 8:6764420-6764442 AAGAAACTGACTACAAGGCCCGG - Intergenic
1036534452 8:9633022-9633044 AAAGAACAACATAGAGGGCCGGG - Intronic
1036726756 8:11227619-11227641 AATGAACAAAATAGAGGCCCAGG - Intergenic
1036917524 8:12818892-12818914 AAGGAACAGAATATTGAGCCAGG - Intergenic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037190844 8:16123138-16123160 AAGAATTTGAATAGAGGGCCGGG - Intronic
1037842143 8:22252340-22252362 AAGAAACAGAATAGAAAGAGAGG - Exonic
1038163277 8:25061010-25061032 AAGAAAGAGAAAAGCGTGCCTGG - Intergenic
1038296807 8:26299760-26299782 AAGAAACACAGAAGACGGCCTGG - Intronic
1039814479 8:41080881-41080903 AACAAAAAAAATAGAGGGCCGGG + Intergenic
1039849684 8:41353278-41353300 ATGGAACAGAATAGAGCCCCTGG - Intergenic
1040790340 8:51221604-51221626 ACGGAACAGAATAGAGAACCTGG + Intergenic
1040904775 8:52456278-52456300 AAGGAAAAGAATGGAGAGCCTGG + Intronic
1041054817 8:53973877-53973899 AATAAAGAAAAAAGAGGGCCAGG + Intronic
1041316343 8:56566955-56566977 AAGAAACAGAAGAAAGGGTGTGG + Intergenic
1041494960 8:58475906-58475928 ATGGAACAGAATAGAGAGCCCGG - Intergenic
1041524838 8:58793665-58793687 ATGGAACAGAATAGAGAACCCGG + Intergenic
1041622233 8:59985233-59985255 ATGAAAGAGAATAAAGAGCCCGG - Intergenic
1042188496 8:66161354-66161376 ATGGAACAGAATAGAGAACCCGG - Intronic
1042244178 8:66694254-66694276 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1042276400 8:67009270-67009292 AAAAAATAAAATAAAGGGCCGGG + Intronic
1042297674 8:67239299-67239321 AAGAAAGGGAAAGGAGGGCCAGG - Intronic
1042528797 8:69794127-69794149 AAGAAACAGAACAGGTGGCAGGG + Intronic
1042552285 8:70004816-70004838 AAGAAAAGGAAAAAAGGGCCGGG + Intergenic
1043348788 8:79333588-79333610 AAGAAACAAACTAGAAAGCCAGG - Intergenic
1043918334 8:85951083-85951105 AAAAAAAAAAAAAGAGGGCCGGG + Intergenic
1044192611 8:89336931-89336953 ATGGAACAGAATAGAGAACCTGG - Intergenic
1044243263 8:89911637-89911659 AAAAAAAAGAAAAGAGGGCCAGG + Intronic
1044386879 8:91599479-91599501 AAGAAACAGAATAGAGGGGGTGG - Intergenic
1044637634 8:94342360-94342382 AAGAAACAGAAGGAAGGGCTGGG + Intergenic
1044793920 8:95876936-95876958 ATGTAACAGAATACAGAGCCTGG + Intergenic
1045122687 8:99055333-99055355 AAGAAATATAAAATAGGGCCAGG - Intronic
1045769136 8:105713787-105713809 ATGGAACAGAATAGAGAACCTGG - Intronic
1045855252 8:106757475-106757497 AAGAAGTGAAATAGAGGGCCAGG - Intergenic
1045878314 8:107008819-107008841 AAGGAACAGAATAGAGAACCTGG + Intergenic
1045981672 8:108196959-108196981 AAGAAAGAGAAGAGAGCACCAGG + Intergenic
1046421741 8:113994050-113994072 AAGAAATAAAAAAGAGGGCACGG - Intergenic
1046494425 8:114995350-114995372 ATGAAACAGAATAGAGAGCCTGG - Intergenic
1046520311 8:115317722-115317744 AAGAAACAGAATAGGGGGAGAGG - Intergenic
1047056307 8:121168342-121168364 CAGAAAAACAATAGAGGGCAAGG - Intergenic
1047090114 8:121565293-121565315 GAAAAACAGTATGGAGGGCCAGG + Intergenic
1047304440 8:123641598-123641620 AAGGAGAAGAATAGGGGGCCGGG + Intergenic
1047939144 8:129811074-129811096 ATGTAACAGAATAGAGAACCCGG - Intergenic
1048233845 8:132671023-132671045 AAGAATCAGAAAAAAAGGCCAGG + Intronic
1048551425 8:135436890-135436912 CAGGAAGAGAATGGAGGGCCAGG + Intergenic
1049375118 8:142285710-142285732 AAGGAACAGAAACGTGGGCCAGG + Intronic
1049389986 8:142362834-142362856 AAGAAACAGATTCAAGGGCCAGG - Intronic
1049626699 8:143626478-143626500 AAAAAAAAGAATATCGGGCCGGG - Intergenic
1049793496 8:144484456-144484478 AAGAAAGGGAAGAGAGGGCAGGG - Intronic
1050454829 9:5824276-5824298 AAGAAAAGGCAAAGAGGGCCAGG + Intronic
1050547540 9:6721577-6721599 AAAAAAAAAAAAAGAGGGCCGGG - Intronic
1051175091 9:14352627-14352649 TAGAAACAGCACTGAGGGCCCGG - Intronic
1051191019 9:14513332-14513354 ATGAAACAGAAATGAAGGCCGGG + Intergenic
1051277493 9:15411072-15411094 ATGGAACAGAATAGAGAACCTGG - Intergenic
1051308284 9:15740030-15740052 AAAAAACACATTGGAGGGCCAGG - Intronic
1051919530 9:22248863-22248885 ATGGAACAGAATAGAGGACCTGG - Intergenic
1052375437 9:27713409-27713431 CAGAAACAGAATGGAGAGGCAGG + Intergenic
1052886499 9:33653820-33653842 ATGGAACAGAATACAGAGCCAGG - Intergenic
1053181723 9:35977277-35977299 ATGAAACAGAATAGAGAGTCAGG - Intergenic
1053339594 9:37312620-37312642 AAGAAATAATATAGAGGGCTGGG + Intronic
1055222052 9:73947354-73947376 AATGAACAGAATAGAGGAACTGG + Intergenic
1055231846 9:74075851-74075873 ATGAAACAGAATAGAAAGCATGG - Intergenic
1055304726 9:74917728-74917750 AAGAAACTAAAAATAGGGCCGGG + Intergenic
1055802564 9:80056250-80056272 ATGAAACAGAATAGAGAGCCCGG + Intergenic
1056202003 9:84285903-84285925 CAGAAACAAAACAGAGGGCAGGG + Intronic
1056442235 9:86632698-86632720 AAGCAGCAGAATACAGGGCCAGG - Intergenic
1056463698 9:86833131-86833153 AGAAATCAGAAGAGAGGGCCTGG - Intergenic
1056721621 9:89076881-89076903 AAAAAACAGACAATAGGGCCGGG + Intronic
1056802234 9:89700400-89700422 AAGAAACAAAATACAGGGGCCGG + Intergenic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1057012052 9:91613256-91613278 ATGGAACAGAATAGAGCCCCCGG + Intronic
1057175501 9:92994802-92994824 ATGGAACAGAATAGAGCCCCCGG - Intronic
1057277725 9:93684884-93684906 GAGAATGAGAATCGAGGGCCTGG + Intergenic
1057579744 9:96276568-96276590 ATGGAACAGAATAGAGAGCCTGG + Intronic
1057747940 9:97766626-97766648 AAGAAACAGCATAGAGTGTTTGG - Intergenic
1058308828 9:103475394-103475416 AAAAAACTGAATTCAGGGCCGGG - Intergenic
1058534625 9:105945695-105945717 ATAAAACAGAATAGAGAGCCAGG - Intergenic
1058666895 9:107326932-107326954 AAGAAATAGAAAAGTTGGCCGGG - Intronic
1058874545 9:109232344-109232366 AAAAAACAGAATAAAGGCACAGG - Intronic
1059051405 9:110930630-110930652 AAGAAAGTGAATATTGGGCCGGG + Intronic
1059622186 9:116018902-116018924 AAAAAACAAGAAAGAGGGCCAGG - Intergenic
1060595809 9:124848004-124848026 AAAAGACAGAAAATAGGGCCAGG - Intergenic
1060856708 9:126919846-126919868 ACCAAACAGTATAGTGGGCCAGG + Intronic
1060887777 9:127167779-127167801 GAGGAACAGAAAAGAGGGCGAGG - Intronic
1060973203 9:127750533-127750555 AAGTACAAGAATAGAGTGCCTGG - Intronic
1061076845 9:128346704-128346726 AAAAAACAAAATAAAAGGCCGGG + Intronic
1061825231 9:133254286-133254308 ATGAAACAGAATAGAGAGCCCGG + Intronic
1061827058 9:133265049-133265071 AAAAATAAAAATAGAGGGCCAGG - Intronic
1062283486 9:135762450-135762472 AAGAAAAAGAAAAAAGGGCCAGG + Intronic
1062356447 9:136166454-136166476 AAAAAACTAAATAAAGGGCCGGG - Intergenic
1062439570 9:136563679-136563701 AGTAAACAGAAACGAGGGCCTGG - Intergenic
1062570362 9:137182215-137182237 AAGAAAAAGAAAAAAGGGCCGGG + Intronic
1185459282 X:327310-327332 AAGAAATAGAATCCGGGGCCGGG - Intergenic
1185635775 X:1550706-1550728 AACAAACCCAAAAGAGGGCCGGG + Intergenic
1185653485 X:1666160-1666182 AAGAGACAGAAGAGGAGGCCGGG - Intergenic
1185788596 X:2911373-2911395 AAAAAACCCAAAAGAGGGCCAGG + Intronic
1187090834 X:16094993-16095015 ATGAAACAGAATAGAGAACCTGG - Intergenic
1187185773 X:16983798-16983820 CAAAAACAAAATGGAGGGCCGGG - Intronic
1187379022 X:18783420-18783442 AAAATACAGAATAAAGGGCCAGG + Intronic
1187893802 X:23962266-23962288 AAGAAAGATAATAGAGGACAAGG - Intergenic
1188177013 X:27003430-27003452 AAGAAAGGATATAGAGGGCCGGG + Intergenic
1188315918 X:28673158-28673180 ATGGAACAGAATAGAGGACCCGG + Intronic
1188728510 X:33615355-33615377 GAGAAGCAAAATAGAGGGTCCGG - Intergenic
1188796792 X:34476864-34476886 AAGGAACAGAATGGAGAGCCCGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1188883201 X:35515947-35515969 AAAAAACAAAAAAAAGGGCCGGG - Intergenic
1188894988 X:35656362-35656384 ATGAAACAGAATAGAGAACCTGG - Intergenic
1189388419 X:40556245-40556267 AAGAAAGAGAAAAGGGAGCCAGG - Intergenic
1189411375 X:40775361-40775383 AAAAGACAGGAAAGAGGGCCGGG - Intergenic
1189626351 X:42901327-42901349 AAGAAACAAAAGAGAGGGAAGGG - Intergenic
1189778218 X:44488986-44489008 AGGAAGCAGGATATAGGGCCAGG + Intergenic
1189963502 X:46348509-46348531 AGGAAACAGAGTAGAGAACCTGG + Intergenic
1190421212 X:50286597-50286619 AAAAAACCGAACTGAGGGCCAGG - Intronic
1190847982 X:54211929-54211951 AAAAAAGAAAATATAGGGCCGGG + Intronic
1190902641 X:54693320-54693342 ATGTAACAGAATAGAGAACCTGG + Intergenic
1191745761 X:64484860-64484882 ATGGAACAGAATAGAGCCCCTGG + Intergenic
1192165485 X:68825070-68825092 AACAAACATAATAGAGCACCAGG + Intergenic
1192377777 X:70581591-70581613 AAGCAACAGTATATAGGACCAGG - Intronic
1192591741 X:72366061-72366083 AAGAACCATAATAGAGGTGCAGG + Intronic
1192724528 X:73734263-73734285 AATGAACAGAATAGAGAACCTGG - Intergenic
1193212042 X:78818388-78818410 AAGGAACAGAATAGAGAATCCGG + Intergenic
1193359705 X:80566631-80566653 ATGGAACAGAATAGAGATCCTGG - Intergenic
1193552032 X:82906315-82906337 ATGGAACATAATAGAGAGCCTGG - Intergenic
1193674423 X:84432163-84432185 ATGGAACAGAATAGAGAGCCCGG - Intronic
1193690902 X:84641336-84641358 ATGGAACAGAATAGAGAACCCGG + Intergenic
1193985485 X:88236316-88236338 ATGAAACAGGATAGAGAACCTGG - Intergenic
1194179021 X:90690061-90690083 ATGGAACAGAATAGAGAGCCTGG + Intergenic
1194284168 X:91989265-91989287 AAGAAGAAGAAAAGAAGGCCGGG + Intronic
1194419249 X:93651765-93651787 GAGAAACAGCAGAGAGGGTCTGG - Intergenic
1194544341 X:95214162-95214184 ACGGAACAGAATAGAGCCCCTGG - Intergenic
1194692436 X:97004116-97004138 ATGGAACAGAATAGAGAACCTGG - Intronic
1195224156 X:102775062-102775084 ATGGAACAGAATAGAGATCCCGG - Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195555995 X:106225025-106225047 AAGAAAAAGAAAAAAGAGCCTGG + Intergenic
1195690341 X:107619101-107619123 AAGAAAAAGAAAAGACGGCCGGG - Intergenic
1195732195 X:107979151-107979173 AATAATCAGGATTGAGGGCCAGG - Intergenic
1195933350 X:110101877-110101899 AAGAAAAACAATAGAGAGGCAGG - Intronic
1196815959 X:119665784-119665806 AAGAGTCAGTAGAGAGGGCCAGG + Intronic
1196972724 X:121126848-121126870 AAGAAAAAGAAAAGAAGGCCAGG - Intergenic
1197030770 X:121811579-121811601 ATGAATCAGAATAGAGAGCCTGG - Intergenic
1197082077 X:122430548-122430570 ATGGAACAGAATAGAGAACCAGG - Intergenic
1197395026 X:125916928-125916950 AGAAAACAGAATAGAGAACCTGG - Intergenic
1197495123 X:127170785-127170807 AAACAACAGAATATAGGGGCAGG + Intergenic
1197556447 X:127960871-127960893 ATGGAACAGAATAGAGACCCTGG - Intergenic
1197564331 X:128063209-128063231 ATAAAACAGAATAGAGAACCTGG + Intergenic
1197922097 X:131605887-131605909 ATGAAACAGAATGGAGAGCCTGG + Intergenic
1198277532 X:135110729-135110751 AAGAAAAAGAAAAGAAGGGCAGG - Intergenic
1198314599 X:135452994-135453016 GAGAAACACAACAGAGGGTCTGG - Intergenic
1198333643 X:135645186-135645208 AAGAGATAGAATAGATGACCAGG - Intergenic
1198687907 X:139247454-139247476 AAGAAACAGATTAGAGGCATAGG + Intergenic
1198733140 X:139755638-139755660 ATGGAACAGAATAGAGAGCCCGG + Intronic
1198769598 X:140115550-140115572 ATGGAACAGAACAGAGAGCCCGG - Intergenic
1199431743 X:147769090-147769112 ATGAAACAGAATGGAGAACCCGG - Intergenic
1199540823 X:148956125-148956147 AAGAAGAAGTACAGAGGGCCTGG + Exonic
1199706695 X:150432743-150432765 GTGAAACATAATAGAGAGCCCGG - Intronic
1200074204 X:153543290-153543312 GAGAATCAAAAGAGAGGGCCCGG - Intronic
1200525686 Y:4272232-4272254 ATGGAACAGAATAGAGAGCCTGG + Intergenic
1200601735 Y:5213822-5213844 AAGAAGAAGAAAAGAAGGCCAGG + Intronic
1201182576 Y:11363603-11363625 ATGAAACAGAATAGAGCCCTCGG + Intergenic
1201286323 Y:12381739-12381761 AAAAAACCCAAAAGAGGGCCAGG - Intergenic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic