ID: 917406686

View in Genome Browser
Species Human (GRCh38)
Location 1:174714074-174714096
Sequence CTTTTTCCTGCTCTTTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 353}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917406678_917406686 8 Left 917406678 1:174714043-174714065 CCTTCCTCCCCAGTGGTATCCAA 0: 1
1: 0
2: 2
3: 20
4: 219
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406680_917406686 4 Left 917406680 1:174714047-174714069 CCTCCCCAGTGGTATCCAAAGGT 0: 1
1: 0
2: 0
3: 7
4: 80
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406677_917406686 12 Left 917406677 1:174714039-174714061 CCTTCCTTCCTCCCCAGTGGTAT 0: 1
1: 0
2: 3
3: 43
4: 396
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406681_917406686 1 Left 917406681 1:174714050-174714072 CCCCAGTGGTATCCAAAGGTCAG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406682_917406686 0 Left 917406682 1:174714051-174714073 CCCAGTGGTATCCAAAGGTCAGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406676_917406686 13 Left 917406676 1:174714038-174714060 CCCTTCCTTCCTCCCCAGTGGTA 0: 1
1: 1
2: 9
3: 55
4: 450
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406674_917406686 25 Left 917406674 1:174714026-174714048 CCTGCAGTTATTCCCTTCCTTCC 0: 1
1: 0
2: 1
3: 30
4: 497
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353
917406683_917406686 -1 Left 917406683 1:174714052-174714074 CCAGTGGTATCCAAAGGTCAGCC 0: 1
1: 0
2: 0
3: 4
4: 117
Right 917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG 0: 1
1: 0
2: 4
3: 38
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917406686 Original CRISPR CTTTTTCCTGCTCTTTGTAG TGG Intronic
901948734 1:12724651-12724673 ATTTTTTATACTCTTTGTAGAGG + Intronic
902757865 1:18560961-18560983 CTGTTTCCTGCTCTGTATGGAGG - Intergenic
902847221 1:19121211-19121233 TTCTTTCTTGCTCTTTTTAGTGG + Exonic
903214394 1:21835498-21835520 CTGTTCCCTGCTCTTAGCAGAGG + Intronic
904506511 1:30960079-30960101 CTTGTTCCTGATCTTGGCAGGGG - Intronic
904872551 1:33628038-33628060 GTTTTGCCTGTTCTTTGTTGTGG - Intronic
905788860 1:40779516-40779538 CTTCCTCCTGCTCTCAGTAGAGG + Intergenic
908545063 1:65154089-65154111 CTTTTGCCTGCTGTGTGGAGAGG + Intronic
909368380 1:74855991-74856013 ATCTTTCCTGCTCTTTCTTGTGG + Intergenic
909519667 1:76552459-76552481 CTTTTGGCTCCTCTTTGTGGAGG + Intronic
910781606 1:90942404-90942426 TTTTTTCCTGCTCTTAGAAATGG + Intronic
910878226 1:91898081-91898103 TTTTTTCCTGTACTTTCTAGGGG - Intronic
911670398 1:100601347-100601369 CTCTTTCCTGCTTTTTCTTGTGG + Intergenic
913118211 1:115716007-115716029 CTGTTTCCTGATCTGTCTAGTGG + Intronic
915528197 1:156488895-156488917 CTCTTTCTTGCTCTTGGCAGGGG + Intronic
915714685 1:157933802-157933824 ATTTTTCCTGATCCTTATAGAGG + Intergenic
915854451 1:159366843-159366865 CTTTTTCCTGCCCTCGGCAGAGG - Intergenic
916538807 1:165731250-165731272 CTTTTTACTGCTTTGTGTAATGG - Intronic
917320237 1:173773610-173773632 TTTTTTCCTAGTCGTTGTAGTGG - Intronic
917406686 1:174714074-174714096 CTTTTTCCTGCTCTTTGTAGTGG + Intronic
919162648 1:193851281-193851303 ATCTTTCCTGCACTGTGTAGTGG - Intergenic
919251161 1:195057814-195057836 CATTTACCTGCTCTTGGCAGGGG + Intergenic
920121424 1:203661576-203661598 CTTTCTCCTGCTCTTTGAAAAGG + Intronic
921435109 1:215109791-215109813 CTCTATCCTGCTTTTTATAGTGG + Intronic
921844134 1:219860987-219861009 CTTGCTTCTGCTCTTTGGAGTGG - Intronic
922199403 1:223389329-223389351 CTATTTGCTGTTCTGTGTAGGGG + Intergenic
1062763579 10:45509-45531 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1063090386 10:2860804-2860826 TTTTTTCCTCATCTTTGAAGTGG - Intergenic
1063816953 10:9786603-9786625 CTTTTTACTGTTTTTTGTAATGG - Intergenic
1065309556 10:24401718-24401740 CTTTTTCCTGCCTATTGCAGTGG - Intronic
1066356318 10:34687568-34687590 CTGTTTCTTGCCCTTTGTGGAGG - Intronic
1066502016 10:36003687-36003709 TTTTTTCCTTCTCTTTCTAAAGG - Intergenic
1067313544 10:45139432-45139454 CTTTTTCCAGCTCAGTGTGGGGG + Intergenic
1067660012 10:48228477-48228499 CTTTTGTCTCCTCATTGTAGAGG + Intronic
1068824823 10:61424300-61424322 CTTTTTGATGCTCTTAGTAGTGG - Intronic
1068948403 10:62752930-62752952 CTTTTCTTTGCTCTTTGTATTGG - Intergenic
1070648751 10:78219966-78219988 CTTTCTGCTGCTCTTTGTTTGGG + Intergenic
1071138093 10:82475055-82475077 CTTTTTCTTGCTGTTTTTCGAGG - Intronic
1071167168 10:82820368-82820390 CCTTTTCCTTCTCTTTATATTGG + Intronic
1071445083 10:85738080-85738102 CTTTTTCCTGCTCCATCCAGTGG - Intronic
1071727529 10:88214748-88214770 ATTTTGCTTGCTATTTGTAGAGG + Intergenic
1072440967 10:95454792-95454814 CTCTTCCATGCTGTTTGTAGTGG - Intronic
1072710406 10:97712763-97712785 CTTTTTCCTTTTTTTTGTGGGGG - Intergenic
1073028528 10:100506418-100506440 CTCTTCCCTTCTCTTTTTAGGGG - Exonic
1073193900 10:101672542-101672564 CTTTTGCCTGCTCTCTGTTTAGG - Intronic
1073376479 10:103039763-103039785 TTCTTACCTGCTCTTTGTAGAGG + Intronic
1073702516 10:105944575-105944597 TTTTTTCCTGCTATTTTAAGTGG - Intergenic
1073888417 10:108068422-108068444 TTTTTTCCTGCTGTTTGTGGAGG - Intergenic
1074197961 10:111206021-111206043 GTTTTTCCTCCACTTTTTAGTGG - Intergenic
1074975202 10:118574743-118574765 CTTTTTCTTGATCTTTGAGGTGG - Intergenic
1075099928 10:119499053-119499075 ATTGTTCCTGCTATTTGTAGGGG - Intergenic
1075258418 10:120943487-120943509 CCTTTTCCAGCTCCATGTAGAGG - Intergenic
1075348946 10:121706518-121706540 CTTTTTCCTCCTCTCTAAAGTGG + Intergenic
1075827054 10:125367289-125367311 CTTTTTCCTGCTCAGTCTAAAGG - Intergenic
1076217189 10:128704496-128704518 CTTTTTTTTTCTTTTTGTAGAGG + Intergenic
1076346574 10:129782953-129782975 CCTTCTGCTGCTCTTTCTAGAGG - Intergenic
1076655322 10:132019796-132019818 CTCTTGTCTGCTCCTTGTAGTGG + Intergenic
1076724802 10:132408356-132408378 CTCTGGTCTGCTCTTTGTAGGGG + Intronic
1077912635 11:6586747-6586769 CTCCCGCCTGCTCTTTGTAGCGG - Intronic
1078358900 11:10653132-10653154 CTTTCTCCTGCTCTGAGTGGTGG + Intronic
1079014096 11:16854379-16854401 CTTTTTCCGGATCTTAGTAATGG - Intronic
1079157821 11:17964938-17964960 CTGTTTCCTGCTCCTTGTACAGG - Intronic
1079302959 11:19295823-19295845 CTTTTTCCTTCTCTTTCCATTGG + Intergenic
1079664558 11:23088154-23088176 TTTTTTCCTGCTGTTTTTGGTGG - Intergenic
1081494121 11:43589461-43589483 TTTTTTCCTTCTCTTTGGAATGG - Intronic
1081794142 11:45808116-45808138 CTCTTTCTTCCTCCTTGTAGGGG + Intronic
1082899486 11:58229686-58229708 CTATTTCTTAATCTTTGTAGTGG - Intergenic
1085050794 11:73379215-73379237 CTATTTCCACCTCTTTGTTGAGG - Intronic
1085526109 11:77165249-77165271 CTATGTCCTGCTCTGTGCAGTGG + Intronic
1087517094 11:99177684-99177706 TTTTTTCCTTCTCTCTGTATAGG - Intronic
1088746263 11:112807573-112807595 TTTTTTCCTGCTTTTTCAAGGGG - Intergenic
1089030371 11:115320774-115320796 CTCTTTCCTTCTATTTTTAGGGG - Intronic
1090362919 11:126185890-126185912 CTGTTTCCTCCTCTATGAAGGGG + Intergenic
1091152562 11:133342432-133342454 ATTTTCCCTGCTCTATGTACAGG - Intronic
1093256640 12:16875861-16875883 CTACTTCCTACTCTTTGTATAGG + Intergenic
1093493156 12:19726752-19726774 CTTCTGCCTGCTCTGTGGAGTGG + Intergenic
1094055167 12:26261782-26261804 CTTTTGCCTGCTTTTTGATGGGG - Intronic
1094404741 12:30105381-30105403 CTTTTTCCTGGTCTGTGTTCAGG - Intergenic
1095298199 12:40551079-40551101 CTTCTTCCTCCCCTTTATAGTGG + Intronic
1097053164 12:56235637-56235659 CCTCTTCCTGCTCTTTGTGCTGG + Exonic
1097572617 12:61354274-61354296 CTTTTTGCTTCTCTTTTTAAGGG - Intergenic
1097690569 12:62730681-62730703 CTTTTTCTTGCCCTTAGAAGGGG + Intronic
1097742922 12:63266162-63266184 CTTTTTCTAGCTCTTTGAGGTGG + Intergenic
1097945731 12:65365953-65365975 CTTTCTCTTGCTCTTTTTTGGGG + Intronic
1098010072 12:66041428-66041450 CATTCTCCAGCTCTTTATAGGGG - Intergenic
1098222717 12:68286939-68286961 CTTTTCCTTGGCCTTTGTAGGGG - Intronic
1098487424 12:71037619-71037641 TTTTTTCCTGCTCTTTGAACAGG - Intergenic
1099173024 12:79388326-79388348 CTTTTTCCTGCTTCTTTAAGGGG + Intronic
1100622833 12:96296256-96296278 GTTTTTCCTGCTTTTTTTATTGG - Intronic
1101645834 12:106630122-106630144 CTTTTTCCTGCTATTTTTTTGGG + Intronic
1102528146 12:113526556-113526578 TTTTTTCTTTCTCTTTGCAGTGG + Intergenic
1103230104 12:119322472-119322494 CTTTTTCCTGCGACTTCTAGAGG - Intergenic
1104098615 12:125584721-125584743 TTTTTTCATGCTCTCTGAAGGGG + Intronic
1105568984 13:21581552-21581574 ATTTTTCCTGATCTTTGAATAGG - Intronic
1106649348 13:31673078-31673100 CTATTTTCTGCTCTTTCTACTGG + Intergenic
1106719350 13:32422661-32422683 CTTGTTCTTGCTCATTGGAGAGG - Intronic
1107152590 13:37129212-37129234 CTCATTCTTGCTCTCTGTAGAGG + Intergenic
1107293155 13:38880411-38880433 CTTCTTCCGGCTCTTGGTGGTGG - Exonic
1107503292 13:41003219-41003241 CTTTTTTGTGCTCTTTGTTGGGG - Intronic
1108739753 13:53323495-53323517 CTTTTTTCTAGTCTTTTTAGTGG - Intergenic
1108797883 13:54054439-54054461 TTTTTTTCTGTTCTTTGGAGTGG - Intergenic
1110077285 13:71262723-71262745 CTTTTTCCTGTTCTTTAGATTGG - Intergenic
1110505274 13:76278783-76278805 CTTTATCCTGCTCAGTGGAGAGG - Intergenic
1112429448 13:99337773-99337795 CTTTTCCCTTCTCTCTGTGGAGG + Intronic
1112898679 13:104333602-104333624 CTTTTTCCTAATATTTTTAGTGG + Intergenic
1113601519 13:111572572-111572594 CTTCTTCATGCTGTTTGTAGGGG + Intergenic
1114148118 14:20002468-20002490 CTTCTTCCTGCATTTTGTAGGGG + Intergenic
1114430490 14:22656511-22656533 CTTTTTGCAGCACTTTGCAGGGG - Intergenic
1114517705 14:23310567-23310589 CTTTTTCATGGTATTTCTAGGGG + Exonic
1115964542 14:38872928-38872950 CTTTTTCCTGGTGTGGGTAGGGG - Intergenic
1116130764 14:40854187-40854209 CTTCTTCCTGCTTTGTGGAGTGG - Intergenic
1117307321 14:54489150-54489172 CTTTTCCCTGCTCCCTCTAGAGG + Exonic
1117471861 14:56054492-56054514 TTTTTTCCTGCCCTTTGTAAAGG + Intergenic
1118339787 14:64884941-64884963 CTTTTTCCTGTTATTGGTGGAGG - Intergenic
1118554620 14:67002992-67003014 CTTTTTCCTAGTCATTGTAAAGG + Intronic
1118726952 14:68635306-68635328 CTTTTACCTGCTTTATATAGTGG + Intronic
1118910540 14:70058685-70058707 CTCTGTCCTGCTGTTGGTAGAGG + Intronic
1121644667 14:95509562-95509584 CTGTTTCCTGCTCTTTAAAGAGG - Intergenic
1121807439 14:96841883-96841905 CTTTCTCCTTCCCTTTGAAGGGG + Intronic
1122330097 14:100906124-100906146 CTATCTCCTGCTCTTTCAAGGGG + Intergenic
1122757469 14:103993584-103993606 CTCTTTCCAGCTCCTGGTAGTGG + Intronic
1123705196 15:22946133-22946155 CTTTTTTGTGTTTTTTGTAGAGG - Intronic
1125443452 15:39728092-39728114 CTTTTTAATTCTCATTGTAGAGG - Intronic
1126084180 15:44995696-44995718 CTTTTGCCCGCTCTTTGATGGGG - Intergenic
1126308705 15:47290921-47290943 CTATTTCCATGTCTTTGTAGAGG - Intronic
1127845397 15:62866234-62866256 CTTTTATCTGCTTTTTGTATTGG + Intergenic
1127902313 15:63349938-63349960 ATTTTTCCTCCTCTTTTTTGAGG - Intronic
1128235180 15:66062139-66062161 CTTCCTCCTGCTCTTTGCAGAGG - Intronic
1129141382 15:73601309-73601331 CTTTTCCATGCTGTTTGGAGGGG - Intronic
1130834469 15:87635606-87635628 CATTTTCCTGCCCATTGGAGGGG - Intergenic
1130905291 15:88235769-88235791 CTTCTTGCTGCTTTTTGCAGAGG - Intronic
1131096445 15:89657473-89657495 TTTTTTCTTGCTCTTTCTGGTGG + Intergenic
1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG + Intergenic
1135580073 16:23617987-23618009 CTTTTTCTTTTTCTTTGTAGAGG - Intronic
1135762413 16:25147856-25147878 ATTTTTCCTGTTTTTTGTAGAGG + Intronic
1135860772 16:26053986-26054008 CCTTTTCCTTGTCTTTGTGGTGG - Intronic
1136093436 16:27936965-27936987 CTCTTTTCTGCTCTTCCTAGAGG + Intronic
1136093717 16:27938659-27938681 CTCTTTTCTGCTCTTCCTAGAGG - Intronic
1137240618 16:46652486-46652508 CTTTTTCTTTTTCTTTTTAGGGG - Intergenic
1138056231 16:53836839-53836861 CTTTTTCCTGAGCTTTGGGGAGG + Intronic
1138898656 16:61241531-61241553 CTTTTTTCTACTTTTTTTAGGGG + Intergenic
1140295806 16:73708772-73708794 CTTATTTATCCTCTTTGTAGGGG + Intergenic
1140937813 16:79691138-79691160 TTTTCTCCTGCTCTTTGCAGTGG + Intergenic
1143335481 17:6168916-6168938 CAATTTCCTGCTCTTAGGAGTGG + Intergenic
1143817512 17:9529506-9529528 CTTTTTCTTGCTGTGGGTAGTGG - Intronic
1144802566 17:17940576-17940598 CTTATTCCTGCTCTTTGTTCAGG - Intronic
1147748386 17:42710427-42710449 GTTTTTCCTTTTCTTTGTTGGGG + Intronic
1147772420 17:42877209-42877231 CTGTTCCCTGCTGTTTGTAGCGG + Intergenic
1149276717 17:55048620-55048642 CTTTTTCCTGATTTTTTTGGGGG - Intronic
1149330677 17:55577841-55577863 CTCCTTCCTGCTCTGTGGAGTGG + Intergenic
1150750368 17:67856433-67856455 CTTTTTCCTATTCTTTGTTTTGG + Intronic
1151172661 17:72260462-72260484 CTTATTACTGCTCTTTGTCCAGG - Intergenic
1152956488 18:45840-45862 CCTTTTCCTGCTCTTAGAACAGG + Intergenic
1153890940 18:9514481-9514503 CTATTTCCAGATCCTTGTAGTGG - Intronic
1154025252 18:10701418-10701440 CTTTCTCCTGCTTATTGTGGAGG - Intronic
1156040559 18:32815947-32815969 CTCTTTCCTGCTTTTTTTACTGG - Intergenic
1156108911 18:33699664-33699686 CATTTTCATATTCTTTGTAGGGG - Intronic
1158500137 18:57993559-57993581 CATTTTCCTGCTCTATGCAAAGG + Intergenic
1158831827 18:61287912-61287934 TTTTTTCCTGACTTTTGTAGGGG - Intergenic
1158886698 18:61834935-61834957 CTTTTTGCAGATCTTTGCAGTGG - Intronic
1159233889 18:65645729-65645751 ATCTTTCTTGCTCTTAGTAGTGG - Intergenic
1161186694 19:2926324-2926346 CTTTTTCCAGCTCTTTCTCCCGG - Intergenic
1162250287 19:9436523-9436545 GTTTTTGCTGTGCTTTGTAGTGG + Intergenic
1162575991 19:11499138-11499160 GTTTTTCCTGCTCCTTGAGGTGG - Intronic
1162878968 19:13643140-13643162 CTATTTCTTGATTTTTGTAGAGG - Intergenic
1163711439 19:18849551-18849573 CTTTTTGCTGCTTTTTGCGGGGG + Intronic
1164442132 19:28286882-28286904 CTTTTTCCTGCTGTTTCCCGGGG - Intergenic
1165304094 19:34992832-34992854 CTTTTTCTTGATCTCAGTAGCGG + Intergenic
1166255236 19:41599697-41599719 CTTTGTCCTCCTCTGTGGAGAGG - Intronic
1166276146 19:41755601-41755623 CTCTGTCCACCTCTTTGTAGAGG - Exonic
1166793000 19:45408942-45408964 TTTTTTCCTCTTCTTCGTAGGGG - Exonic
1168209229 19:54877701-54877723 CTTTTTCTAGCTTTTTGAAGTGG + Intronic
925904214 2:8529621-8529643 CTTTCTCCTGCTTTTTGCAATGG + Intergenic
928569185 2:32585886-32585908 GATTTTTCTGCTCTATGTAGTGG + Intronic
929713896 2:44291878-44291900 CTTTCTCCTCCTCTTTGTACTGG + Intronic
931527305 2:63170755-63170777 CTTTTTCCTGCTTATTTTTGTGG + Intronic
931832646 2:66068506-66068528 CTTTTTACTGTTCTTGTTAGAGG - Intergenic
932920651 2:75910515-75910537 CTTTTTCCTTTTCTGTGCAGAGG + Intergenic
933046522 2:77544656-77544678 TTTTGTCCTTCTCATTGTAGTGG - Intronic
935274508 2:101464408-101464430 ATGTTTCTTGCTCTTTGTGGCGG - Intronic
935664201 2:105496081-105496103 CTTTCTCCTACTCTCTCTAGGGG + Intergenic
937254240 2:120543540-120543562 CTTTTTCCTGCTTTTTGAGTAGG - Intergenic
937733393 2:125261052-125261074 CTTTTTCTTCCTCTTTGAAGGGG + Intergenic
938249195 2:129800723-129800745 TTATTTCCAGCTCTCTGTAGTGG + Intergenic
939055092 2:137355788-137355810 CTTTTTCCTTCTCTGTAAAGTGG + Intronic
939811243 2:146835503-146835525 ATTTTTCCTACTTTTAGTAGTGG + Intergenic
941005999 2:160247680-160247702 CTTTTTCCTTCACTCTTTAGGGG - Intronic
942624790 2:177888370-177888392 GTTTTGCCTCCACTTTGTAGTGG - Intronic
943339575 2:186663327-186663349 CTATTTCCTGATATTGGTAGAGG + Intronic
944483759 2:200182238-200182260 CTCTTTCCTGCTCAGTGGAGTGG - Intergenic
945374961 2:209068642-209068664 CTTTTTCTTTCTTTTTGTGGGGG - Intergenic
947572296 2:231245740-231245762 CTGTTTTCTGCTGTTTGTAATGG + Intronic
1170980179 20:21205200-21205222 ATTTTTCCTGGACTCTGTAGAGG + Intronic
1171098068 20:22351776-22351798 ATGTTTCCTCCTCTTTGTAAGGG - Intergenic
1171415265 20:24974309-24974331 CTTTTTTTTACTTTTTGTAGTGG - Intronic
1172329268 20:34063692-34063714 CTATTTCCAGCTCTATGTACAGG + Intronic
1172440768 20:34964852-34964874 CTTTTTCATGATCTTTATATTGG + Intergenic
1172550546 20:35795765-35795787 CTTTTTCCTCATCTTTATAATGG + Intronic
1172928676 20:38565309-38565331 TTTTTTCCTACTTTTTGAAGCGG + Intronic
1173963428 20:47092584-47092606 ATGTTTTCTGCTCTCTGTAGGGG + Intronic
1174058747 20:47817456-47817478 TTTTTTCCTTCTCTTTGGATGGG + Intergenic
1174242872 20:49152280-49152302 CATTTCCCTGCTCTCTGTTGGGG - Intronic
1174263911 20:49318159-49318181 CTTTGCGCAGCTCTTTGTAGTGG - Intergenic
1174726997 20:52873042-52873064 CTTTTTCCTGCCTTTTCTAGTGG - Intergenic
1175270656 20:57731606-57731628 CTTTCTTCTGCTCTTTGTCCTGG + Intergenic
1177070930 21:16506851-16506873 TTATTTCCTGCTCTTTGGAAGGG + Intergenic
1177377106 21:20285229-20285251 CTTTTTTCTGCTTTTTTTAAAGG + Intergenic
1177511703 21:22095243-22095265 TTGTTTCTTACTCTTTGTAGTGG + Intergenic
1178616974 21:34143255-34143277 GTTTGTGCTGCTCTTTGTGGTGG + Intergenic
1178822287 21:35986430-35986452 ATTTTTCCAGCTCTATGTGGTGG + Intronic
1179021972 21:37648719-37648741 CTTCTTCCTGCTATTTCTTGGGG + Intronic
1179312004 21:40204863-40204885 CTTTTTCCTGCTTTGTGTTATGG + Intronic
1181003923 22:20000553-20000575 CTTCTCCCACCTCTTTGTAGTGG - Intronic
1181143308 22:20823979-20824001 ATTTTTCTTGCTCTTTGTTGGGG - Intronic
1181265469 22:21628580-21628602 CTTTCTCTTGCTCTTGGGAGCGG - Exonic
1183523334 22:38309252-38309274 CTCTTGCCTGGTCTCTGTAGTGG - Intronic
950132878 3:10559517-10559539 TTTTTTCCTTTTCTTTTTAGTGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951394630 3:22150557-22150579 CTTTTTAGTGCTCATTGCAGTGG - Intronic
951832484 3:26945886-26945908 ATTTTTCCTGCTTTCTGTTGTGG - Intergenic
952056387 3:29451945-29451967 ATTTTTCCTCCTCTTTTCAGGGG - Intronic
953446434 3:42972554-42972576 CTGTTTGATGCTCTTTGAAGAGG + Intronic
953905002 3:46864313-46864335 CTTTCTCTTGCCCTTTGTGGGGG - Intronic
954263446 3:49456285-49456307 CTTTTTGCTGCTTTTTTAAGGGG + Intergenic
954596407 3:51829412-51829434 CTGTTTCCTGATCTTGGCAGGGG - Exonic
956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG + Intergenic
956515813 3:70046791-70046813 CTTTTTCCTGCTTCTAGAAGTGG + Intergenic
956596423 3:70972253-70972275 CTTTTTCCTGTTCCCTGTATTGG - Intronic
957657951 3:83106781-83106803 CTTTTTATTCCTTTTTGTAGGGG - Intergenic
959181313 3:102984159-102984181 CTTTTGCCTGCTCTTTAGTGGGG - Intergenic
959849468 3:111071031-111071053 ATTTTTCCTGCTCTTTTTTCTGG - Intronic
960121161 3:113949400-113949422 CATTTTCCTGCTGTTAGTACTGG + Intronic
960722736 3:120640720-120640742 CTTTTTCGTGCTGTTTGTTTGGG + Intronic
961872287 3:129997425-129997447 CTTTTTCTTTTTCTTTTTAGAGG + Intergenic
962396983 3:135024602-135024624 CTTTTTCCTTCCTGTTGTAGTGG + Intronic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
962944755 3:140157025-140157047 CTTGCCCCTGCCCTTTGTAGAGG + Intronic
963101440 3:141609857-141609879 TATTTTCCTGCTCTTTGTAGAGG + Exonic
963394844 3:144718361-144718383 TTTTTTCCTTCTCTGTGGAGTGG - Intergenic
964843270 3:161017775-161017797 CTTTTTCCTTGTATTTGTAGTGG - Intronic
965899623 3:173622570-173622592 TTTTTTCCTCCTCTTTTTACCGG - Intronic
966287597 3:178315806-178315828 ATTTTTCCTGCACTTTGGGGAGG - Intergenic
966438798 3:179920274-179920296 CTTCATCCTGCTCTTTTTAGAGG + Intronic
966530910 3:180978694-180978716 TTTTTTCCTTCTCTTTAAAGAGG - Exonic
966863612 3:184244113-184244135 GGTTTTCCTGCTATTTCTAGTGG - Intronic
967336008 3:188345475-188345497 CTGTTTCCTGCACATTGTTGGGG + Intronic
967478111 3:189943999-189944021 ATTTTTCCTGCTGTTTACAGTGG + Intergenic
968357843 3:198122390-198122412 CCTTTTCCTGCTCTTAGAACAGG - Intergenic
968849798 4:3071374-3071396 CTTTTTCCTGCTCCCTGGAATGG - Intergenic
970371888 4:15416435-15416457 GGTTTGCCTGCACTTTGTAGTGG - Intronic
971290849 4:25337844-25337866 CTTTTTCAAGCTATTTTTAGTGG + Intronic
972587893 4:40455147-40455169 CTATTTCTGGCTCTTTGTAAAGG + Intronic
972806256 4:42531930-42531952 CTTTTTTGTGTTTTTTGTAGAGG - Intronic
973334362 4:48941415-48941437 CTTGTACCTTCTCATTGTAGTGG + Intergenic
973685401 4:53365159-53365181 CTTCTTCCTGTTCTTTGCAGGGG + Exonic
973910730 4:55577454-55577476 CTATTCCCTGCTCTCTGGAGAGG - Intronic
974102414 4:57431717-57431739 ATTTTTTCTGCTCTTTGTAGGGG + Intergenic
975146202 4:70969811-70969833 TTTTCACCTGTTCTTTGTAGGGG + Intronic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
979770317 4:124516181-124516203 CTTTTTCTTTCTCTTTGGATTGG + Intergenic
980660759 4:135855220-135855242 CTCTTTCCTCCTCTTTCCAGAGG + Intergenic
981235829 4:142414874-142414896 CTTTCTGCTGCTCTTTTCAGTGG + Intronic
982403131 4:154990633-154990655 ATTATTCCTGCACTTTTTAGTGG + Intergenic
985105113 4:186492142-186492164 CTCTTCCCTTCTCTTTCTAGAGG + Intronic
985987285 5:3526866-3526888 CAGTTTCCTGCTCTTTGTAAAGG + Intergenic
986439888 5:7771292-7771314 CCTTTTCCTGTTCTCTGTCGTGG + Intronic
986600836 5:9470933-9470955 CTTTTTCCAGCTCTATGGAATGG - Intronic
987692124 5:21280913-21280935 CTTTTTCCTTCTCTTTTTTAAGG - Intergenic
988868074 5:35357190-35357212 CTTCTTCCTGCTGTTTTCAGAGG + Intergenic
989669665 5:43900917-43900939 CTTTTTCCTTTTCTTTGAACTGG + Intergenic
990073432 5:51813812-51813834 CTTTTTCCAGCTCTCTAAAGTGG - Intergenic
990334587 5:54759619-54759641 CTTTTCCCTGCTCTGTGTCCAGG - Intergenic
990605894 5:57409843-57409865 CATTTTCCTGCTCTTAGAATTGG - Intergenic
991469435 5:66952366-66952388 ATATTTCCTGCTCTTTGAAGTGG + Intronic
991917391 5:71618557-71618579 CTTTCTCTTTCTTTTTGTAGAGG + Intronic
992155478 5:73951397-73951419 CTTTTTCCTGCTCATTATGAAGG - Intergenic
992456518 5:76921373-76921395 CTTGTTCCTTCTCTTTGGATGGG + Exonic
994064426 5:95520506-95520528 ATTTCTTCTGCTCTTAGTAGTGG - Intronic
995077531 5:108004551-108004573 CTTTTTCCTCCTCTTTGCCCAGG - Intronic
995211704 5:109547674-109547696 CTTTTTTCTGCTTTTTGTTGTGG - Intergenic
995323680 5:110866458-110866480 CATTTTCATGCTCATTGCAGTGG + Intergenic
995782765 5:115795558-115795580 GTTCTTTCTGCTCCTTGTAGAGG + Intergenic
997116501 5:131131073-131131095 CTTTTTCCTTTTCTCTTTAGGGG - Intergenic
997193165 5:131959081-131959103 CTGTTTCCTCCTCTTTACAGAGG + Intronic
998887415 5:146708552-146708574 CTTCATACTGCTCTTTTTAGTGG + Intronic
999319467 5:150604466-150604488 CTTTTTCCTGGGTTTGGTAGGGG + Intronic
999363017 5:151001913-151001935 CTTGTGCCTGCTCTCTGCAGAGG - Intergenic
999505593 5:152192555-152192577 CTTATTCCTGAGCTTTGTGGGGG + Intergenic
999610752 5:153366697-153366719 CCATTTCCTGCTCTGTGAAGTGG + Intergenic
1000026845 5:157366602-157366624 CTTCTTCCTGCAATCTGTAGTGG + Intronic
1000426109 5:161093373-161093395 CTTCTGCCTGCTCTTTGGAGTGG - Intergenic
1000710771 5:164574337-164574359 TTTTTTCTTTCTTTTTGTAGGGG - Intergenic
1001573974 5:172749858-172749880 CATTGTCCTGCCCTTTGGAGAGG - Intergenic
1001825069 5:174737852-174737874 CATTTTCCTGCTCTTTGTAAGGG - Intergenic
1002408534 5:179055010-179055032 CCTTTCCCTGCCCTTTGTGGGGG + Intergenic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1003797867 6:9625615-9625637 CTTTTTCCTGCATTTTCTTGTGG + Intronic
1004918820 6:20357232-20357254 CATTTTCCTGCTCACTGTTGGGG - Intergenic
1005417963 6:25621694-25621716 CATTTTCCCTCTCCTTGTAGTGG + Intergenic
1005442279 6:25882784-25882806 CATTTTCTTGCTCTCTATAGAGG - Intergenic
1005745541 6:28833764-28833786 TTTTTTCCTCCTGTTTGTTGAGG - Intergenic
1005873405 6:29994289-29994311 CTATTTCCGGCCCTTTGTTGGGG + Intergenic
1006611282 6:35295918-35295940 TTTTTTCCTGCTCTGGGTGGTGG + Exonic
1006652840 6:35565770-35565792 TTTTTTCCTGCAGTTTTTAGGGG + Intergenic
1007190989 6:40018280-40018302 CTTGTTCATACTCTTTGTAATGG + Intergenic
1007545536 6:42690843-42690865 CTTTTACCTGCTCTTGGCAAAGG + Intronic
1007751577 6:44074730-44074752 TTTTTTCCTGCACTTCCTAGTGG - Intergenic
1008240226 6:49101196-49101218 CTTTTTCCCACTTTTTGAAGGGG - Intergenic
1009290993 6:61882137-61882159 CTTTTTTCTACTCTTGGTATAGG - Intronic
1009652350 6:66492063-66492085 ATTTTTCCTGCTTTTTCTTGTGG - Intergenic
1011764228 6:90602464-90602486 CTTTTTTTTGCTCTTTATATTGG + Intergenic
1011813986 6:91166778-91166800 CTCTCTCCTCCTCTCTGTAGTGG - Intergenic
1013700287 6:112759789-112759811 CATTTTCCTTCTTTCTGTAGAGG + Intergenic
1014289211 6:119539411-119539433 CTTCTTCCTGCTCCATGTAGTGG - Intergenic
1015096699 6:129423314-129423336 CTTTTTCTTGCCCCTTGTACTGG - Intronic
1015467644 6:133565278-133565300 GTTTTTACTGTTTTTTGTAGAGG - Intergenic
1017195789 6:151698615-151698637 CTTTTTCCTTCTCTTCCAAGGGG + Intronic
1017605862 6:156132342-156132364 CTTTTTAATGCTTTTTGTAATGG - Intergenic
1018807049 6:167269925-167269947 CTTTTTCCTGCTTTTTGTACAGG + Intergenic
1020364402 7:7365116-7365138 CTTTTTCCTCCTCTCTCCAGAGG - Intronic
1020584349 7:10047361-10047383 CTTTTTCTTGCTGTTTGCACAGG + Intergenic
1023465789 7:40453078-40453100 CTTTTTCATGTTCTTTGCACCGG - Intronic
1023547832 7:41337893-41337915 TTTTTTCCTGATCTTTTTGGAGG - Intergenic
1023558258 7:41445780-41445802 CTTTTTCTTTTTCTTTCTAGAGG + Intergenic
1024635005 7:51280050-51280072 TTTTTTGCTGCTCTATGTGGAGG - Intronic
1025573461 7:62604296-62604318 ATCTTTCCTGCTCTCTCTAGTGG - Intergenic
1026485345 7:70814555-70814577 CTTTTTCTTGTTCTTTGAGGTGG - Intergenic
1027980575 7:85214950-85214972 ATTTTTCCTACTCTTTCTATAGG - Intergenic
1028170121 7:87586177-87586199 CTTTTTTCTGCTCATTCTTGAGG - Intronic
1028199537 7:87945002-87945024 CTTCTTCTTGGTCTTTGTAAAGG + Intronic
1028934915 7:96454191-96454213 CTGTTTCTTGCTCTGTGTGGAGG - Intergenic
1029325762 7:99807557-99807579 CTTTTTCTTTTTCTTTGAAGGGG + Intergenic
1029530913 7:101124745-101124767 CTTTTTCCTTTTCTTAGTTGTGG - Intergenic
1029566740 7:101343596-101343618 CATTTTCATGCTCTTTCTACGGG + Intergenic
1030545346 7:110887764-110887786 CGTTTTCCTGAGCTTTTTAGGGG - Intronic
1030690034 7:112522939-112522961 TTTTTGCCTTCTTTTTGTAGTGG + Intergenic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1033102127 7:138483084-138483106 ATTTTTCCTCATTTTTGTAGCGG + Intronic
1038465489 8:27758941-27758963 TTCTCCCCTGCTCTTTGTAGAGG - Intronic
1038629900 8:29231758-29231780 CTTTTTCCTTTTTTTTTTAGAGG - Intronic
1038782333 8:30579014-30579036 CTTTTTCCTTCTCTGAATAGGGG + Exonic
1039748633 8:40456388-40456410 CTTTTTTCAGCTCATTGTGGTGG + Intergenic
1041071975 8:54134352-54134374 CTTTTTCTTTCTTTTAGTAGTGG - Intergenic
1042211808 8:66388739-66388761 CTGTTTCCTTCTTTTTGTAGAGG + Intergenic
1043208786 8:77483908-77483930 CTTTCTCCTGCTTTCTGTAATGG + Intergenic
1043501095 8:80857295-80857317 CTTATTCCTGATATTGGTAGAGG + Intronic
1044039172 8:87343978-87344000 CTTTTTCATGCTCTTTGCTTAGG + Intronic
1045037058 8:98184058-98184080 CTTTTTCTAGCCCTTTTTAGAGG - Intergenic
1046875871 8:119254026-119254048 ATCATTCCTGGTCTTTGTAGGGG + Intergenic
1047264112 8:123289574-123289596 CATTTTCCTGCTCTAGGAAGTGG - Intergenic
1048645133 8:136411435-136411457 CTCTTTTCTGCCCTTTGCAGGGG + Intergenic
1048936508 8:139362108-139362130 TTTTTTCCTCCTCTTTGAAGAGG + Intergenic
1050327287 9:4509673-4509695 CTTTGTCCTGCTCTGTGCACTGG - Intronic
1050662861 9:7902324-7902346 TTTTTTCCTGCTCTTTTTAAAGG + Intergenic
1051084543 9:13333227-13333249 CTTTTTCCTGCTCTAAGAAAAGG + Intergenic
1051487257 9:17622578-17622600 TTTTTTTTTGGTCTTTGTAGAGG - Intronic
1051596130 9:18825972-18825994 CTGTTTCCTCCTCTTTGTACTGG + Intronic
1052707449 9:32010642-32010664 CTCCTTCCTGCTCTATGGAGTGG - Intergenic
1053348017 9:37392391-37392413 GTCTTTCCCGCCCTTTGTAGTGG + Intergenic
1054450411 9:65400898-65400920 CCTTTTCCTGACCTTTCTAGGGG + Intergenic
1055574762 9:77649357-77649379 CTTATGCCTGCTCTTAGTAGAGG - Intergenic
1055680930 9:78714454-78714476 CATTTTCATGCTATTTGTACTGG + Intergenic
1055854777 9:80672569-80672591 TATTTTTCTGCTCTTTGTATGGG + Intergenic
1056513325 9:87326924-87326946 ATTTTTTCTATTCTTTGTAGAGG - Intergenic
1056936884 9:90921809-90921831 CTTTTTCTTGCTTTTTGAACAGG - Intergenic
1057935689 9:99236812-99236834 CTTTTTTTTGTTTTTTGTAGAGG + Intergenic
1059506384 9:114803373-114803395 CTTTTTCCTTTTCTCTGAAGGGG - Intronic
1062188033 9:135229027-135229049 CTTTTTCCTGAACTTTGTATTGG - Intergenic
1186672472 X:11781415-11781437 CTTTTTCATGCTTTTTGCTGTGG - Intergenic
1187807003 X:23131688-23131710 CTTTTTCCTGATTTCTGAAGTGG + Intergenic
1188824324 X:34811515-34811537 TTTTTTTCTGCCCTTTGTTGGGG + Intergenic
1189221368 X:39375096-39375118 CTTTTTTGTATTCTTTGTAGAGG - Intergenic
1189551258 X:42095977-42095999 CTTCTCCCTGCTCTTTGCAGAGG - Intergenic
1191746978 X:64500321-64500343 CTCTTTCCTGCTTTCTCTAGTGG + Intergenic
1193297096 X:79846246-79846268 CTTTTTCCTCCTATTTTTATAGG + Intergenic
1193426791 X:81349250-81349272 CATTTTCCTCCTCCATGTAGTGG + Intergenic
1193650186 X:84122499-84122521 TTTTTTCGTGCTTTTAGTAGAGG + Intronic
1194007719 X:88517576-88517598 CTTCTTCCTGCTCTTCTCAGAGG - Intergenic
1194295563 X:92122524-92122546 TTTTTTTCTTTTCTTTGTAGAGG - Intronic
1197037606 X:121895355-121895377 CTTTTTCCTGCTTTTTATTCTGG - Intergenic
1197052514 X:122077133-122077155 CTCTTTCCTCCTCTTTCTACAGG + Intergenic
1198094246 X:133362897-133362919 GATTTACCTGTTCTTTGTAGTGG - Intronic
1198272651 X:135068903-135068925 CTGTTTCCTGCTGTTTTTATGGG - Intergenic
1198459651 X:136850850-136850872 CTTTTTCATGCTCATTTTTGTGG + Intronic
1198921518 X:141733875-141733897 ACTTTTCCTGGTCTTTGTGGAGG + Intergenic
1199402753 X:147418499-147418521 CTTTTTCTAGGACTTTGTAGTGG - Intergenic
1199543023 X:148978731-148978753 CTTTTTGCTGCTCTGTGAGGTGG + Intronic
1200326374 X:155244753-155244775 CTTTTTCTTTCTCTTTTTAAAGG - Intergenic
1200613066 Y:5347038-5347060 TTTTTTTCTTTTCTTTGTAGAGG - Intronic
1200741731 Y:6861413-6861435 CATTTTCCTGTCCTTTGTGGTGG + Intergenic
1200766942 Y:7088116-7088138 CCTTTTTCTACTCTTTTTAGTGG - Intronic
1201577166 Y:15473366-15473388 CTTTTACCTGCTCATTCTTGAGG + Intergenic
1202093966 Y:21225022-21225044 CTTTTTTCTGCTGTTTTTTGAGG + Intergenic
1202177921 Y:22114616-22114638 CTTCATCCTGGTCTTTGCAGGGG + Intergenic
1202213440 Y:22471779-22471801 CTTCATCCTGGTCTTTGCAGGGG - Intergenic