ID: 917411298

View in Genome Browser
Species Human (GRCh38)
Location 1:174762509-174762531
Sequence TAGATGTCCTAGAAGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917411298_917411300 1 Left 917411298 1:174762509-174762531 CCCTTTGTCTTCTAGGACATCTA 0: 1
1: 0
2: 2
3: 9
4: 239
Right 917411300 1:174762533-174762555 TTGACAGTCCTTTGCATACTTGG 0: 1
1: 0
2: 0
3: 5
4: 133
917411298_917411303 22 Left 917411298 1:174762509-174762531 CCCTTTGTCTTCTAGGACATCTA 0: 1
1: 0
2: 2
3: 9
4: 239
Right 917411303 1:174762554-174762576 GGGACTGATACCTGATTAAATGG 0: 1
1: 0
2: 0
3: 15
4: 109
917411298_917411305 30 Left 917411298 1:174762509-174762531 CCCTTTGTCTTCTAGGACATCTA 0: 1
1: 0
2: 2
3: 9
4: 239
Right 917411305 1:174762562-174762584 TACCTGATTAAATGGTTGGTTGG 0: 1
1: 0
2: 1
3: 16
4: 114
917411298_917411301 2 Left 917411298 1:174762509-174762531 CCCTTTGTCTTCTAGGACATCTA 0: 1
1: 0
2: 2
3: 9
4: 239
Right 917411301 1:174762534-174762556 TGACAGTCCTTTGCATACTTGGG 0: 1
1: 0
2: 0
3: 32
4: 275
917411298_917411304 26 Left 917411298 1:174762509-174762531 CCCTTTGTCTTCTAGGACATCTA 0: 1
1: 0
2: 2
3: 9
4: 239
Right 917411304 1:174762558-174762580 CTGATACCTGATTAAATGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917411298 Original CRISPR TAGATGTCCTAGAAGACAAA GGG (reversed) Intronic
900059103 1:664537-664559 TAGAACTCCTAGAAGAAAACAGG - Intergenic
905306907 1:37025992-37026014 TAGCTCTCCTAGAAGACAGCAGG - Intronic
907857545 1:58318576-58318598 AAACTGTCCTAGAAGCCAAAAGG + Intronic
911277613 1:95880646-95880668 TGGATGGCTTAGAAGACAGATGG - Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
913478898 1:119265708-119265730 TTGATGGCCTGGAAGATAAAAGG + Intergenic
913568609 1:120098195-120098217 TAGATGTGCTAGAAGCTACAAGG + Intergenic
913974608 1:143445158-143445180 TAGATGACTCAGAAGAAAAAGGG + Intergenic
914068998 1:144270774-144270796 TAGATGACTCAGAAGAAAAAGGG + Intergenic
914110157 1:144695580-144695602 TAGATGACTCAGAAGAAAAAGGG - Intergenic
914289423 1:146259216-146259238 TAGATGTGCTAGAAGCTACAAGG + Intergenic
914550459 1:148709969-148709991 TAGATGTGCTAGAAGCTACAAGG + Intergenic
916336017 1:163672059-163672081 AAGATCTCCTAGCAGAGAAAAGG + Intergenic
917411298 1:174762509-174762531 TAGATGTCCTAGAAGACAAAGGG - Intronic
918409310 1:184242211-184242233 TAGATGTCCCAGAATCCACAGGG + Intergenic
919042325 1:192406450-192406472 AAAATGGCTTAGAAGACAAAGGG - Intergenic
921795957 1:219345302-219345324 TAGATGTCCTAAAAGATTAATGG + Intergenic
1063582730 10:7323515-7323537 CAGTTGCCATAGAAGACAAAAGG + Intronic
1064960634 10:20960956-20960978 TAGATATCCAAGAAGAAATATGG - Intronic
1065273214 10:24057999-24058021 TAAATTTCCTAGAAGAAAACAGG - Intronic
1065640440 10:27776736-27776758 TTGATGACCGAGAAGGCAAAAGG + Intergenic
1065658967 10:27985250-27985272 TTGTTGTACTAGAAGACAAGTGG - Intronic
1065917167 10:30363469-30363491 TACATGTCCCAGTACACAAAAGG - Intronic
1066004838 10:31136498-31136520 TAAATGACCTAGAAGAGAAAAGG - Intergenic
1069684118 10:70306408-70306430 TCAATGTCATAAAAGACAAAGGG - Intronic
1074325690 10:112448367-112448389 AAGATGTGCTAAAACACAAAAGG - Intronic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1076964201 11:66719-66741 TAGAACTCCTAGAAGAAAACAGG - Intergenic
1079218925 11:18541768-18541790 AAGATGGCCGAGAAGGCAAAGGG + Intronic
1079661028 11:23036733-23036755 TAGATCTGATAGAAGACATAAGG + Intergenic
1080744751 11:35098864-35098886 TAGATTTCCTAGAAGATCCACGG - Intergenic
1080934247 11:36845407-36845429 AAGATGTCCTCCAAAACAAACGG - Intergenic
1081430014 11:42966724-42966746 TAGAATTCCTAGAAGGAAAATGG - Intergenic
1084628956 11:70333027-70333049 CAGAGCTCCCAGAAGACAAAAGG - Intronic
1086343526 11:85871670-85871692 TAAATGTCCAAGCAGTCAAATGG - Intronic
1086606229 11:88699857-88699879 TCGATGTCAGAGGAGACAAAAGG + Intronic
1087892931 11:103555819-103555841 GAAATGTCCTAACAGACAAAGGG - Intergenic
1088142257 11:106631704-106631726 ATAATGTCTTAGAAGACAAAAGG - Intergenic
1089832696 11:121342680-121342702 GCAATGTCCTAGAAAACAAAAGG + Intergenic
1090641427 11:128732253-128732275 TAGATGTCCTAGATGAGAAGGGG - Intronic
1093598659 12:20994461-20994483 TAGATGTTTTAGAAGACAACAGG - Intergenic
1093888301 12:24488994-24489016 TTGCTTGCCTAGAAGACAAATGG - Intergenic
1096332322 12:50724760-50724782 TTGCTGACCTAGAAAACAAATGG - Exonic
1096990218 12:55795401-55795423 TAGATGCCCTCAAAAACAAAAGG + Intronic
1098496401 12:71140812-71140834 TAGAGGTTATAGAAGGCAAATGG - Intronic
1100215256 12:92441285-92441307 AAGATGTCCTAGTAGCCAGAGGG - Intergenic
1100483898 12:95006077-95006099 TAAAACTCCTAGAAGACAACGGG - Intergenic
1102051661 12:109866721-109866743 TAGTTGTCCTAAAAGCCTAAAGG - Intronic
1103738177 12:123073869-123073891 TAGTTGTCTGAGAAGAGAAAAGG - Intronic
1105359547 13:19694841-19694863 TAGCTATCTTAGGAGACAAAGGG - Intronic
1109295712 13:60527798-60527820 TAGATATCCTACTATACAAAAGG - Intronic
1109376578 13:61502943-61502965 TAGATGTTTTAAAAGAAAAAGGG - Intergenic
1109988550 13:70022079-70022101 GAAATCTCCTAGAAGAAAAAAGG - Intronic
1110654715 13:77984192-77984214 TAGTTCTTCTAGAAAACAAAAGG - Intergenic
1115872319 14:37818597-37818619 TATATGTCCTCAAAGAGAAAAGG - Intronic
1116030519 14:39565582-39565604 AAGAAGTCCTAGAAAACAGAAGG - Intergenic
1117033453 14:51700899-51700921 AAGAGATACTAGAAGACAAAAGG - Intronic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1119567953 14:75644926-75644948 TCTATGTGCTAGAAGAAAAATGG - Intronic
1119626655 14:76182882-76182904 AAGCTGTCATAGAAGACAACAGG + Intronic
1120072066 14:80114902-80114924 TAGATTTCCTAGAAAAAAAAAGG - Intergenic
1123665446 15:22606569-22606591 TACATGTCCCAGTACACAAAAGG - Intergenic
1123752311 15:23366082-23366104 TACATGTCCCAGTACACAAAAGG + Intronic
1124319277 15:28700984-28701006 TACATGTCCCAGTACACAAAAGG - Intergenic
1124483245 15:30094448-30094470 TACATGTCCCAGTACACAAAAGG + Intergenic
1124489694 15:30146515-30146537 TACATGTCCCAGTACACAAAAGG + Intergenic
1124544784 15:30615510-30615532 TACATGTCCCAGTACACAAAAGG + Intergenic
1124753835 15:32391812-32391834 TACATGTCCCAGTACACAAAAGG - Intergenic
1125194388 15:37030100-37030122 TTCATATCCTGGAAGACAAATGG + Intronic
1125896677 15:43308315-43308337 GAAATGTCCTAGAAAAAAAAAGG - Intergenic
1127429053 15:58884192-58884214 AAGATGTCTGAGAAGATAAAAGG + Intronic
1127745521 15:61967105-61967127 GGTATGCCCTAGAAGACAAATGG + Intronic
1128622704 15:69164085-69164107 TAGATTTCCTAGAGGAGAATAGG + Intronic
1128996114 15:72296264-72296286 TAGATGTCTTAGAAAACTGAGGG + Intronic
1129038841 15:72667359-72667381 TATATGTCCCAGTACACAAAAGG + Intergenic
1129211048 15:74069873-74069895 TATATGTCCCAGTACACAAAAGG - Exonic
1129399358 15:75271211-75271233 TATATGTCCCAGTACACAAAAGG + Intronic
1129402962 15:75295492-75295514 TATATGTCCCAGTACACAAAAGG + Intronic
1129610809 15:77054581-77054603 TAGATGTCCTAAATTATAAATGG + Intronic
1129728183 15:77914146-77914168 TATATGTCCCAGTACACAAAAGG - Intergenic
1130259133 15:82341744-82341766 TACATGTCCCAGTACACAAAAGG - Intronic
1130269539 15:82437370-82437392 TACATGTCCCAGTACACAAAAGG + Intronic
1130282133 15:82527405-82527427 TACATGTCCCAGTACACAAAAGG + Intergenic
1130473502 15:84243600-84243622 TACATGTCCCAGTACACAAAAGG + Exonic
1130480916 15:84357664-84357686 TACATGTCCCAGTACACAAAAGG + Intergenic
1130490796 15:84430095-84430117 TACATGTCCCAGTACACAAAAGG - Intergenic
1130502383 15:84508863-84508885 TACATGTCCCAGTACACAAAAGG - Intergenic
1130595781 15:85248206-85248228 TACATGTCCCAGTACACAAAAGG + Intergenic
1130865331 15:87928973-87928995 TAAATGTCCAAGAAGAAAGAAGG + Intronic
1131188829 15:90296692-90296714 TACATGTCCCAGTACACAAAAGG + Intronic
1131419307 15:92290921-92290943 TATAAGACCTAGAAGACCAAAGG + Intergenic
1131778763 15:95831359-95831381 TAGAAGTCCTGGAAAAGAAAAGG + Intergenic
1132444348 15:101898464-101898486 TAGAACTCCTAGAAGAAAACAGG + Intergenic
1135883650 16:26283702-26283724 TAGATTTCATAGAACAAAAATGG - Intergenic
1139296291 16:65904346-65904368 GAGATTTCCCAGCAGACAAAAGG - Intergenic
1142514991 17:421982-422004 TAGATTTCCTAAAAGACAGTTGG - Intronic
1142921534 17:3191390-3191412 TACATGCCCTACAACACAAAAGG - Intergenic
1143634436 17:8156328-8156350 TAGAAGTCCTAGAAGAAATTTGG - Intronic
1146681855 17:34814219-34814241 GTGAAGTCCTAGAAGACAATTGG - Intergenic
1146967725 17:37047151-37047173 TTGATGTGAGAGAAGACAAATGG - Intronic
1148555231 17:48574878-48574900 TAGATAATCAAGAAGACAAATGG - Intronic
1149040383 17:52181606-52181628 TAAATGTCCAAGAAGAGACAGGG + Intergenic
1150873868 17:68946545-68946567 TAGATGCCTTAGAAGACAGCCGG + Intronic
1152788151 17:82262835-82262857 ATGATGTCCGAGAAGGCAAAAGG - Intronic
1155560303 18:27068912-27068934 TTCATGTCCTAGAAAAGAAAAGG - Intronic
1155684699 18:28534385-28534407 TAGATGTAGTAGAAGACCACTGG + Intergenic
1157139427 18:45090760-45090782 TAGTTGACCGTGAAGACAAATGG + Intergenic
1157280130 18:46341457-46341479 TAGAAGACCATGAAGACAAACGG + Intronic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1158971631 18:62673594-62673616 TAAATGTCACAGAAGTCAAAAGG - Intergenic
1159162548 18:64661629-64661651 TAGATGTCCTAGAATACACAAGG + Intergenic
1160641004 19:136351-136373 TAGAACTCCTAGAAGAAAACAGG - Intergenic
926131446 2:10305156-10305178 TTTATGTCCTACAAGAAAAAAGG + Intronic
926515697 2:13842676-13842698 TACATGACCAAGAAGCCAAAAGG + Intergenic
927580502 2:24241203-24241225 TACATGTCCCAGTATACAAAGGG - Intronic
928282737 2:29963545-29963567 GAGAGGTCCTAAAAGGCAAACGG - Intergenic
928706533 2:33955658-33955680 AAAATGTACTAGAAGAAAAAGGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932008394 2:67950858-67950880 TATAAGAACTAGAAGACAAAGGG - Intergenic
933510482 2:83234788-83234810 TAGTTTTCCTGGAAGAAAAATGG + Intergenic
934179312 2:89606133-89606155 TAGATGACTCAGAAGAAAAAGGG + Intergenic
934289598 2:91680396-91680418 TAGATGACTCAGAAGAAAAAGGG + Intergenic
934764931 2:96875352-96875374 TAGATCTCCTGGAGCACAAAGGG + Intergenic
935557019 2:104520992-104521014 TAGATGTCCTACAATATGAAGGG - Intergenic
939297837 2:140292823-140292845 AAGCTACCCTAGAAGACAAATGG + Intronic
939618294 2:144386065-144386087 CAGATATGCTAGAATACAAAAGG + Intergenic
939828271 2:147041954-147041976 TTCCTGTCCAAGAAGACAAAGGG - Intergenic
940363513 2:152820583-152820605 TACAGGTCCTAGAAGAGGAAAGG + Intergenic
940498885 2:154469565-154469587 TAGAGGTCTTAGATTACAAAGGG + Intergenic
942777368 2:179599189-179599211 CAGAGGTCCAAGAAGACTAAGGG + Intronic
943559823 2:189447737-189447759 TAGATGTCCCCATAGACAAAAGG + Intronic
944457314 2:199908987-199909009 TCGGTCTCCTAGAAGACAGAGGG + Intergenic
945403044 2:209411109-209411131 TAAAACTCCTAGAAGAAAAAAGG + Intergenic
946031655 2:216710145-216710167 TACATGTCCAAGATGACATATGG + Intergenic
948415915 2:237803665-237803687 AAGATTTCTTAGAACACAAAAGG - Intronic
1168972739 20:1941847-1941869 GAAATGTGCTAGAAGACACATGG - Intergenic
1169348131 20:4845786-4845808 AAGATAACCTAAAAGACAAATGG + Intergenic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1173845033 20:46182834-46182856 TAAATATCCTAGGTGACAAACGG - Intronic
1173855167 20:46245696-46245718 CAGAAATCCTAGAAGACAACTGG - Intronic
1177224931 21:18242247-18242269 AAGGTGTCATAGAAGACACATGG - Intronic
1177747480 21:25236416-25236438 TAGATGTATCAGAAGAAAAAGGG + Intergenic
1177821672 21:26036933-26036955 TAGATGTCCAAAGAGACTAATGG + Intronic
1177828147 21:26106769-26106791 TTGAGGTCATTGAAGACAAAAGG - Intronic
1177964646 21:27712980-27713002 TAGATTTCCTAGAAAATATATGG + Intergenic
1179026230 21:37681141-37681163 TAGATGTCAAAGAATAAAAAAGG + Intronic
949624412 3:5850841-5850863 TCAATATCCTAGCAGACAAAGGG + Intergenic
950782895 3:15407665-15407687 TAGAATCCCTAGAAGACTAACGG - Intronic
950983652 3:17336260-17336282 AATATGGCCTAGAAAACAAAGGG + Intronic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
951916959 3:27811319-27811341 TGGAAGACCTAGAACACAAAGGG - Intergenic
951922237 3:27869496-27869518 GAGATGTGATAGAACACAAATGG - Intergenic
952690741 3:36202428-36202450 TAGATGTTTTCGAACACAAAAGG - Intergenic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
962264628 3:133936081-133936103 CAGAAGGCTTAGAAGACAAAAGG + Intronic
963847851 3:150178061-150178083 TAGATGAGCTAGAAGACTACAGG + Intergenic
967025720 3:185562033-185562055 TAGGTGGCCTAGAAGATAAGGGG + Intergenic
969829963 4:9787486-9787508 TAGATGACTCAGAAGAAAAAGGG - Intronic
970856860 4:20659151-20659173 TAGATTTCCTGAAAGACAGAGGG + Intergenic
970941511 4:21640109-21640131 TAGAGTTCCTAGAAGTTAAATGG - Intronic
973042336 4:45485854-45485876 TAGATGACCTAGAGGCCAAGTGG - Intergenic
975186773 4:71412693-71412715 TAGATGTCCTAGCACAGAAATGG + Intronic
975318580 4:72983186-72983208 TTGATGTCCTGGAAGCTAAAGGG - Intergenic
977180592 4:93868607-93868629 AAGATGTCCTGGGAGAGAAAAGG - Intergenic
977741297 4:100486804-100486826 GAGATGTCCTGGCTGACAAATGG + Intronic
978074894 4:104516210-104516232 AAGATGCTCTAAAAGACAAATGG - Intergenic
978698824 4:111617650-111617672 TAAAGGTACTAGAAGAGAAACGG + Intergenic
978815351 4:112898281-112898303 TTGGTATCCTAGAAGAGAAAAGG - Intronic
980712496 4:136588980-136589002 TAAACGTACTAGAAGACATAGGG + Intergenic
981892086 4:149750468-149750490 TATATGTCCAAGAACAAAAAAGG + Intergenic
981892794 4:149758369-149758391 TAAAACTCCTAGAAGACAACAGG + Intergenic
983057168 4:163111842-163111864 TTGATGTCCTGGAAGCCAAGTGG + Intronic
983367778 4:166816800-166816822 AAAATCTCCTAGAAGACAGAAGG + Intronic
984001438 4:174251516-174251538 AAGTTGTCCTAAAAGGCAAAGGG + Intronic
984633823 4:182089635-182089657 TATATTTCTTAGAAGCCAAAGGG - Intergenic
986382705 5:7202754-7202776 GAGGGGTCCTAGAAGACAAGAGG + Intergenic
987276366 5:16367210-16367232 TAAATGTCATAAAAGTCAAAAGG + Intergenic
988878307 5:35472729-35472751 ATGAAGTCCTATAAGACAAATGG - Intergenic
990785080 5:59409620-59409642 TAGTTGTTTCAGAAGACAAAAGG - Intronic
991483156 5:67105473-67105495 TAGAAGGCCTAGAGGGCAAAGGG - Intronic
992080515 5:73231630-73231652 TATTTGTCCTAGAAGACAGGAGG - Intergenic
993877992 5:93330337-93330359 TAGATCTCTTAGAAAACAAAAGG - Intergenic
994634429 5:102326509-102326531 TAGATTTCTCAGAAGACAGAGGG - Intergenic
996297736 5:121942786-121942808 CAGAAGTCCTAGAATACACATGG - Intergenic
996645041 5:125803980-125804002 TAGATTTTCTAGAAAATAAATGG + Intergenic
996945990 5:129068153-129068175 TGGATGTCCTTGAAGTCTAAGGG + Intergenic
997231700 5:132249782-132249804 TAGATTTAAAAGAAGACAAAAGG - Intronic
998668390 5:144325325-144325347 CAGATGTCCTATTAGACACAGGG - Intronic
999169163 5:149578759-149578781 TAAATGTTCTAGAAATCAAATGG + Intronic
999535729 5:152514979-152515001 TATAGGTCCTAGAAAAAAAATGG + Intergenic
1000203384 5:159033881-159033903 TAGATGTCCCAGGAGACAAAGGG - Intronic
1000859056 5:166434376-166434398 TAGATGACCTTGAATACAACTGG + Intergenic
1002712046 5:181201196-181201218 TAAATGTCCTACAAGGCACAGGG - Intronic
1002748351 6:84754-84776 TAGAACTCCTAGAAGAAAACAGG - Intergenic
1006333278 6:33406941-33406963 TCCCTGCCCTAGAAGACAAAAGG - Intronic
1008065347 6:47041861-47041883 TAGATTGCCTAGAATAAAAAGGG - Intronic
1010264099 6:73848564-73848586 AAGCTGTACTAGAAAACAAATGG - Intergenic
1010504600 6:76641744-76641766 CAGATATACTAGAAGAAAAAAGG + Intergenic
1010880429 6:81162296-81162318 TAGATGTCCTATTAGAGGAAGGG + Intergenic
1011227646 6:85125702-85125724 GAGAAGTCCCAGAAGACAAATGG + Intergenic
1012593704 6:101015613-101015635 TACATGTCCAACAAGATAAATGG + Intergenic
1012801842 6:103840285-103840307 AAGATGGACAAGAAGACAAAAGG - Intergenic
1013573225 6:111451131-111451153 CAGAGGTCATAGAAGAAAAAGGG + Intronic
1013576678 6:111490187-111490209 CAGAGGTGCTAGAAGATAAATGG - Intergenic
1014291907 6:119568433-119568455 GAGATGTGCTGGAAGAAAAAGGG - Intergenic
1014296917 6:119629636-119629658 TAGATGTCACAGATGAGAAAAGG + Intergenic
1014980077 6:127935449-127935471 TAGATGTCCTAAAAATAAAATGG + Intergenic
1019241443 6:170665599-170665621 TAGAACTCCTAGAAGAAAACAGG + Intergenic
1020476031 7:8596038-8596060 TACATGTCACAGAAAACAAATGG + Intronic
1020681428 7:11241933-11241955 TATATGTTCTAGAAGGCAATTGG - Intergenic
1022166443 7:27768213-27768235 TAAATGGCTTAGAAGAAAAAAGG + Intronic
1024156751 7:46633779-46633801 TAGCTGTCCATGAAGACCAATGG - Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1026358078 7:69577254-69577276 TATGTGTTCTAGAAAACAAAAGG - Intergenic
1029946014 7:104533796-104533818 TAGAAGTCCAAGAAGCAAAAAGG - Intronic
1033412893 7:141136021-141136043 GAGATGTCCTAGAATTCATATGG + Intronic
1033619081 7:143046212-143046234 GAGATGTCATAGAAGACAGCTGG + Intergenic
1036085397 8:5607994-5608016 TAGATGTCGTAGAATACATTTGG - Intergenic
1037561933 8:20083173-20083195 TTGATGTGGTAGATGACAAATGG + Intergenic
1037622903 8:20582257-20582279 TACATGAACTAGAAGACAATTGG + Intergenic
1039262915 8:35791946-35791968 AAGATGTCCTGGTAGACTAAAGG + Intronic
1040566758 8:48574233-48574255 GAGATGTCTTTGAAGAAAAAAGG + Intergenic
1042477737 8:69267812-69267834 AAGATGTCCCAGGAGGCAAAAGG - Intergenic
1043219023 8:77635165-77635187 TAGGTGTTCTAGGAGAGAAATGG - Intergenic
1044796190 8:95900559-95900581 TGGAGGTCCTAGAAAAGAAATGG + Intergenic
1045167438 8:99622546-99622568 TAGATTGCCTAAAAAACAAAAGG + Intronic
1046011664 8:108556016-108556038 GAGATGTCCTAGATGACAGTAGG + Intergenic
1046341822 8:112868902-112868924 TACAGGTCCTAGAAGAAAACAGG + Intronic
1046538725 8:115550724-115550746 TAGATTTCCAAGAATACCAAGGG - Intronic
1052402340 9:28016364-28016386 AAAATATCCTAGAAGATAAAAGG - Intronic
1056002589 9:82232643-82232665 TCAATGTCCCAGAAGATAAAGGG + Intergenic
1057540119 9:95959823-95959845 AAGGAGTCCTAAAAGACAAAAGG + Intronic
1057760399 9:97869216-97869238 ACTATGTCATAGAAGACAAACGG + Intergenic
1060610362 9:124958598-124958620 TAGAATTCCTAGAAGAAAATAGG + Intronic
1203601635 Un_KI270748v1:14833-14855 TAGAACTCCTAGAAGAAAACAGG + Intergenic
1187221722 X:17333317-17333339 AAGATGTGCTAGAACTCAAATGG - Intergenic
1188533843 X:31172748-31172770 TAATTGTCCTAAAAGACAAGGGG - Intronic
1189069656 X:37849885-37849907 GAGATGGACTAGAAGACTAATGG - Intronic
1190399280 X:50015349-50015371 AGGATGTCCTGGAAGATAAAGGG - Intronic
1190405782 X:50086313-50086335 TAGCTGACCTAGAAGAAAGAAGG - Exonic
1192507699 X:71699024-71699046 TAGGTGGCCTAGAAGATAAGGGG + Intergenic
1192518997 X:71782528-71782550 TAGGTGGCCTAGAAGATAAGGGG - Intergenic
1197232951 X:124026070-124026092 TACCTGGTCTAGAAGACAAAAGG - Intronic
1197539462 X:127739032-127739054 TAAATCTCCTAAAAGATAAAAGG + Intergenic
1198063624 X:133073358-133073380 TAGATGTCCTTGGAGAAAAGTGG - Intronic
1198713468 X:139530811-139530833 TAGATATCCTAAAAGGCAGATGG - Exonic
1199172523 X:144747542-144747564 TAGGTGTCCAAGAAGAAAATAGG - Intergenic
1200408638 Y:2840236-2840258 TTGATGTCGTAAGAGACAAATGG - Intergenic
1201964138 Y:19713210-19713232 TAAATGCCCTGGAAGACAACTGG + Intronic
1202367441 Y:24175467-24175489 TACATGTCCCAGTACACAAAAGG + Intergenic
1202503342 Y:25494656-25494678 TACATGTCCCAGTACACAAAAGG - Intergenic