ID: 917414748

View in Genome Browser
Species Human (GRCh38)
Location 1:174797327-174797349
Sequence CATTTCACATTTAAGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 442}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917414748 Original CRISPR CATTTCACATTTAAGAACAA GGG (reversed) Intronic
904394645 1:30211159-30211181 CATTTCACATATTAGAACCCTGG + Intergenic
904404942 1:30281525-30281547 CATTTCAAATTTAATGACATAGG + Intergenic
904746247 1:32713019-32713041 CATTTCCCATTTGAAAACAAAGG - Intergenic
905141809 1:35852190-35852212 CATTTTACATTTAACAAACACGG - Intronic
905681930 1:39879425-39879447 CACTTCACAGTTAAGAAAATAGG - Intronic
906286183 1:44589285-44589307 TATTTCACAGATAAGAACACTGG - Intronic
906415133 1:45615826-45615848 CATTTCAGATTTTAGATTAAGGG - Intronic
906797777 1:48711435-48711457 CAAGTCACATTTAACACCAAAGG - Intronic
909082634 1:71131573-71131595 CAATTCACAGTCAAGAAGAAAGG + Intergenic
909382270 1:75012346-75012368 CATTTCACAGATAGGAACAAAGG + Intergenic
909912387 1:81277066-81277088 GAGTTCACATTGAAGAACCACGG - Intergenic
910156802 1:84228611-84228633 CATTTTACTTTTAGGATCAAAGG + Intronic
910478209 1:87631448-87631470 AAATTTACATGTAAGAACAAAGG + Intergenic
910654073 1:89602140-89602162 CATTTCACATATAAGCAAACTGG + Intergenic
911521286 1:98933502-98933524 GATTTCAGAATTAAGAATAAAGG + Intronic
911627043 1:100135705-100135727 CATATAACAGTTAAGAACACAGG - Intronic
911634165 1:100214809-100214831 AATCTCACCTTTAAGAAGAAAGG + Exonic
911662650 1:100520650-100520672 AATTTCTCATTTAGGAAAAATGG - Intergenic
912044696 1:105439064-105439086 GATTTCATATTTTAAAACAATGG + Intergenic
915709076 1:157876611-157876633 CATTAAACATTGAAGAGCAAAGG + Intronic
916961597 1:169894535-169894557 CATTTAACATTTCTGAACCAAGG - Intergenic
917055151 1:170972873-170972895 CATTGCACATTAAATAATAAAGG + Intronic
917190342 1:172410855-172410877 CATTTCATATTTGAGAATTATGG - Exonic
917208813 1:172609446-172609468 CTTTTCTCATTTAAGAATCAAGG + Intronic
917368909 1:174266759-174266781 CATTTGACATTTTACAAAAATGG + Intronic
917414748 1:174797327-174797349 CATTTCACATTTAAGAACAAGGG - Intronic
917702336 1:177594136-177594158 CATTTTTCATTTAAGAAGCATGG + Intergenic
918298474 1:183180556-183180578 CCTTTACCAATTAAGAACAAAGG + Intergenic
918908080 1:190525691-190525713 CTTTTAACTCTTAAGAACAAGGG + Intergenic
919686850 1:200491448-200491470 CATTTTACATTTAAAAATAAAGG + Intergenic
919855370 1:201702859-201702881 CATTTTACAGTTGAGAAAAACGG - Intronic
920458774 1:206120996-206121018 CATTTTAAAAATAAGAACAAAGG - Intergenic
921002790 1:211061381-211061403 CATTCCAGATTTTAGAAAAAAGG - Intronic
921528512 1:216249471-216249493 TATCTCACATTAAAGAACAAAGG + Intronic
924335780 1:242985819-242985841 CATGCCACATTCAAAAACAAAGG + Intergenic
924395393 1:243613419-243613441 CTTTTTACATTTAAAAACACAGG + Intronic
1063079072 10:2747898-2747920 CATTTCAGATGTGAGAACAAGGG + Intergenic
1063681041 10:8188315-8188337 CACTTCACAATTAAGAACCTGGG + Intergenic
1063993481 10:11593055-11593077 CATTTCATTATTTAGAACAAAGG + Intronic
1064835079 10:19517569-19517591 GATTTCATATATAAGAACTATGG - Intronic
1064851358 10:19712374-19712396 AATTTCAGCTTTTAGAACAATGG - Intronic
1065827928 10:29588822-29588844 CATTTTACATGTGAAAACAAAGG - Intronic
1066074838 10:31864423-31864445 TATTTTCCATTTAGGAACAAGGG - Intronic
1066227203 10:33394823-33394845 CATTTCACAGCTCAGAAAAATGG - Intergenic
1066977403 10:42381751-42381773 CATTTCACAGTTGAATACAAAGG - Intergenic
1067896531 10:50186827-50186849 CATCTTACATATAAGAAAAATGG - Exonic
1067952441 10:50755200-50755222 CATCTTACATATAAGAAAAATGG + Intronic
1068717930 10:60208816-60208838 CATCTCACATCAAAGAAGAAAGG + Intronic
1068796524 10:61087883-61087905 CATTTTACCTCTAAGAAGAAAGG - Intergenic
1068943161 10:62701369-62701391 CATTTTACAGTTAAGAAAATAGG - Intergenic
1069404231 10:68081087-68081109 CCTTTCCCTTTTAAGAACACCGG + Intergenic
1071028524 10:81143992-81144014 CATTTCAGATTCAAGAACATTGG + Intergenic
1071220489 10:83459390-83459412 CATTTCTCGTTTCAGAAAAAAGG + Intergenic
1071816781 10:89240293-89240315 CATTTCAAAATTAAAAACAGAGG + Intronic
1072365697 10:94706432-94706454 CATTTTACAGATAAGAACAGAGG - Intronic
1074563681 10:114557130-114557152 CATCTCAGATTTACGAATAATGG + Intronic
1074587197 10:114779417-114779439 AATTAAACATTTAAGAAAAAAGG - Intergenic
1074611473 10:115026136-115026158 CATGTCACATGCAAGCACAAGGG - Intergenic
1074903486 10:117839785-117839807 CATTTTACAGATAAGAACACTGG - Intergenic
1076197797 10:128532665-128532687 CATTTCACACTTAAGCAAACTGG + Intergenic
1076309098 10:129490595-129490617 TATTTTAAATATAAGAACAAAGG - Intronic
1077129138 11:960963-960985 CATTCTACAGTTAAGAACAAAGG - Intronic
1077964641 11:7115952-7115974 CCATTCATATTTAAGAATAAGGG - Intergenic
1078746553 11:14120860-14120882 CATTTCACAGGTAAGAAAACTGG + Intronic
1078782307 11:14450883-14450905 CATTTTACAGATAAGAACATAGG + Intronic
1079349269 11:19679000-19679022 CTTTTCACATTTAACAACATAGG - Intronic
1079411105 11:20188650-20188672 CATTTCAAAGTTAAAAAGAAAGG - Intergenic
1079569378 11:21923375-21923397 CATTTCCAACTTAGGAACAATGG + Intergenic
1079698896 11:23519468-23519490 CATTTTACAGTGAAGGACAAGGG - Intergenic
1079817102 11:25075570-25075592 GATTACACATATAAAAACAATGG + Intronic
1080226895 11:29972158-29972180 CATTTCTTTTTGAAGAACAAAGG + Intergenic
1080398468 11:31911908-31911930 CATTTCAAATTTGAGACTAAGGG + Intronic
1081023117 11:37971888-37971910 TATTTCACTTGTCAGAACAAAGG - Intergenic
1081245020 11:40755124-40755146 CATTGCACATTTTAGAATCAGGG + Intronic
1081262858 11:40982386-40982408 CATTTTACATGTAAGAAAAAAGG - Intronic
1081822013 11:46007824-46007846 ATTTTCAAATTTTAGAACAAGGG + Intronic
1082604007 11:55200725-55200747 CTTTTCACATTTTACCACAAAGG + Intergenic
1082604020 11:55200894-55200916 CTTTTCACATTTTACCACAAAGG + Intergenic
1084098481 11:66929276-66929298 GATTTCACATTTGAGAAGTAAGG - Intronic
1085786188 11:79452436-79452458 CATTTCCCATTTAAAAAGAAAGG - Intergenic
1086190156 11:84069532-84069554 CATTCCACATTTAAAAAATAGGG + Intronic
1086204531 11:84242020-84242042 CAGAGCACTTTTAAGAACAAGGG - Intronic
1086326588 11:85707680-85707702 CTTTACACATTTAAGTATAAAGG - Intronic
1088075432 11:105842705-105842727 CATTTCTCCTTTAAAATCAATGG - Intronic
1089947471 11:122492230-122492252 CATTTCAGATTGAGGAACAAAGG - Intergenic
1091559059 12:1596565-1596587 CTCTTCAGATTTGAGAACAAGGG - Intronic
1092431890 12:8416746-8416768 CATTTTACAATTAAGATCACAGG - Intergenic
1092434843 12:8439362-8439384 CATTTTACAATTAAGATCACAGG - Intergenic
1093516512 12:19993122-19993144 CATTTAACATTTATGAATGATGG + Intergenic
1094070241 12:26404767-26404789 GATTTCAGATGTAAGAACAATGG + Intronic
1094088670 12:26623199-26623221 CATTTCATATTTTAGGACCATGG - Intronic
1094293987 12:28882814-28882836 CAATTCACCATTATGAACAAAGG + Intergenic
1094347506 12:29486953-29486975 CCTTTTACATCTAAGACCAAAGG + Intronic
1094602563 12:31922645-31922667 CATTTCACAATTGAGTACAAAGG + Intergenic
1095297536 12:40544231-40544253 GATTTCACATTTTAGTTCAAGGG + Intronic
1096117407 12:49063033-49063055 CATTTCTCATTTATGAAGAGTGG - Intergenic
1096820750 12:54232117-54232139 CATTTCAGATTCAAGAGCATTGG - Exonic
1098473195 12:70869232-70869254 AATTCCAAATTTAAGAAAAAAGG + Intronic
1099029455 12:77507045-77507067 TATTTCACATTTCACAACATTGG + Intergenic
1099631035 12:85145926-85145948 AATTTCTCATGTAAAAACAAGGG - Intronic
1099753729 12:86812691-86812713 CACTTCACATTCAACAACATAGG - Intronic
1099856480 12:88174532-88174554 CATTTTACCTTTTAGAACAGAGG - Intronic
1100138124 12:91580672-91580694 TATTTAACATTTAACAATAAAGG + Intergenic
1102995238 12:117344842-117344864 CATTACACAATAAATAACAAGGG + Intronic
1103260275 12:119582102-119582124 CATGTCACAAAGAAGAACAAAGG + Intergenic
1104586517 12:130052412-130052434 TATCTCACATTTAAGATCCAAGG - Intergenic
1105748227 13:23397648-23397670 CCTCTCACATTTAAGAGCTAAGG + Intronic
1105861582 13:24419823-24419845 CAGTACAGATTTAAGGACAAAGG + Intergenic
1106163825 13:27224420-27224442 CAGTACAGATTTAATAACAAAGG + Intergenic
1106484089 13:30157369-30157391 CATTTCACAGGTGAGAACACAGG - Intergenic
1106638296 13:31555050-31555072 CATTTCACAGACAAGAACATGGG - Intergenic
1108609253 13:52068135-52068157 CATTTCACAGCTGAGTACAAAGG - Intronic
1108729602 13:53220635-53220657 CCTTTCACATTTAAGTAGTAAGG + Intergenic
1108981963 13:56525120-56525142 ATTTTCACATTTAAGCACCATGG - Intergenic
1110468986 13:75836810-75836832 CCTTTCACAATAAAGAAGAAAGG - Intronic
1110534555 13:76636114-76636136 AATTTCTTATTTAAGCACAAGGG + Intergenic
1111132491 13:83995935-83995957 CCTTTCACACATAATAACAATGG + Intergenic
1111142961 13:84145877-84145899 CATTTAACATTTAGGAATAGAGG - Intergenic
1111513392 13:89295473-89295495 CATTTCACACTTATCAAAAAAGG + Intergenic
1111523827 13:89440833-89440855 CATTTCACAGTAAAAAGCAATGG + Intergenic
1111910802 13:94309938-94309960 GAGTACACATTTAAGAATAAAGG - Intronic
1112128793 13:96498730-96498752 AATTTCACATTTTATTACAAAGG - Intronic
1112709282 13:102108699-102108721 AACTTCACATCTATGAACAAGGG - Intronic
1112765344 13:102735919-102735941 CTTTGCACATTGAAGAGCAAGGG - Exonic
1113062644 13:106339933-106339955 CATTGAACATTAAACAACAAAGG + Intergenic
1114133696 14:19821887-19821909 CAATGAACATTTATGAACAATGG + Intronic
1114288506 14:21268912-21268934 CTTTTTACATGTAAGAAGAACGG + Intronic
1114887072 14:26866058-26866080 TATTTCACGTTTAAAAAAAAGGG + Intergenic
1115017542 14:28635128-28635150 TACTTAACAGTTAAGAACAAAGG - Intergenic
1115121854 14:29946435-29946457 CATTTCACATATAAAAATATAGG + Intronic
1115641128 14:35336364-35336386 GATTTTAAATTTAAGAACTATGG - Intergenic
1116014724 14:39392709-39392731 CATTTCACATATAAGGAAATAGG - Intergenic
1116118688 14:40694008-40694030 CATTTCACAGTTGAATACAAGGG + Intergenic
1116259687 14:42608475-42608497 CATTTTAAAATTAATAACAATGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118538464 14:66795315-66795337 CATTTAAAATTTAATGACAAGGG - Intronic
1120224268 14:81773031-81773053 CATTTCACAGATGAGAAAAATGG + Intergenic
1120246027 14:82007803-82007825 CATTTCACATATAAAATTAAGGG - Intergenic
1120359393 14:83478296-83478318 GTTTTCACATTCAAGAATAAAGG + Intergenic
1120895388 14:89526752-89526774 CAATTCATATGTAAGTACAAAGG + Intronic
1120905482 14:89617341-89617363 CATTTCACATCCAAGAGGAAGGG - Intronic
1122243946 14:100388000-100388022 TATTTCACATTCAAAGACAAGGG + Intronic
1122502662 14:102211629-102211651 CAGTTCACCTTTAGGAACAAAGG - Intronic
1122698209 14:103568402-103568424 CAATTTACAGTTAAGAAGAAAGG + Intronic
1123576774 15:21677481-21677503 CAATGAACATTTATGAACAATGG + Intergenic
1123613396 15:22119949-22119971 CAATGAACATTTATGAACAATGG + Intergenic
1123737931 15:23203195-23203217 CTTTTGGCCTTTAAGAACAAGGG + Intergenic
1124289140 15:28431864-28431886 CTTTTGGCCTTTAAGAACAAGGG + Intergenic
1124294082 15:28485446-28485468 CTTTTGGCCTTTAAGAACAAGGG - Intergenic
1124389510 15:29241565-29241587 CATTTCATATTTAAAAAGAAAGG + Intronic
1125043239 15:35216188-35216210 CATTTCACAGATAAGAAAACTGG - Intergenic
1125776880 15:42223889-42223911 AATTGCATATTTAACAACAATGG - Intronic
1127969008 15:63944606-63944628 CATTTCACAGATAAGAAAACGGG + Intronic
1127974750 15:63988877-63988899 CATTTCACAGATAAGAAAACTGG + Intronic
1128055949 15:64700244-64700266 CTTTTCACATGTAAGCACACTGG + Intronic
1129611573 15:77063568-77063590 TATTTCTAATTTAAGAATAATGG - Intronic
1129774364 15:78225696-78225718 CATTTTACATAGAAGTACAAAGG + Intronic
1130421630 15:83753551-83753573 CATTTCACATAGAAAAACACAGG - Intronic
1132402596 15:101522521-101522543 CATTTCACGTTAGTGAACAAAGG - Intronic
1132440014 15:101852641-101852663 CTTTTCACCCTTAAGAACGATGG + Intergenic
1202985642 15_KI270727v1_random:411726-411748 CAATGAACATTTATGAACAATGG + Intergenic
1133384847 16:5361191-5361213 CATATCACCATTAAGACCAATGG - Intergenic
1135331471 16:21563518-21563540 CATGTCCCTTTTAAGAATAATGG - Intergenic
1135891503 16:26361372-26361394 CATTTTACATTTTAGACCTAGGG + Intergenic
1137356016 16:47765211-47765233 CATTTCAAATGTAACAACATAGG + Intergenic
1138227456 16:55309752-55309774 CATTTCACAAGTAAGGACACTGG + Intergenic
1138254888 16:55547344-55547366 CATTTCACATGTGAGGAGAAGGG - Intronic
1138440416 16:57031095-57031117 CATCTCAAATTTAAAAAGAAAGG + Intronic
1138828951 16:60355733-60355755 CACTGTACATTTTAGAACAAAGG + Intergenic
1138858998 16:60732151-60732173 GACTTCACATTTAAGCAAAATGG - Intergenic
1139086521 16:63593020-63593042 CTTTTCACATTCTAGAAAAATGG - Intergenic
1140617758 16:76687762-76687784 CAATTCACATGTAACAAAAAAGG + Intergenic
1140814003 16:78604602-78604624 TATTTAACATTGAAGAAAAAGGG - Intronic
1140951188 16:79819093-79819115 CATCTCACTTTTAAGAATATGGG + Intergenic
1141873140 16:86803370-86803392 CATTTCTAACTTAAGAAAAAAGG + Intergenic
1142380627 16:89729998-89730020 CATTTCACAGCCCAGAACAAAGG + Intronic
1143241705 17:5448675-5448697 AATTTCACAAATAAGAAAAAAGG - Intronic
1146064820 17:29626004-29626026 AAGTTCACATTTAAAAACAGTGG + Exonic
1146114613 17:30123944-30123966 CATTTCACATTAAAGCACCCTGG + Intronic
1146978116 17:37133459-37133481 CATTTCACAGTTAGGCAGAATGG - Intronic
1146996509 17:37325394-37325416 AATTGAACATTTAAGAAGAAAGG - Intronic
1147110990 17:38261328-38261350 CATTTCACATTTGAGGAAACAGG + Intergenic
1148418520 17:47527112-47527134 CATTTCACATTTGAGGAAACAGG - Intronic
1148605403 17:48925481-48925503 CCTGTCTCATTTAAGCACAAAGG + Intronic
1148699189 17:49577729-49577751 CATTTCACAGATAAGGACACTGG - Intronic
1148861249 17:50605375-50605397 CACTTTACAGATAAGAACAACGG - Intronic
1149237542 17:54610482-54610504 AATTTCAAATTTAAGGAGAATGG + Intergenic
1150024743 17:61661957-61661979 CATTTCACATTTAATTAACATGG - Intergenic
1150142651 17:62743341-62743363 TATATCACATTTAAAAACAAAGG + Intronic
1151517922 17:74608582-74608604 CATGTCACATATAAGAATAGCGG + Intergenic
1153204593 18:2683901-2683923 CATTTCATATATAATAATAAAGG - Intronic
1153627503 18:7035718-7035740 CTTTTCACATTTAAAAAGAAAGG - Intronic
1153742322 18:8141383-8141405 CATTTCACATTGCAGGTCAAGGG - Intronic
1155032831 18:21999196-21999218 CATTTCACAGCCAAGAAAAAAGG - Intergenic
1155496880 18:26451370-26451392 CATTTCATATTTACAAACCAAGG - Intergenic
1155785172 18:29887886-29887908 CAATTCAATTTTAAGAACAGAGG - Intergenic
1156336115 18:36173024-36173046 CATGTCATATTTAAGAAGATAGG - Intronic
1156714632 18:39992656-39992678 TATTTCACATTTTAGCATAATGG + Intergenic
1156886177 18:42139014-42139036 CATTTCAGACTTAATAGCAAAGG + Intergenic
1157989651 18:52479392-52479414 AATTTCAAATTAAAGACCAAGGG - Intronic
1158001751 18:52627467-52627489 CATTTTGCATTTAAGAAACAAGG - Intronic
1158244661 18:55418408-55418430 CATCTCATATTTAAAAATAAGGG - Intronic
1158488595 18:57890119-57890141 CTTTCTACAGTTAAGAACAATGG - Intergenic
1159013210 18:63078894-63078916 CATTTTAAATTTAAGATCACAGG + Intergenic
1159192740 18:65069214-65069236 TAGTACACATGTAAGAACAAAGG - Intergenic
1159424518 18:68267961-68267983 TATTTTAAATTTAATAACAATGG - Intergenic
1163158461 19:15451437-15451459 CATTTCACAGATAAGAAAACGGG + Intergenic
1164407348 19:27962979-27963001 CATTTCTCATTTATAAAGAAGGG + Intergenic
1166019875 19:40017502-40017524 CACATCACATCTAAGAATAAAGG + Exonic
925216383 2:2099352-2099374 TTTTTCTCATTTAAGAAAAATGG + Intronic
925407824 2:3617400-3617422 CCTTTCACATCAAAGAACTACGG - Intronic
925549946 2:5062631-5062653 CACTTCAAATTTATTAACAAAGG + Intergenic
925607085 2:5670580-5670602 CATTTCACATTTATGGAATATGG - Intergenic
925807225 2:7662366-7662388 TTTTTCACATTTACCAACAAAGG - Intergenic
925858120 2:8150049-8150071 CATTTCAAATGTATGAACATTGG + Intergenic
926495755 2:13585368-13585390 CATTTTACATTTAAAAATCAAGG - Intergenic
926565465 2:14464899-14464921 CATTTCACATTTATGGTGAAAGG - Intergenic
926614062 2:14977423-14977445 CATTTTTCATTTAAGAATCAAGG + Intergenic
926801147 2:16661853-16661875 CATTTTACAGTTAAGAAAATGGG - Intronic
928059455 2:28096257-28096279 CAATTCACTTTTTAAAACAATGG - Intronic
928280521 2:29942484-29942506 CATTTCTCATATAGGAAAAATGG + Intergenic
928351137 2:30556375-30556397 CTTTCCACATTAGAGAACAAAGG + Intronic
929831886 2:45353898-45353920 CATTTTACATGTGAGAAGAACGG + Intergenic
930777541 2:55188891-55188913 CAATTCACATTTAAGTGCAGTGG + Intronic
932928939 2:76010743-76010765 CATATCACACTTGGGAACAAGGG + Intergenic
933788073 2:85859800-85859822 CATTTCACAGTTGAGAAAACTGG + Intronic
935488088 2:103682873-103682895 AATTATACATTTAAAAACAAAGG + Intergenic
935882640 2:107581036-107581058 CATTTAACATATGAGAAAAACGG - Intergenic
937213529 2:120294742-120294764 CATTTCACATGTATGACAAAAGG - Intergenic
937567523 2:123312755-123312777 CATATAACATTTTTGAACAAGGG - Intergenic
937759310 2:125581355-125581377 CATTTCACTTTTGAGAAAACTGG + Intergenic
938123450 2:128651546-128651568 TCTTTCACCATTAAGAACAATGG + Intergenic
938930995 2:136086905-136086927 CACTACACATTTCAGAACTAAGG + Intergenic
938993518 2:136653797-136653819 CATTTCACATTCCAAAAAAAAGG + Intergenic
939524354 2:143274487-143274509 CATTGAACATTTCAGATCAAAGG - Intronic
939905750 2:147911950-147911972 TATTTCACATTTAAATACAATGG - Intronic
940218866 2:151329688-151329710 TATATAGCATTTAAGAACAAAGG + Intergenic
941161617 2:162042101-162042123 AAGATCACATTTAAGAGCAAAGG + Intronic
943529684 2:189063581-189063603 TATTTCACATTGCAGAACAAGGG + Intronic
943614347 2:190075269-190075291 CATTTTACATTTATTAAAAATGG + Intronic
943949914 2:194120426-194120448 CATTTCACACTTTAGAAAGAAGG - Intergenic
946471580 2:219965661-219965683 CATTCCAAATTAAAAAACAAGGG - Intergenic
947887764 2:233588490-233588512 CTTTACAAATTTAAGAATAAAGG + Intergenic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
949079688 2:242087109-242087131 CATTTCACATGTGAAAAGAAAGG - Intergenic
1169202375 20:3718087-3718109 CAATTCATCTTTATGAACAAAGG - Intergenic
1169445321 20:5666566-5666588 CATTTCACATTGTACAACATCGG - Intergenic
1169609418 20:7362386-7362408 CCTTTGACAGTTAAGAGCAAGGG - Intergenic
1169763827 20:9127607-9127629 CATTTAACTTTTAAAAAAAACGG + Intronic
1170282301 20:14663466-14663488 CATTTAACATTTAAGTTCAGGGG - Intronic
1170392503 20:15890757-15890779 CATTTCCCATTTATTAAAAAAGG - Intronic
1170657688 20:18305169-18305191 CATTTCACAGGTAAGAAAACTGG + Intronic
1172107712 20:32526749-32526771 CATTTCACAGTTAAGGAAACTGG - Intronic
1172143263 20:32738998-32739020 CATTTTACAGTTAAGAAAGATGG - Intronic
1172759999 20:37315027-37315049 CATTTCTCAATAAAGAACATGGG + Intronic
1172917238 20:38452191-38452213 CATTTCTCACTAAAGGACAAAGG - Intergenic
1174669736 20:52295763-52295785 CATTTCAAAATTAAGACCACGGG - Intergenic
1174760353 20:53201101-53201123 CTTTTTACTTCTAAGAACAATGG + Intronic
1178553488 21:33563942-33563964 AATTTCACCTTTTAGAGCAAAGG + Intronic
1178701316 21:34835646-34835668 CATTTCTCTTTTAAAGACAATGG + Intronic
1179159741 21:38884532-38884554 CTTTTTACATTTAAGATTAATGG + Intergenic
1183126433 22:35786300-35786322 GATTTCATACTTAAAAACAAGGG - Intronic
1183449485 22:37884126-37884148 CATTTGACATTTCAGATAAATGG + Intronic
1184297967 22:43538008-43538030 TATTTCCTATTTAAAAACAAGGG + Intronic
949213157 3:1530587-1530609 CCTTTCAAAAATAAGAACAAGGG - Intergenic
949309785 3:2684146-2684168 CATTTAAAATTTAAATACAAGGG + Intronic
949761105 3:7471866-7471888 CAGTCCCCATTTAAGAATAATGG - Intronic
950868855 3:16212011-16212033 CATTCCACATTTGAGGATAAAGG - Intronic
950868931 3:16212515-16212537 CATTCCACCTTTAAGAACGGCGG - Intronic
951242786 3:20306213-20306235 CATTTCACAGTGAAATACAAGGG - Intergenic
951725719 3:25756259-25756281 CCTTTTACATTTAAGAACAATGG - Intronic
952191239 3:31025561-31025583 GATTTCAGATTTCAGGACAAGGG - Intergenic
952745109 3:36769579-36769601 CATTTGACAGGTAATAACAAGGG - Intergenic
953553346 3:43922567-43922589 CATTTCACAATTTAGTTCAAAGG - Intergenic
953854016 3:46486823-46486845 CATTTCACAAGTAAGAAAACTGG + Intergenic
954049448 3:47961407-47961429 CATTCCTCATTTTAGAACAAGGG + Intronic
955027330 3:55182049-55182071 CATTTCACTTTTAAGAAAATGGG - Intergenic
955152672 3:56383610-56383632 CAAATCACATCTAAGAACTAGGG + Intronic
956223741 3:66933272-66933294 GCTTTCACATATATGAACAAGGG - Intergenic
957143202 3:76387649-76387671 CATTTCACAGATGAGAACAATGG + Intronic
957171317 3:76739981-76740003 CATTTCAAAACTAAGAAAAATGG + Intronic
957808634 3:85187094-85187116 CATTTCACAGTTAAGGAAATTGG + Intronic
957885186 3:86278659-86278681 AAATTCAAATTTAAGTACAAAGG - Intergenic
958896490 3:99835533-99835555 CATATAAAATTTAAGAACCATGG - Intronic
958994741 3:100891176-100891198 CAATTCACATTTGAGAATCATGG - Intronic
959995281 3:112673962-112673984 CATTTTATATTTAAAAACATAGG + Intergenic
960377002 3:116915387-116915409 CGTTTCATCTTTAAGAACAAAGG + Intronic
961969081 3:130940459-130940481 CATTTAACATTTTAAAATAAGGG + Intronic
963133836 3:141882394-141882416 CATTTAACATTTAAGGAGAATGG + Intronic
964012333 3:151905595-151905617 GATATCATATTTAAAAACAAAGG - Intergenic
965269063 3:166589064-166589086 CATTTCACATAAAGGAACTAGGG + Intergenic
965900892 3:173640261-173640283 AATTTTACATTTTAGAAGAAAGG + Intronic
966177019 3:177149457-177149479 CATTTTACATATAAGAAAACTGG + Intronic
968173232 3:196527241-196527263 AATTTCACAGTTAAGATAAATGG - Intergenic
968325033 3:197806224-197806246 CTTTTCATATTTAAAAACATAGG - Intronic
968604366 4:1525119-1525141 CATTTGATATTTCAGAACACAGG + Intergenic
969367447 4:6705799-6705821 AATTTCAGATTTTAGAGCAAGGG + Intergenic
970297533 4:14646704-14646726 ACTTTCATATTTAAGAAAAAAGG + Intergenic
970346887 4:15160888-15160910 CATTTTATATATAAGGACAAGGG + Intergenic
970597665 4:17614851-17614873 CAGTTCACGTTTCAGAAAAAAGG - Intronic
970942672 4:21653566-21653588 CATTACACATATCACAACAATGG - Intronic
971305257 4:25474306-25474328 CATATCACAGTTATTAACAATGG - Intergenic
971646673 4:29215590-29215612 AATTTTACATTTAAGTTCAAGGG - Intergenic
972186271 4:36532171-36532193 CATTTCACTTATAAGAAAACTGG - Intergenic
973088336 4:46098162-46098184 CTTTTCACTTTTAAGCACACAGG - Intronic
973898549 4:55442293-55442315 TATTTCAAATTTAAGAACATTGG + Intronic
973941309 4:55913504-55913526 CATTTAAAATTTTAGAACAGTGG + Intergenic
975103578 4:70542737-70542759 CATTTTACATTTAGGCATAAAGG - Intergenic
975540465 4:75504881-75504903 CATTTACCATTTAAGTATAATGG - Intronic
975612424 4:76215258-76215280 CATTTTACACTCAAGAACACTGG + Intronic
976019875 4:80609153-80609175 CATTTTACATTTCTGAACACAGG - Intronic
976044688 4:80931112-80931134 CTTTTCTCATTTAAAATCAATGG - Intronic
976608501 4:87005654-87005676 CACTGCACACTTAAGTACAATGG - Intronic
976631407 4:87240807-87240829 CATTAGCCATTTAAAAACAAGGG - Intergenic
976898952 4:90149387-90149409 CATTGCCCTTTGAAGAACAATGG + Intronic
977352768 4:95909303-95909325 AATTTCACATTTAATTACAATGG + Intergenic
977696258 4:99969982-99970004 TAATTCACATTTAAGAATATTGG + Intergenic
978105309 4:104895109-104895131 AATTTTACATTTTAGAACATTGG - Intergenic
978879797 4:113688074-113688096 CTTTTCAGATTTAGGAACCATGG - Intronic
979803818 4:124946033-124946055 GATTTCAGATTTTAGAACATTGG - Intergenic
979968323 4:127104352-127104374 TATTTCACATGTCAGTACAAAGG + Intergenic
981491024 4:145339547-145339569 TAGCTCACAGTTAAGAACAAGGG + Intergenic
981652978 4:147079834-147079856 TATTTCATATTTAAGACAAAGGG + Intergenic
981854269 4:149268745-149268767 AGATTCACATTTAAGAACAAAGG - Intergenic
983373606 4:166896760-166896782 TATTGCACATTTAAGAAAATTGG - Intronic
983680627 4:170349368-170349390 CAACTCACATTTTTGAACAAAGG - Intergenic
983889871 4:173019680-173019702 GATTTCATATAGAAGAACAAGGG - Intronic
985842159 5:2315558-2315580 CACTTCAAATTTAACAATAAAGG - Intergenic
988029594 5:25746067-25746089 GCTTTCACAGTAAAGAACAATGG + Intergenic
989669651 5:43900794-43900816 CAATTCACATTTAAAACCAAAGG + Intergenic
990636085 5:57728669-57728691 AAATTCACATGTAACAACAAAGG - Intergenic
991109756 5:62886111-62886133 GATTTCACCATTAAGTACAATGG - Intergenic
992008339 5:72501405-72501427 CTTTTTACATTTAACAACATTGG - Intronic
992477886 5:77121475-77121497 CATTTCACACTCAAGGAGAAGGG + Intergenic
993122062 5:83787438-83787460 TACTTCACATTTGAGAACACAGG - Intergenic
993658778 5:90604155-90604177 GATTTCACATTTTAAAAAAATGG - Intronic
993767322 5:91877428-91877450 CATTAAATATTTAAGAAAAATGG + Intergenic
993772753 5:91951013-91951035 CATTTCTGATTTAGAAACAATGG + Intergenic
993806277 5:92414046-92414068 CATTTTACATATAAGATCTAAGG - Intergenic
995139158 5:108715119-108715141 CATCTCATACTTAAGAAAAATGG + Intergenic
995615001 5:113951986-113952008 CATTTTACAGTTAAGAAAACAGG + Intergenic
995950192 5:117702888-117702910 CAATTAACATTTATGAACTAAGG - Intergenic
996277226 5:121681571-121681593 CATTTCACAGTTGAGTACAAAGG - Intergenic
996701886 5:126458126-126458148 TATTTCATATTTAAGAATGAGGG + Intronic
996880460 5:128290943-128290965 CATTTCTCATTGTAGAACACGGG + Intronic
997277297 5:132605633-132605655 CATTTCATATTAAAGAAACATGG - Intronic
997281943 5:132654823-132654845 CACTTCACATGTAGGGACAAGGG + Intergenic
997830960 5:137149431-137149453 CATAAGACATTTATGAACAAAGG + Intronic
998877690 5:146617333-146617355 AATTGCACATTTAAAAATAAAGG + Intronic
999257019 5:150215383-150215405 CCTTTCACATCTGAGAACACCGG - Intronic
999389031 5:151176712-151176734 CAATTGACATTTGAGAACCAAGG + Intergenic
999869565 5:155735126-155735148 CTTTTAGCATTTAAGGACAATGG - Intergenic
1000138295 5:158375886-158375908 CATTCCACTTTGAAAAACAATGG + Intergenic
1001100846 5:168813086-168813108 TATCTCACATTTAAGGCCAAGGG + Intronic
1001877529 5:175214372-175214394 CAGTGCACATTTAAGGACAGAGG + Intergenic
1004254812 6:14053263-14053285 CATTTCGGATTCCAGAACAATGG + Intergenic
1004845830 6:19640720-19640742 TATTTTACATGTAAAAACAAAGG + Intergenic
1005092549 6:22072967-22072989 CATTTTATATTGAAGAACAAAGG + Intergenic
1005169166 6:22961900-22961922 CATTTCACATATGAGCACCACGG + Intergenic
1007067418 6:39005526-39005548 CACTTCACATTTACAAAGAATGG - Intronic
1007365720 6:41391046-41391068 CATGTGAAATTTCAGAACAAAGG + Intergenic
1007832677 6:44650816-44650838 CATAGAACAATTAAGAACAATGG - Intergenic
1009445669 6:63739381-63739403 CATTTCACATTGAAGCAAAGTGG + Intronic
1009562194 6:65260747-65260769 AAATACACTTTTAAGAACAATGG + Intronic
1009639325 6:66311063-66311085 CATGAAACATATAAGAACAAAGG + Intergenic
1009721655 6:67479240-67479262 CATTTCACAGTTGAGAAACATGG - Intergenic
1009881780 6:69576437-69576459 AATATCACAGTAAAGAACAAAGG + Intergenic
1010333452 6:74652175-74652197 CATTTGAAATCTAAGAAGAATGG + Intergenic
1010909326 6:81534792-81534814 TAATTCACAATTAAGAAGAAAGG + Intronic
1011155759 6:84329328-84329350 CATTTCGCTTTTAACAACAAAGG + Intergenic
1011205935 6:84897859-84897881 CATATTACATTTAATAACATGGG + Intergenic
1011679679 6:89770887-89770909 CATATGACCTTTGAGAACAAGGG + Intronic
1011736908 6:90320210-90320232 TATTTCTCATTTTAAAACAATGG - Intergenic
1012334898 6:98043382-98043404 CACTTCACAATTAATAACGAAGG - Intergenic
1012785234 6:103616700-103616722 TTTTTGACATTTTAGAACAAAGG - Intergenic
1013506913 6:110809874-110809896 CTTTACATATGTAAGAACAAAGG + Intronic
1013849719 6:114499138-114499160 TATGTTACATTTCAGAACAATGG + Intergenic
1014927341 6:127288890-127288912 CAATTCACATTTGAGAATCATGG - Exonic
1015010496 6:128340681-128340703 CATTTTATATTAAATAACAAAGG - Intronic
1015141676 6:129941305-129941327 CAGTCCAGATTTAAGACCAAGGG + Intergenic
1015478019 6:133675210-133675232 CATTTGACATTTTAGAAACAAGG - Intergenic
1015919139 6:138249128-138249150 CATCACACAGTTAAGAACACTGG + Intronic
1016105367 6:140156250-140156272 CATTTAACATTTTTGAACCATGG - Intergenic
1016283411 6:142446199-142446221 CATTTTCCATTTAAGTAAAATGG - Exonic
1016465830 6:144324354-144324376 AATTTCACATTTGAAAATAAAGG + Intronic
1016630057 6:146218789-146218811 CATTTAATATTTAAATACAAGGG + Intronic
1018379974 6:163249875-163249897 CACTTCCCTTTTGAGAACAAAGG - Intronic
1018550548 6:164992743-164992765 CATTTTACATTTAAGAGGACTGG + Intergenic
1019027966 6:168987532-168987554 AAATTCACATTTAAAAATAATGG + Intergenic
1020439728 7:8204372-8204394 CATTTCACAGATAAGACCACAGG - Intronic
1020563393 7:9761268-9761290 AATTTCACACTTTGGAACAAAGG + Intergenic
1020804625 7:12773140-12773162 TTTTTAACATTTAAAAACAAGGG - Intergenic
1020865384 7:13554642-13554664 CAATTCGCATTTAAGACAAATGG + Intergenic
1021592856 7:22283260-22283282 CATTTGACATTTACAAACACAGG + Intronic
1021638660 7:22716717-22716739 CATATAACATTTTAAAACAATGG + Intergenic
1021897622 7:25251914-25251936 AATTTCACTTTAAAGCACAATGG - Intergenic
1021907920 7:25354182-25354204 AATTTCACATTTATGTAAAATGG - Intergenic
1022031799 7:26498589-26498611 CATTTCACAGATAAGGAAAAGGG + Intergenic
1022225984 7:28363808-28363830 CATTTCACAGATGAGAACAAAGG - Intronic
1022618835 7:31961538-31961560 CATTTGACAGATAAGAACACTGG + Intronic
1022750639 7:33220372-33220394 CTTCTCACATTTAGCAACAAGGG - Intronic
1022840057 7:34155565-34155587 CATTTCTAATTGAAGAAGAAAGG + Exonic
1023212456 7:37821962-37821984 CGTTTCACACTTAACAAGAATGG - Intronic
1023565490 7:41520445-41520467 CTTTTCACCTTTAAGGACATTGG + Intergenic
1025266869 7:57469011-57469033 CATTTCAAATGTAAAAACGATGG + Exonic
1026039763 7:66857986-66858008 TATTTCACATTTAATCACCAAGG - Intergenic
1027130555 7:75587387-75587409 TATTTTACATTTAAGAATAAAGG - Intronic
1027212050 7:76157680-76157702 CATTTAACATTTAATTACCAAGG + Intergenic
1027645839 7:80797049-80797071 AATTTCAAATTCAAGAAAAAAGG + Intronic
1027804938 7:82806741-82806763 CTTTTCTCATTTGAAAACAATGG + Intronic
1030004995 7:105109387-105109409 CAATCGACATTTAAGAACACAGG - Intronic
1030153915 7:106432828-106432850 TCTTTAACATTGAAGAACAAAGG + Intergenic
1031456846 7:121991630-121991652 CATTTCACTTTTTAAAACATAGG - Intronic
1034323960 7:150212637-150212659 CTTTTCAGAATGAAGAACAATGG + Intergenic
1035494416 7:159310746-159310768 CATTTCACAGTTGAATACAAGGG + Intergenic
1035537740 8:405394-405416 CATTTCACATGTGAAAAGAAAGG - Intergenic
1035863296 8:3053670-3053692 CATAGCAAATTTAAGAAGAAAGG - Intronic
1036293113 8:7512496-7512518 CTTTTAACATATAGGAACAAAGG - Intergenic
1036329446 8:7808504-7808526 CTTTTAACATATAGGAACAAAGG + Intergenic
1036638344 8:10566508-10566530 CATTTTACATCTAAGGACATTGG - Intergenic
1036697143 8:10982972-10982994 CATTTCACAAATAAGAAAATAGG - Intronic
1036722337 8:11188226-11188248 CATATCACATTTAATCATAAAGG + Intronic
1037643523 8:20770298-20770320 CATTTCCTATTAAAGAAAAATGG - Intergenic
1038821503 8:30956263-30956285 CCTTTCACAAATAAGAAAAATGG + Intergenic
1041085494 8:54252694-54252716 CATGTTACTTTTAGGAACAAAGG + Intergenic
1041259815 8:56011523-56011545 CATTTCAGATTGGAGAACCAAGG + Intergenic
1041606585 8:59788841-59788863 CATTTTACCTATAAGAGCAAAGG - Intergenic
1042582304 8:70293308-70293330 CTTCTCACATCTATGAACAAAGG + Intronic
1043093867 8:75939783-75939805 CATTTTGCATGTAAGAACATTGG - Intergenic
1043184172 8:77124702-77124724 CATTTCTCATCTAGGAAGAAAGG + Intergenic
1044006760 8:86946699-86946721 TATTACAGATTTAATAACAATGG + Intronic
1044289920 8:90455672-90455694 CATTTCATGTTAAATAACAAAGG + Intergenic
1044742865 8:95345364-95345386 GACTTCACATTTCAGAGCAAAGG + Intergenic
1044926230 8:97210853-97210875 TATTTCATATTTAAGAATGAGGG - Intergenic
1045009634 8:97946485-97946507 CTTTTCCCATTTAAAAAAAATGG + Intronic
1045530197 8:102977474-102977496 CCTGTCACAATTAAGCACAATGG - Intronic
1046399350 8:113684466-113684488 CATTTCACATTAATGCACACCGG + Intergenic
1046626827 8:116584203-116584225 CCTGACACATTTTAGAACAAAGG + Intergenic
1047050963 8:121112671-121112693 TATTTCACAAATAAGAAAAATGG + Intergenic
1047862188 8:128979752-128979774 CATTTCACATTTTAAAAGATAGG - Intergenic
1049119463 8:140721604-140721626 CACTTCACTTTTAAAAGCAATGG - Intronic
1049930616 9:452941-452963 CATTTCACCTATAAGAGAAAAGG + Intronic
1050235327 9:3572407-3572429 CATTCCAGAGTTAAGAACACTGG - Intergenic
1050868408 9:10534306-10534328 CATTTCAAATTAAAAAGCAATGG + Intronic
1050936021 9:11396109-11396131 CTTTTCACACTTAAGAGAAAGGG + Intergenic
1055235914 9:74123043-74123065 CATTTCTTATTTAAAAACTAGGG + Intergenic
1056101249 9:83302377-83302399 CATTTCACCTGAAAGAACAGTGG + Intronic
1056169714 9:83972494-83972516 CAATGCACATTTCACAACAAGGG + Intronic
1056540186 9:87564373-87564395 CATTTCCCAGTTAACAAAAATGG - Intronic
1057462606 9:95277295-95277317 CTTTTCCCATTTAGGAAAAAAGG - Intronic
1057646060 9:96876219-96876241 CACTTAACAGTTAAGAATAACGG - Intergenic
1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG + Intergenic
1059645116 9:116258232-116258254 AATTTCACATGGAAGAGCAAGGG + Intronic
1060458972 9:123830527-123830549 CATTTCACCTTTCAGTACCACGG - Intronic
1060577526 9:124710464-124710486 TATTTCACATTTAGCATCAAAGG + Intronic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1060711238 9:125866699-125866721 CATCTGCCATTTTAGAACAAAGG - Intronic
1060863653 9:126977469-126977491 CATCTCACATTCAAGAAAGAAGG + Intronic
1185861500 X:3583610-3583632 CATGTCACATTGAAGAAAAGTGG - Intergenic
1186606196 X:11095102-11095124 AATTTTACATTTGAGAACCATGG - Intergenic
1187042030 X:15606853-15606875 CTTTTTACATTTAGGAAAAAAGG - Intergenic
1187206671 X:17188100-17188122 CATTTCACAGCTAAGAAAACAGG - Intergenic
1189001197 X:36949126-36949148 CATTTCACTTGGAAGAACAAGGG - Intergenic
1190409811 X:50125358-50125380 CATTTCACTTATAAGGAAAACGG + Intergenic
1193753266 X:85373857-85373879 CAGTTCAGATGTAAGAGCAATGG + Intronic
1194084784 X:89512608-89512630 CATATCACCTTTAATAACACTGG + Intergenic
1194171505 X:90589551-90589573 CATTTTAGATACAAGAACAAAGG - Intergenic
1194750782 X:97682002-97682024 CATTTCACATATGGGAGCAATGG + Intergenic
1195309399 X:103616162-103616184 CATTTTACATGTAAAAAGAAAGG - Intronic
1195418456 X:104646267-104646289 CATTTAATATTCAAGAAGAATGG + Intronic
1195547851 X:106133598-106133620 CATTTCAAATGCAATAACAATGG + Intergenic
1196083977 X:111663983-111664005 CATTTGACATTTACGAACAATGG + Intergenic
1196123985 X:112080907-112080929 CATTTCACATTTGAAGCCAAGGG + Intronic
1198706738 X:139457277-139457299 CATCTCAAATTTAAGGAGAAGGG + Intergenic
1199242974 X:145569405-145569427 TATTTCATTGTTAAGAACAACGG - Intergenic
1199446183 X:147924878-147924900 CATTTTAAATTTAAAAACATAGG + Intronic
1200437431 Y:3168493-3168515 CATATCACCTTTAATAACACTGG + Intergenic
1200517738 Y:4167305-4167327 CATTTTAGATACAAGAACAAAGG - Intergenic
1201529869 Y:14979830-14979852 AATTTAACATTTAAATACAATGG - Intergenic