ID: 917417262

View in Genome Browser
Species Human (GRCh38)
Location 1:174823520-174823542
Sequence GAACCCTTGTTGCTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917417260_917417262 9 Left 917417260 1:174823488-174823510 CCGATTTACAGAAGAAAAGAAAA 0: 1
1: 5
2: 25
3: 265
4: 2554
Right 917417262 1:174823520-174823542 GAACCCTTGTTGCTTCTCACTGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917417262 Original CRISPR GAACCCTTGTTGCTTCTCAC TGG Intronic
900103958 1:974343-974365 GAACCCTGGCTGCCTCTGACAGG + Exonic
904033144 1:27545587-27545609 AAACTCTTGATCCTTCTCACTGG - Intronic
904889411 1:33767771-33767793 CAACCTTTGTTGCTTCATACAGG + Intronic
908525462 1:64983669-64983691 GAAAGCCTGTTCCTTCTCACTGG - Intergenic
909834557 1:80237498-80237520 ATACCCTTTTTTCTTCTCACTGG + Intergenic
912930815 1:113959139-113959161 GAATCCTGGTTTATTCTCACAGG - Intronic
917417262 1:174823520-174823542 GAACCCTTGTTGCTTCTCACTGG + Intronic
922481799 1:225944580-225944602 GAAGCCCTGTGGCTTATCACTGG + Intergenic
923273602 1:232378705-232378727 GATTCCTTTTTGCTTCTCAAAGG + Intergenic
924182028 1:241448497-241448519 GAGCCTCTGTTTCTTCTCACTGG + Intergenic
1065490226 10:26275039-26275061 GGACCCTTGGGGCTTCTCTCAGG + Intronic
1068218186 10:54010279-54010301 ACACCCTTGCTACTTCTCACCGG + Intronic
1069091081 10:64199448-64199470 GAGACCTTGCTGCTTATCACAGG + Intergenic
1070341245 10:75500162-75500184 GAACCCCTGTTGCTCCTTACAGG + Intronic
1074471586 10:113732060-113732082 GAACCCCAGTTCCTCCTCACAGG + Intergenic
1075062909 10:119269303-119269325 GTACCATTCTTGCTTCTCACGGG - Intronic
1075895652 10:125992323-125992345 GTACCTCTGTTGCTTCACACAGG + Intronic
1089275841 11:117335487-117335509 GATCCTTTGTTGCTTGTCAGGGG + Intronic
1089852207 11:121509166-121509188 GAACCTTTGTTGCTGCTCCAAGG + Intronic
1090120750 11:124024814-124024836 GAAATATTCTTGCTTCTCACAGG + Intergenic
1099781098 12:87196443-87196465 GAATAATTTTTGCTTCTCACTGG + Intergenic
1105208339 13:18241934-18241956 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1106183780 13:27390195-27390217 GACTCCTTGTTGCTTTTCATGGG + Intergenic
1114854080 14:26416390-26416412 AAAGCCTTGTTGTTTTTCACTGG - Intergenic
1119659491 14:76440022-76440044 AAACCCTGGGTGCTTCTCACTGG + Intronic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1124634921 15:31359171-31359193 CAACCCTTATTGCTCCTCAATGG - Intronic
1124996918 15:34732447-34732469 GAACCCTGGTTGCTACTTACAGG - Intergenic
1126929833 15:53635144-53635166 CTACCCTAGGTGCTTCTCACTGG - Intronic
1126986713 15:54319908-54319930 GGACCCTTGATGCTTCTGATGGG + Intronic
1134088483 16:11375208-11375230 GAACCCTTGTGTATTCTTACGGG - Intronic
1134213617 16:12298719-12298741 GGACCCTTGCTGTCTCTCACCGG + Intronic
1137882866 16:52070570-52070592 TAACCCTTCTTGCTTCTTCCTGG + Intronic
1138385152 16:56631573-56631595 GAACCCGTTTTGCTCATCACAGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144622118 17:16824306-16824328 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1144884306 17:18448407-18448429 AAACCCCTGTTGCCTCTCTCTGG + Intergenic
1145147925 17:20495970-20495992 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1147574087 17:41588641-41588663 AAACCCCTGTTGCCTCTCTCTGG - Intergenic
1149108896 17:53002168-53002190 GAACCATTGTTGCATCCCAGGGG - Intergenic
1150013952 17:61534426-61534448 AGACGCTCGTTGCTTCTCACAGG + Intergenic
1153308312 18:3652828-3652850 GAACACATGCTGCTTATCACTGG + Intronic
1154363701 18:13687434-13687456 AAGCCCTTTTTGCTTCTCCCTGG - Intronic
1159903716 18:74071903-74071925 GAACCATTGTCCCTGCTCACAGG + Intergenic
1160617445 18:80142488-80142510 GAAGACATGTTGCTTCTCAGTGG + Intronic
1161121398 19:2528825-2528847 GAACCCCTGTTTCCTCACACAGG - Intronic
1162300314 19:9841390-9841412 GAATCCTTCTTGCTTCCTACTGG - Intronic
1163910758 19:20189450-20189472 AAACCCATGTTGCTTCTTGCTGG - Intronic
924962040 2:44663-44685 GAGCTCTTTTTGCTTTTCACTGG - Intronic
926226649 2:10971663-10971685 GTGCCCTTGTTTCTCCTCACTGG - Intergenic
927123252 2:19989223-19989245 GAACCCTTGTTCCTTGTTCCAGG + Exonic
928237460 2:29556673-29556695 GAAACCTGGATGGTTCTCACAGG - Intronic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
931937263 2:67213478-67213500 CTCACCTTGTTGCTTCTCACTGG - Intergenic
939382376 2:141452765-141452787 GAACACTTGTTGGTTCTCCCAGG + Intronic
940412858 2:153386592-153386614 TACCCCTTCTTGCTTCTCCCTGG - Intergenic
940980261 2:159993576-159993598 GAACCCTGGTTTCTTCTGATGGG - Intronic
943075306 2:183187370-183187392 AAGCCCTTTTTGCTTCTCCCTGG - Intergenic
943760336 2:191601109-191601131 GAAGCCTTGTGGCTTCTACCCGG + Intergenic
945236595 2:207637076-207637098 GAAACCTTGTTGCTGATGACTGG - Intergenic
1179165454 21:38932005-38932027 GAACCCTTCTTGCCTCTTCCTGG - Intergenic
1180758909 22:18183834-18183856 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1180769196 22:18367625-18367647 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1180777116 22:18494770-18494792 GAAGCCATGGTGCTTCGCACAGG - Intergenic
1180809836 22:18752079-18752101 GAAGCCATGGTGCTTCGCACAGG - Intergenic
1180827068 22:18870854-18870876 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1181195979 22:21186331-21186353 GAAGCCATGGTGCTTCGCACAGG - Intergenic
1181213549 22:21306793-21306815 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1203230820 22_KI270731v1_random:108510-108532 GAAGCCATGGTGCTTCGCACAGG + Intergenic
1203277213 22_KI270734v1_random:96759-96781 GAAGCCATGGTGCTTCGCACAGG + Intergenic
951145975 3:19227768-19227790 TGACCCTTGTTGCCGCTCACTGG - Intronic
951236876 3:20246586-20246608 GAACTCTTGTTGATTTTCATGGG - Intergenic
954835240 3:53461052-53461074 GAACCCTGTTTGCTTTTCACTGG + Intergenic
956932444 3:74060248-74060270 GAACGCTTGTTGCTCCTCGAGGG - Intergenic
965611612 3:170549713-170549735 GAACCATTGTTTATTCTCAAAGG - Intronic
966148632 3:176841201-176841223 GAACCTTTGAGGCTTCTCAATGG + Intergenic
980269924 4:130570913-130570935 CAACTTTTATTGCTTCTCACTGG - Intergenic
980892104 4:138826858-138826880 GAACTCTTGTAGCTTCCCAGGGG - Intergenic
981832826 4:149021793-149021815 GAACACTTCTTTCCTCTCACAGG + Intergenic
983041020 4:162926599-162926621 GAACTCTTTTTGCATTTCACTGG - Intergenic
983069701 4:163254038-163254060 GAACTTTTGTTGCTTTTTACAGG - Intergenic
988388432 5:30596823-30596845 GAGCCCTAGATTCTTCTCACAGG + Intergenic
989750108 5:44883444-44883466 GAAATCTTGCTGCTGCTCACTGG - Intergenic
993652638 5:90540732-90540754 GAACATTTGTAGCTTCTCAGTGG - Intronic
995017526 5:107327925-107327947 GAACCCTTGTTTCTTCTTTCTGG - Intergenic
995297748 5:110540004-110540026 GCCCCCTTGTTGCTTCATACAGG - Intronic
995598835 5:113774948-113774970 GCCCCCTTGTTGCTTCACACAGG + Intergenic
996524283 5:124461325-124461347 GTACCCCTGTGGTTTCTCACAGG - Intergenic
997838563 5:137217086-137217108 GATTCCTTGTGGCTTCTCATGGG - Intronic
997932793 5:138086032-138086054 GGACCTTTGCTGCTTCTGACTGG - Intronic
998822496 5:146069311-146069333 GAGACCTTGTTGCTTCTGAATGG + Intronic
1000402641 5:160847633-160847655 CAAATCTTGTTGCTTCTCAAAGG - Intronic
1006679248 6:35785563-35785585 AAGCCCTTTTTGCTTCTCTCTGG + Intronic
1011153388 6:84300576-84300598 GATGCCTTGTTGCATCTCTCTGG - Intergenic
1012145827 6:95680602-95680624 GAAACAGTGTTCCTTCTCACAGG - Intergenic
1012328666 6:97957255-97957277 AAACCCCTGTTGCTTCTGGCAGG - Intergenic
1013520713 6:110930628-110930650 GAACCTTTGTTATTTCTCCCAGG + Intergenic
1016682907 6:146851246-146851268 GAGCCCTTGTTCCTTACCACAGG + Intergenic
1017787251 6:157766657-157766679 CAAGCCTTGTGGCTTCTCTCAGG + Intronic
1018644959 6:165939827-165939849 AAACCCTTTTGGCTGCTCACAGG + Intronic
1020622833 7:10538308-10538330 GAAATCTTGTGGCTTCTCAGTGG - Intergenic
1021254127 7:18368826-18368848 CAACCCCTGTTCCTTCTCAGGGG - Intronic
1030453860 7:109747560-109747582 GAAGCATTGTTGATTCTCATAGG - Intergenic
1031861103 7:126981281-126981303 GAAGACTTGTTGCTTCAGACAGG - Intronic
1037803493 8:22047561-22047583 GCACCCTTCTTTCTTCTCATTGG + Intronic
1038701979 8:29857356-29857378 GAGCCTTTGTAGCTGCTCACAGG - Intergenic
1040529382 8:48254028-48254050 TTACCCCTGTTGCTTCTTACAGG + Intergenic
1041374681 8:57202121-57202143 CAGCCATTGTTTCTTCTCACTGG - Intergenic
1042667933 8:71228125-71228147 GAACCCTTCCTGCAGCTCACAGG - Intronic
1043399083 8:79866215-79866237 TAAACCTTGTTGCTTCTCAATGG - Intergenic
1049415917 8:142495056-142495078 AAACCACTGTTGATTCTCACTGG - Intronic
1049554493 8:143275246-143275268 GAACCCTGGGAGCTTCTCAAGGG - Intronic
1049985588 9:947965-947987 GAGCCCTTGCTGCTGCTGACTGG + Intronic
1056722769 9:89085858-89085880 GAACTCGTGTGGCTGCTCACTGG - Intronic
1057397206 9:94690755-94690777 GAAACCTTGCTGCTTCTACCTGG - Intergenic
1057468966 9:95340899-95340921 CAACCTTTGTTTCTACTCACAGG + Intergenic
1058287271 9:103193932-103193954 GAACCATTGTTTCTTTTCGCTGG - Intergenic
1058298345 9:103337923-103337945 GTACCCATGTTTCTTCTGACTGG - Intergenic
1058649542 9:107161937-107161959 GAACCCTTTATGGTTCTCTCTGG + Intergenic
1060973223 9:127750646-127750668 GCACCCTTGGTGCTTAGCACAGG + Intronic
1189295278 X:39913442-39913464 GAACCCTTGCTGCATCACAGAGG + Intergenic
1194511627 X:94803328-94803350 GAACCCTAATTGGATCTCACCGG + Intergenic
1197794451 X:130284646-130284668 GCCCCCTTGTTGCTTCATACAGG - Intergenic
1200002792 X:153070901-153070923 GAACCCATGTTCCCTCGCACTGG - Intergenic
1200004931 X:153079108-153079130 GAACCCATGTTCCCTCGCACTGG + Intergenic