ID: 917422274

View in Genome Browser
Species Human (GRCh38)
Location 1:174877031-174877053
Sequence TATTACATGAAGATTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917422274 Original CRISPR TATTACATGAAGATTGTTCT TGG (reversed) Intronic
906626401 1:47329541-47329563 TATTACCTGAAAATTGGGCTGGG - Intergenic
909570048 1:77099454-77099476 GAATATATGAAGATTCTTCTAGG - Intronic
911429452 1:97765681-97765703 TAATACATGCACGTTGTTCTAGG + Intronic
911503407 1:98717527-98717549 TATTTTCTGAGGATTGTTCTGGG - Intronic
911986718 1:104635717-104635739 TATGAACTGAAGATTGTTCAGGG + Intergenic
912690006 1:111797775-111797797 AGTCACATGAAGATTCTTCTGGG + Intronic
915336533 1:155146188-155146210 TTTTACATTAAAATTGTTTTGGG - Intergenic
916385485 1:164262875-164262897 TATAGCATGAAGACTGTTGTCGG - Intergenic
917422274 1:174877031-174877053 TATTACATGAAGATTGTTCTTGG - Intronic
917776640 1:178343873-178343895 TAATACATGTAGATAGTTGTGGG + Intronic
919066781 1:192701846-192701868 TATTGCATGATGATTCCTCTAGG - Intergenic
919360822 1:196591846-196591868 TATTACATGAAATATGTTGTAGG + Intronic
919604591 1:199666270-199666292 TATTAGAAGAAGATTGCTTTGGG + Intergenic
920318116 1:205094602-205094624 TATTATGTGAATATTTTTCTGGG - Intronic
920542404 1:206789170-206789192 CATTCCATGAAGGTTGCTCTGGG + Intergenic
922092014 1:222404901-222404923 TAGTTCATGAAGAGTCTTCTGGG - Intergenic
923348673 1:233082041-233082063 TATAACAGGAAGCATGTTCTGGG + Intronic
923994773 1:239481127-239481149 TATGTCATGAATATTGTTCCAGG - Intronic
1062871605 10:909365-909387 TAATATTTGAAGATTGTTGTTGG - Intronic
1063528830 10:6810299-6810321 TATTTTATGAAGAGTTTTCTGGG - Intergenic
1063989088 10:11540237-11540259 TATTTCATATAAATTGTTCTTGG - Intronic
1067541751 10:47160000-47160022 TAGTAAATCAAGATTTTTCTAGG + Intergenic
1067687021 10:48471856-48471878 TATTACATCAAGACATTTCTCGG + Intronic
1068384871 10:56312897-56312919 TAATACATTCAGATTCTTCTAGG - Intergenic
1071039649 10:81291306-81291328 AATTATATGAAGAATGTTATTGG - Intergenic
1071270797 10:84005466-84005488 TGATACATGAAGATTGTTCAAGG + Intergenic
1072439846 10:95444576-95444598 TATTTCATGAACATTTTTCTGGG + Intronic
1074549537 10:114429816-114429838 AATTACATGCAGATTGGGCTGGG + Intergenic
1075910072 10:126116909-126116931 TATTTAATGAATATTATTCTTGG - Intronic
1078488623 11:11748054-11748076 AATTTCATGAAGAATGTCCTTGG + Intergenic
1078601581 11:12736325-12736347 TCTTTCCTGAAGTTTGTTCTAGG - Intronic
1079554100 11:21738365-21738387 TATTATATGAACAATGTTCTAGG - Intergenic
1079743096 11:24088693-24088715 AATGACATGAATATTGCTCTAGG - Intergenic
1079991504 11:27251210-27251232 GATTACATGAAGATTCTCCCAGG - Intergenic
1084343173 11:68522849-68522871 TCTTTCATGAAGACTGTTCATGG + Intronic
1088461390 11:110087028-110087050 GATTATATGAAGATTTTTGTTGG - Intergenic
1088834195 11:113563749-113563771 TTTTACATGAAGAATATTTTGGG - Intergenic
1090179341 11:124681675-124681697 TATTAAATTAAAATTGTGCTGGG + Intronic
1093723424 12:22473641-22473663 CATTACCTGAAGTTTGATCTAGG - Intronic
1094079800 12:26521139-26521161 TATTACCTGAAGATATTTTTTGG + Intronic
1097132579 12:56823483-56823505 GATTATATGAAAATTGTTCTGGG - Intergenic
1098456182 12:70676941-70676963 TTTTCCATGAAGAATGTTATTGG + Intronic
1098712856 12:73787969-73787991 TATTACTTGTAGATTTTTGTAGG + Intergenic
1098976444 12:76907107-76907129 AAATACATGAAGATTTTTTTTGG + Intergenic
1099374780 12:81885920-81885942 TGTTACATGAAGATTTTTTCAGG + Intergenic
1100484616 12:95013071-95013093 AATTTCATGAAGATTTATCTAGG + Intergenic
1100722430 12:97373031-97373053 TATTATATGCAGAGTGGTCTGGG + Intergenic
1101267734 12:103108239-103108261 TATAACAGGACAATTGTTCTTGG - Intergenic
1101899448 12:108780369-108780391 CATTACAGGAATATTGTCCTAGG + Intergenic
1105022390 12:132825806-132825828 TACTACAAGAACATTGGTCTGGG + Intronic
1106458516 13:29948327-29948349 GATTTCATGAAGACTGTTTTTGG + Intergenic
1108059693 13:46520056-46520078 TTTGACATGATGATGGTTCTTGG - Intergenic
1108792806 13:53993026-53993048 TATTACATGAATATTCATCCTGG - Intergenic
1111234256 13:85388469-85388491 TATTCCAAAAAGATTCTTCTAGG + Intergenic
1115673561 14:35644175-35644197 TATTTATTGAAAATTGTTCTGGG - Intronic
1115730250 14:36260683-36260705 TATTAGATAAAGATGATTCTAGG + Intergenic
1120817268 14:88874870-88874892 TATTTCATGAGGAATGTTGTCGG + Intronic
1127939497 15:63680300-63680322 TATTATATGTAGAATTTTCTCGG - Intronic
1128909622 15:71501146-71501168 TATAACAATAAGATTGTTGTTGG + Intronic
1129641258 15:77380884-77380906 TATTAAATGTAGATAGTTTTGGG - Intronic
1131040717 15:89263965-89263987 TATTTCTTGAAGATTCATCTTGG - Exonic
1133123110 16:3624377-3624399 TTTTACATTAAAATTGTTATTGG + Intronic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1135830143 16:25765734-25765756 AATTACATGAGGTTTGTTGTAGG - Intronic
1144110182 17:12022875-12022897 TTTTACCTGAAGACGGTTCTAGG + Intronic
1146788402 17:35737335-35737357 TATAACCTGAAGATTTTTCCAGG + Intronic
1149145970 17:53492772-53492794 TAATACCTGAAGATTTTACTTGG - Intergenic
1153087842 18:1308586-1308608 TATTAGTTAAAGATTGTTCTAGG - Intergenic
1153318126 18:3744469-3744491 TTTTACAGGAAAATTGTTGTGGG - Intronic
1155757377 18:29517933-29517955 TACTACATGAAGTTTGTACAAGG - Intergenic
1156175229 18:34536381-34536403 TATTAGATGATGAGCGTTCTAGG + Intronic
1156724174 18:40107974-40107996 TGTTCCATGAAGGTTTTTCTTGG + Intergenic
1157345688 18:46829798-46829820 AATTCCAAGAAGATGGTTCTTGG - Exonic
1158359328 18:56653607-56653629 TATTAAATGTATATTGTTCTGGG + Intronic
1159769742 18:72535784-72535806 TATTACATATAGGTTGTTATTGG - Intergenic
1162633565 19:11947558-11947580 AATTACCTGAAGCTTCTTCTGGG - Exonic
1162686702 19:12392098-12392120 TACTCCAGGAAGAGTGTTCTTGG + Exonic
1162691052 19:12431872-12431894 TACTCCAGGAAGAGTGTTCTTGG + Exonic
925643374 2:6009102-6009124 TATTAGAAGAAGTGTGTTCTAGG - Intergenic
925907511 2:8548066-8548088 GATAAGATGAAGATTGTTCCAGG - Intergenic
926807888 2:16728423-16728445 AATTACAAGAAAATTGTTATTGG - Intergenic
933029073 2:77303121-77303143 TATTTGAGGAAGATTTTTCTGGG - Intronic
933159305 2:79006889-79006911 TATTAAATGAAGAGTGTGGTTGG + Intergenic
935542283 2:104362694-104362716 TACTTTATGAAAATTGTTCTTGG - Intergenic
936796967 2:116217981-116218003 TAATACAAGGAAATTGTTCTGGG + Intergenic
938817653 2:134919740-134919762 TTTTCCATCAAAATTGTTCTGGG + Intronic
939555963 2:143673596-143673618 TTTTACATTAAGATTGTGGTAGG - Intronic
939576188 2:143898152-143898174 TAATACATGAATACTGTTCGAGG + Intergenic
940101893 2:150049725-150049747 TAAAACATGAAAACTGTTCTTGG + Intergenic
941427051 2:165360543-165360565 TATTACTTGAACAATGTTTTTGG - Intronic
942573881 2:177342273-177342295 AATTACATAAAGATTATTCCAGG - Intronic
942610096 2:177734584-177734606 TCTGTCATGAAGAGTGTTCTAGG - Intronic
944525493 2:200614682-200614704 TACCACAGGAAGACTGTTCTTGG - Intronic
944536210 2:200713043-200713065 TATTACATGAAAAGTATGCTCGG - Intergenic
946062147 2:216952108-216952130 AGTTACATGAAGAATGTTGTTGG + Intergenic
946655814 2:221945968-221945990 TCCTAAATGAAGATTGTTCAAGG + Intergenic
948171696 2:235908738-235908760 GATTACATGCAGAATGTTCATGG + Exonic
1169933116 20:10855040-10855062 TATTCCATGAAGATTCTCATTGG - Intergenic
1169976970 20:11340391-11340413 TAGCAAATGAAGATTGCTCTGGG + Intergenic
1170001267 20:11617346-11617368 GATTACATGAAGACTGTATTTGG - Intergenic
1170352327 20:15455450-15455472 TATTACTTGTTGAATGTTCTGGG - Intronic
1173047188 20:39523804-39523826 AATGAGATGAAGAATGTTCTAGG - Intergenic
1175447701 20:59035603-59035625 TATTCCAAGAAGAGTGTTCTAGG - Intronic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1178011130 21:28288718-28288740 TTTTAGATGAAGTTTGCTCTTGG + Intergenic
1179094005 21:38295438-38295460 TAAAACATAAAAATTGTTCTTGG - Intronic
951456239 3:22895483-22895505 TAGGAAATGAAGATTGTTTTAGG + Intergenic
951782150 3:26375909-26375931 TCTTATATGATGACTGTTCTAGG + Intergenic
953283812 3:41584807-41584829 GTGTACTTGAAGATTGTTCTTGG - Intronic
956415885 3:69029000-69029022 TATAACAAGAAGATAGTACTGGG - Intronic
956793521 3:72698600-72698622 TAGTACATGAAGACTGTTTATGG - Intergenic
957602395 3:82354738-82354760 TATTTCATGAAGCTCTTTCTAGG + Intergenic
958382173 3:93321402-93321424 TTTTACATGAAGATATTTCGTGG - Intergenic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959558077 3:107746294-107746316 GATTACAGGAAGATTTCTCTGGG + Intronic
963136415 3:141909473-141909495 TTTTACATGCAGAGTGGTCTGGG + Intronic
964290572 3:155175392-155175414 TATTAAAAGAAGAATGTTTTTGG - Intronic
965759921 3:172064744-172064766 TATTACATGAAACTGGTTTTGGG + Intronic
965875880 3:173319086-173319108 TATAACATGCAGATTTTTCATGG - Intergenic
965894343 3:173555928-173555950 TATTTCAGGAAGTTTGTTTTAGG + Intronic
967567593 3:190990053-190990075 AATTCCATGAAGAATGTTGTTGG + Intergenic
971978157 4:33717952-33717974 AAATACATGAATTTTGTTCTGGG + Intergenic
973003297 4:44978639-44978661 TTTTACATAAATATTGTACTAGG + Intergenic
974796152 4:66752857-66752879 TATTAAATGTAGAATATTCTTGG - Intergenic
976004021 4:80406670-80406692 TATAACATTAAGTTTGTACTAGG - Intronic
976145508 4:82039257-82039279 TATTAGAGGAAGAATATTCTGGG + Intronic
976270469 4:83225394-83225416 TATTATTTGCAGATCGTTCTTGG - Intergenic
977195201 4:94049819-94049841 TATTCCATTCAGATTGTTCCTGG - Intergenic
977987404 4:103399447-103399469 TATTAAGTGAATATTGTTGTTGG + Intergenic
978906762 4:114014014-114014036 TATTACATGAAAATCCTTCAAGG + Intergenic
978933569 4:114348015-114348037 TATTTCATGTAGAATGATCTGGG + Intergenic
978994905 4:115139004-115139026 TATAATAGGAAGATTATTCTGGG + Intergenic
979996408 4:127437052-127437074 TAGTACATGTAGCTTGTGCTGGG - Intergenic
980725474 4:136754387-136754409 TATTATATCAAGATTTTTTTAGG + Intergenic
984103183 4:175512169-175512191 TATTACATGTGTATTGTTTTTGG + Intergenic
985313178 4:188626140-188626162 TATTACATGTTAATTCTTCTAGG + Intergenic
986994750 5:13594148-13594170 TATTTCATGAGGAAAGTTCTAGG - Intergenic
988573430 5:32395341-32395363 AAATACATGTAGATTGTTTTGGG - Intronic
988573613 5:32397141-32397163 TTTTACATAAAGAATGCTCTGGG + Intronic
989062651 5:37424852-37424874 TATAAGCTGAACATTGTTCTAGG + Intronic
989158527 5:38368023-38368045 TTTTACATAAAGATTGTTGCAGG + Intronic
989691132 5:44145579-44145601 TGTTATATGAAGATTTATCTAGG - Intergenic
989721024 5:44528262-44528284 TATTACATCAACACTGTTGTGGG - Intergenic
990354766 5:54955564-54955586 CATTTCATGAGGATTGTTCATGG + Intergenic
990451471 5:55934884-55934906 TACTAAGTGAAGATTGTTCTAGG + Intergenic
990881646 5:60545639-60545661 TATAACTTGAGGATTTTTCTAGG + Intergenic
991585909 5:68201726-68201748 TATTACATGGAAATTGGTATGGG + Intergenic
992407469 5:76473389-76473411 TATTATAAGTAGTTTGTTCTGGG + Intronic
993250718 5:85518513-85518535 TATTACAAGGACATTGTTCTAGG + Intergenic
993451584 5:88077495-88077517 AGTTACATGAAGAATGTCCTTGG - Intergenic
996486998 5:124047834-124047856 TATTATATGATTATTATTCTTGG + Intergenic
996977641 5:129454467-129454489 TTTTACATGAAAAATGTACTGGG - Intergenic
997780870 5:136657061-136657083 CATTACATGAGGAATGTGCTTGG - Intergenic
998332672 5:141343265-141343287 TATTTCTTTAAGTTTGTTCTTGG - Intronic
998625716 5:143843350-143843372 TATTACATGAAGGTCATGCTCGG - Intergenic
1000924875 5:167180970-167180992 CATTACATGTGGATTGTTTTTGG - Intergenic
1001505036 5:172272263-172272285 AAATACATGCTGATTGTTCTTGG + Intronic
1002977783 6:2101476-2101498 TCTTACATGATGATGATTCTTGG - Intronic
1003676406 6:8208676-8208698 TATTACATGATCATTTTTCAAGG - Intergenic
1003880110 6:10472572-10472594 GATTACATTAAGATTGTTTTGGG - Intergenic
1007228983 6:40334993-40335015 TTTCACAGGAAGATTGATCTGGG + Intergenic
1007529548 6:42529669-42529691 AATTCCAAGAAGATTTTTCTTGG - Intergenic
1008296992 6:49790553-49790575 TGTTACATGAAGACAGATCTTGG - Intergenic
1008887294 6:56444939-56444961 TTTTCCAGGAAAATTGTTCTAGG + Intergenic
1009564578 6:65296219-65296241 TATTTAATGAAGATAGTTGTGGG + Intronic
1009646252 6:66406166-66406188 TATTCCATTAAGATTTTTTTAGG + Intergenic
1009811533 6:68673822-68673844 TATTTCATTAAGATTGTCCTGGG + Intronic
1011286765 6:85733034-85733056 TATTAAAACAAGATTTTTCTTGG + Intergenic
1013314519 6:108928833-108928855 TTTTACATAATGATTCTTCTCGG + Intronic
1015307521 6:131726341-131726363 TATTAGATAAAGGTTGTTATAGG + Intronic
1017319820 6:153077297-153077319 AAATACAGGGAGATTGTTCTAGG + Intronic
1018458062 6:163970569-163970591 TATGACATGAAAATTGATTTGGG + Intergenic
1020538549 7:9431505-9431527 CATTACATGAAGATATTTGTCGG - Intergenic
1020875595 7:13689683-13689705 TGTTACATAAAGCTTCTTCTAGG - Intergenic
1021910327 7:25379374-25379396 TATTATATGAAGAATGGTCTTGG - Intergenic
1023521507 7:41054490-41054512 TATTACATGGAAATTCTTCAAGG + Intergenic
1024755232 7:52521607-52521629 TATTTTATGTAGATTGTTTTCGG + Intergenic
1028123235 7:87081540-87081562 TATTACATTATGAATTTTCTGGG + Intergenic
1028444272 7:90902211-90902233 TACTGCATGAAGAATGTTATTGG - Intronic
1028676049 7:93461965-93461987 TATTCCATGAAGATATTTTTAGG - Intronic
1028808155 7:95053026-95053048 TCACACAGGAAGATTGTTCTGGG - Intronic
1030011046 7:105167935-105167957 TTTTACAGAAAGATTTTTCTGGG - Intronic
1031313268 7:120226506-120226528 TATTACAGTAAGATTGATCTAGG + Intergenic
1031793971 7:126147977-126147999 TATTATATGAATATTTTCCTTGG + Intergenic
1031852746 7:126885341-126885363 TCTTACCTGAAGAAAGTTCTGGG - Intronic
1034149031 7:148898831-148898853 TATTACATGAAAACTCTTTTAGG + Intergenic
1034543600 7:151775868-151775890 AATTTCATGAAGTTAGTTCTAGG + Intronic
1034843671 7:154422991-154423013 TATTACCTGCTGATGGTTCTCGG + Intronic
1036108394 8:5869737-5869759 TGTTACTTGAAGAATGTTCGTGG + Intergenic
1038934156 8:32229927-32229949 TTTGTCTTGAAGATTGTTCTGGG - Intronic
1041867382 8:62591981-62592003 TAGTTCATGAAGATACTTCTTGG + Intronic
1042892886 8:73632967-73632989 TATTCCAGGAATAGTGTTCTAGG + Intronic
1042895652 8:73664625-73664647 GATTAAATGAAGTTTATTCTAGG - Intronic
1043558850 8:81466954-81466976 TGTTACTTGAAGATCTTTCTTGG + Intergenic
1043766010 8:84133131-84133153 TTTTACATGTACATTTTTCTAGG + Intergenic
1045160584 8:99538679-99538701 TATCACATGAAGATCCTTTTAGG - Intronic
1045768182 8:105702340-105702362 TATTACAGGGAGATTTATCTTGG + Intronic
1046341425 8:112862347-112862369 TATATCATGACGACTGTTCTAGG + Intronic
1046681997 8:117180939-117180961 TATGCCATAAAAATTGTTCTGGG + Intergenic
1046866502 8:119156928-119156950 TCTTACTTCAGGATTGTTCTGGG - Intergenic
1055096254 9:72417442-72417464 TATTAGATCAAGATTGTAGTTGG + Intergenic
1055200158 9:73649266-73649288 GATTACATGAAGAATATTCATGG + Intergenic
1055904818 9:81280741-81280763 TATGATGTGAAGATTGGTCTTGG - Intergenic
1056415753 9:86374591-86374613 TAATACATGAAAATTGCCCTTGG - Intergenic
1056490339 9:87100485-87100507 TCTGACATGAATATTTTTCTTGG - Intergenic
1056622591 9:88226540-88226562 TATTTCATGATGGTTATTCTAGG + Intergenic
1057287466 9:93770647-93770669 AATCACATGAAGTATGTTCTGGG + Intergenic
1057327937 9:94083242-94083264 AATTATATGAGGATTATTCTAGG - Intronic
1058252795 9:102722465-102722487 TTTAATCTGAAGATTGTTCTGGG - Intergenic
1058273748 9:103010901-103010923 TATTACATAATGGTTGATCTAGG - Intronic
1060458229 9:123821111-123821133 TCTTCCATGAATATTGTTCCAGG + Intronic
1060912585 9:127362725-127362747 TATTACATGAAGGATGGTCCTGG - Intronic
1185994843 X:4934809-4934831 TATTTCTGAAAGATTGTTCTTGG - Intergenic
1186886774 X:13921911-13921933 TATTACATGCAGAAATTTCTAGG + Intronic
1187452155 X:19408008-19408030 TATAACATAAAGAATGGTCTAGG - Intronic
1187724037 X:22183629-22183651 TATTACATGTAGATGGTCATAGG - Intronic
1188550268 X:31356541-31356563 AATTAGAGGAAGAATGTTCTTGG - Intronic
1188936952 X:36188017-36188039 TATTACAAGAAGAGTGATATGGG + Intergenic
1195529150 X:105931910-105931932 TATTACATTCAGAATGTTGTGGG + Intronic