ID: 917422514

View in Genome Browser
Species Human (GRCh38)
Location 1:174879628-174879650
Sequence GTGTTGATAATTATTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 1, 2: 35, 3: 166, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917422514 Original CRISPR GTGTTGATAATTATTGAAAC TGG Intronic