ID: 917424569

View in Genome Browser
Species Human (GRCh38)
Location 1:174900860-174900882
Sequence TCTCCTGGATGATATCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 4, 1: 43, 2: 66, 3: 46, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917424565_917424569 23 Left 917424565 1:174900814-174900836 CCAGGCTGAATTTGAATGTTGAC 0: 1
1: 0
2: 1
3: 22
4: 214
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199
917424564_917424569 24 Left 917424564 1:174900813-174900835 CCCAGGCTGAATTTGAATGTTGA 0: 1
1: 0
2: 2
3: 28
4: 307
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199
917424567_917424569 1 Left 917424567 1:174900836-174900858 CCTGTCTTGCTAGGTTGACGAAG 0: 1
1: 59
2: 1036
3: 2424
4: 5595
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917424569 Original CRISPR TCTCCTGGATGATATCCTGA AGG Intronic
901179620 1:7332280-7332302 CCTCCTGGATGACATTCTGGAGG - Intronic
904897912 1:33831084-33831106 TCTCCTGGATAGTATCCTGCAGG - Intronic
905161555 1:36039852-36039874 AGTCCTGGATGATCTCCTGTCGG - Exonic
905414718 1:37795828-37795850 TCACCTGGATGCTGTACTGATGG - Exonic
905829247 1:41051447-41051469 TCTCCTGGAATACCTCCTGAAGG - Intronic
906939592 1:50244593-50244615 TCTCCAGGAAGACTTCCTGAAGG - Intergenic
908010085 1:59767194-59767216 TTTCCTGTATGATATCCTATGGG + Intronic
908033373 1:60025655-60025677 TGTCCTAAATGGTATCCTGAAGG - Intronic
909916700 1:81328351-81328373 TTTCCTGTATGATTTACTGATGG - Intronic
911342221 1:96652844-96652866 TCTCCTGGATAATATCCTGAAGG - Intergenic
912176375 1:107162911-107162933 TCTCCTAGATTAAAACCTGAGGG + Intronic
915374659 1:155382561-155382583 TCTTCTGGAATATCTCCTGAAGG - Intronic
916611669 1:166397819-166397841 TCTGCTGGATGAGATACTGATGG + Intergenic
917133041 1:171761771-171761793 TTACCTGGAGGATATTCTGAGGG + Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
917545044 1:175956815-175956837 TCTTCTGGAGTATCTCCTGAAGG - Intronic
918582738 1:186150649-186150671 TTTCCTGGATGTTCTCATGAAGG + Intronic
918802093 1:188985539-188985561 TCTCCTGGATAATATCCTGAAGG + Intergenic
918955392 1:191200286-191200308 TCCCCTGCATAATATCCTGAAGG - Intergenic
919144475 1:193616214-193616236 TCTTCTGGATTACCTCCTGAAGG - Intergenic
921626354 1:217381220-217381242 TCTGCTGGATAATATCCCGAAGG - Intergenic
921842279 1:219840896-219840918 TCTCCTGGATAATATCCTGAAGG - Intronic
921846465 1:219888266-219888288 TCTCCTGGATAATATCCTGAAGG - Intronic
922158929 1:223063738-223063760 ATTCATGGATGATATCCAGAGGG + Intergenic
922231989 1:223695458-223695480 TCTCCTGCATGTTTTCATGAAGG + Intergenic
1063338151 10:5236343-5236365 TCTTCTGGATAATATCCTGAAGG - Intergenic
1063792728 10:9472823-9472845 ACTTCTGGATGATATCCAGATGG + Intergenic
1063904404 10:10767375-10767397 CCTCCAGAATGACATCCTGAGGG + Intergenic
1064150264 10:12857201-12857223 TTTCCTGGATAATATCCTGAAGG - Intergenic
1065283304 10:24162934-24162956 TCTCTTGGATCATGTCCTCAGGG - Intronic
1066340122 10:34524184-34524206 TCTCCTGCATGATATTTTGCTGG - Intronic
1066699038 10:38106928-38106950 TCTCCTGGATAATATCCTGAAGG - Intronic
1066993326 10:42538276-42538298 TCTCCTGGATAATATCCTGAAGG + Intergenic
1069093319 10:64228553-64228575 TCTTCTGGATAATATCCTGAAGG + Intergenic
1069139776 10:64809012-64809034 TCTCCAGGACAATTTCCTGAAGG + Intergenic
1070455460 10:76610070-76610092 TCTCCTGGATAATATCCTGAAGG - Intergenic
1071323613 10:84490308-84490330 TCTCCTGGATAATATCTTGCAGG + Intronic
1071459462 10:85878193-85878215 TCTCCTGGATAATACCCTGCAGG - Intronic
1072024622 10:91442651-91442673 TCTCCTGGATAATATCCTGAAGG + Intronic
1072025075 10:91446944-91446966 TCTCCTGGATAATATCCTGAAGG - Intronic
1072854678 10:98934851-98934873 TGCCCTGGATGATATCCTGAAGG + Intronic
1075498101 10:122945453-122945475 TCTTCTGGAAGACCTCCTGAAGG - Intronic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1081508782 11:43746550-43746572 TCTTCTGGAGTATCTCCTGAAGG + Intronic
1082724225 11:56715985-56716007 TCTCCTGGAATACCTCCTGAAGG - Intergenic
1082775516 11:57241535-57241557 TCTCCTGGGTGATTTCTTCAGGG + Intergenic
1082876957 11:57998729-57998751 TCTCCTGGATAATATCCTGCCGG + Intergenic
1084856160 11:71988320-71988342 TTTCCTGGATGAAATACTGGTGG + Intronic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086129369 11:83384544-83384566 TCTCCTGGATAATATCCTGAAGG - Intergenic
1088109386 11:106244977-106244999 GCTCCTGGATGACTTCATGATGG - Intergenic
1089666381 11:120022896-120022918 TCTCCTGGAAAATACGCTGAAGG - Intergenic
1090540093 11:127692321-127692343 TCTTCTGGAGTATCTCCTGAAGG + Intergenic
1091354435 11:134924737-134924759 TCTCCTGGATGAGATGCTGGAGG - Intergenic
1092536624 12:9395063-9395085 CCTCGTGGATGACATACTGAGGG + Intergenic
1092548169 12:9469574-9469596 CCTCATGGATGACATACTGAGGG - Intergenic
1092555285 12:9553433-9553455 TCTTCTGGAACATCTCCTGAAGG + Intergenic
1092558051 12:9578261-9578283 CCTCGTGGATGACATACTGAGGG - Intergenic
1093318678 12:17684593-17684615 TATCCTGGATAATATTCTGGAGG - Intergenic
1093779466 12:23118622-23118644 TTTCAGGGATGATTTCCTGAAGG + Intergenic
1094504833 12:31052879-31052901 CCTCATGGATGACATACTGAGGG + Intergenic
1094513247 12:31109656-31109678 CCTCGTGGATGACATACTGAGGG + Intergenic
1094516815 12:31137247-31137269 TCTTCTGGAACATCTCCTGAAGG - Intergenic
1094758020 12:33494146-33494168 TCTCCTGGATAATATCCTGAAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095483272 12:42657935-42657957 TCGCCTGGATAATATCCTGTGGG + Intergenic
1096044753 12:48552767-48552789 TCTCCTGGATAATATCCTGCAGG + Intergenic
1096071637 12:48778617-48778639 TCTCCTGGGTGCTGTCCTTAAGG - Intronic
1096931216 12:55211991-55212013 CCTCCTGGATAATATCCTGCAGG - Intergenic
1098181896 12:67856232-67856254 TTTCCAGGCTGATATCCAGAAGG + Intergenic
1098680707 12:73349921-73349943 TCTCCTGGATAATATCCTGAAGG + Intergenic
1100212780 12:92414924-92414946 CCTCCTAGATGATATACTTATGG + Intergenic
1100456995 12:94761980-94762002 TCTTCTGGAATATCTCCTGAAGG - Intergenic
1101164706 12:102016579-102016601 TCTTCTGGAATATCTCCTGAAGG - Intronic
1101552739 12:105777503-105777525 TCTCCTGGATAATATCCTGCAGG - Intergenic
1101555171 12:105802100-105802122 TTACCAGGATGATACCCTGAGGG - Intergenic
1103174358 12:118849164-118849186 TCTCCTGGGTGATATCAGCATGG - Intergenic
1108233690 13:48378530-48378552 TCTTCTGGAATATCTCCTGAAGG + Intronic
1108444438 13:50493178-50493200 TAACCTGGATTATATACTGAAGG - Intronic
1109034011 13:57231499-57231521 TCTCCTGGATAATATCCTAAAGG - Intergenic
1109188070 13:59293272-59293294 TCTATTGGATAATATCCTGAAGG - Intergenic
1110818678 13:79888627-79888649 TCTCCTGGATAATATCCTGAAGG - Intergenic
1111056199 13:82953807-82953829 TATCCTGGATAATATCCTGAAGG + Intergenic
1111269072 13:85856175-85856197 TCTCCTGGAATATATCCTGAAGG + Intergenic
1111284179 13:86066641-86066663 TTTCCTGGATGTTATCTGGAAGG - Intergenic
1111610292 13:90596862-90596884 TCTCTTGCATGATATTCTAAAGG - Intergenic
1111861763 13:93716302-93716324 TCTCCTAGAAGACCTCCTGAAGG - Intronic
1112706528 13:102075699-102075721 TCTTCTGGAAGACCTCCTGAAGG - Intronic
1113276784 13:108739704-108739726 TCTTCTGGATAATATCCTGCAGG + Intronic
1113441969 13:110336201-110336223 TTTCCTGGAAAATATTCTGATGG + Intronic
1113651142 13:112035071-112035093 TCTCCTGGCAGATGCCCTGAGGG - Intergenic
1114267996 14:21083909-21083931 GCTCCTGGAGGAGCTCCTGAGGG + Exonic
1114848726 14:26356506-26356528 TCTCCTATGTGATACCCTGAAGG + Intergenic
1114856858 14:26457750-26457772 TCTTCTGGATTACTTCCTGAAGG - Intronic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1117859531 14:60075034-60075056 TCTCCTGGATAATATCCTGAAGG - Intergenic
1117900492 14:60527820-60527842 TCTCCTGGATAATATCCTGAAGG + Intergenic
1118104101 14:62638115-62638137 TCTCCTGGATAATATCCTGCAGG - Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1120553952 14:85906485-85906507 TCTCCTGGATAATATCCTGAAGG + Intergenic
1121027350 14:90626392-90626414 TCCCCTGGATCACATTCTGAAGG + Intronic
1121447868 14:93989536-93989558 GCATCTGGATGAAATCCTGATGG - Intergenic
1121570564 14:94943658-94943680 TCTCCTGCATGATAAGATGAGGG - Intergenic
1124724532 15:32144483-32144505 TCTCCTGGATAATATCCTGAAGG + Intronic
1124931533 15:34124565-34124587 TCTACTGGCAGAGATCCTGATGG + Intergenic
1125457417 15:39874308-39874330 TCACATGGATGATCTGCTGATGG + Intronic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126264901 15:46742588-46742610 TCTCCTGGATAATATCCCGAAGG - Intergenic
1126554247 15:49967697-49967719 TCTCCTGGATAATATCCTGAAGG - Intronic
1127049449 15:55065428-55065450 TCTCCTGGATAATATCCTGCAGG - Intergenic
1128722144 15:69957897-69957919 CCTCCTTGAGGATATTCTGATGG - Intergenic
1129064647 15:72890574-72890596 TCTCCTGCAAGACAACCTGAGGG - Intergenic
1129954498 15:79622848-79622870 TTTCATAGATGATATCCTGAAGG + Intergenic
1130794913 15:87197607-87197629 TCTCCTGAAAGAGATCCTGGTGG + Intergenic
1131821205 15:96275786-96275808 GCTCATGGATATTATCCTGAAGG - Intergenic
1134157920 16:11859077-11859099 TCTTCTGGAATATCTCCTGAAGG - Intergenic
1135749961 16:25049981-25050003 TCTTCTGGAATATTTCCTGAAGG - Intergenic
1137326166 16:47439258-47439280 TCTCCTGGATAATATCCTGCAGG - Intronic
1139874570 16:70135150-70135172 TCCACTGGATTATGTCCTGATGG + Intronic
1142399456 16:89851737-89851759 TCTCCTCCATGAGATGCTGACGG - Intronic
1145861367 17:28213149-28213171 TCTCCTGGATAATATCCTCAAGG - Intergenic
1145905727 17:28515132-28515154 TCTCCTTGAGGATGTCCTCAGGG + Intronic
1146146959 17:30427372-30427394 TCTCCTGTATGATATGATAAAGG - Exonic
1150094252 17:62358522-62358544 TCTCCTGGATTATATTCTCAAGG - Intergenic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1153407540 18:4757934-4757956 TTTCATGCATGACATCCTGAGGG + Intergenic
1153958077 18:10115202-10115224 TCACCAGCATGATTTCCTGAAGG + Intergenic
1154320527 18:13347640-13347662 TCTTCTGGATAATATCCTGCAGG + Intronic
1154328535 18:13410218-13410240 GCTCCTAGATGGGATCCTGATGG + Intronic
1155623840 18:27812123-27812145 TCTTCTGGACTATCTCCTGAAGG + Intergenic
1156729018 18:40167363-40167385 TCTTCTGGAGTATCTCCTGAAGG - Intergenic
1156855499 18:41776452-41776474 TCTCCTGGATAATATCCTGCAGG - Intergenic
1157622888 18:49026359-49026381 TCACCTGGATGACAACCTCATGG - Intergenic
1158168882 18:54574067-54574089 TCTCCTGGATAATATCCTGCAGG + Intergenic
1158407182 18:57170222-57170244 CCTCCTGGATGATTTCCTCAAGG - Intergenic
1159645634 18:70915334-70915356 TCTCCTGGATAACACCCTGGAGG + Intergenic
1162774345 19:12969936-12969958 TCCCCTGGATCACTTCCTGAGGG - Exonic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1164246480 19:23434700-23434722 TCTCCTGGATAATATCCTGCAGG + Intergenic
1165699165 19:37924368-37924390 TCTTCTGGAATATCTCCTGAAGG + Intronic
1166179816 19:41100077-41100099 TCACCTGCATTATATCCTGAAGG - Intergenic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925433095 2:3814079-3814101 TATCCAGGAGAATATCCTGAAGG - Intronic
926943812 2:18166754-18166776 TCTCCTGGATAATATCCTGAAGG + Intronic
927280215 2:21298415-21298437 TTTCCCGGATGGTATCCTGTGGG + Intergenic
927422292 2:22946111-22946133 TCTTCTGGAATATTTCCTGAAGG + Intergenic
928127456 2:28626421-28626443 TCTCCAGGTTGATGTCCTGAGGG - Exonic
930290012 2:49481898-49481920 TCTCCTGGATAATATCCTGCAGG - Intergenic
931709813 2:64978922-64978944 TATCCTGTATGAAATCCTCAAGG - Intergenic
935399598 2:102645876-102645898 TCTCCTGAATAATACCATGAAGG - Intronic
937147925 2:119663358-119663380 TCTCCTGGAGGACATCTTGCAGG + Intergenic
939072132 2:137556115-137556137 TCTCCTGGATAATATCCTGCAGG - Intronic
939374184 2:141342796-141342818 TCTCCTGGATAATATCCTGAAGG - Intronic
939609317 2:144290719-144290741 TCTCCTGGCAAATATCCTCATGG + Intronic
940080436 2:149795178-149795200 TCTCCTGGATAATATCCTGCAGG + Intergenic
940502802 2:154515303-154515325 TCTCCTGCTTGATATGCTTATGG + Intergenic
941239230 2:163016182-163016204 TCTCCTGCATAATATCCTGAAGG + Intergenic
942201441 2:173575519-173575541 TCTCCTGGGTGACATCATGAGGG + Intergenic
942958573 2:181803115-181803137 TCTCCTGGATAATATCCTGAAGG + Intergenic
943130123 2:183843451-183843473 AGTTCTGGATAATATCCTGAAGG - Intergenic
943233865 2:185292503-185292525 TCTCCTGGATAATATCCTGAAGG - Intergenic
943515262 2:188877735-188877757 TCTGGAAGATGATATCCTGAAGG - Intergenic
944288901 2:197981836-197981858 TCTCCTGGGTTATAAACTGAGGG - Intronic
947086200 2:226455502-226455524 TCTCCTGGATAATATCCTGAAGG - Intergenic
947754881 2:232554855-232554877 TCTCCTGGATGAAATGCTGAGGG + Intronic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
1171194157 20:23184456-23184478 TCTCCTGGACAATACCCTGAAGG + Intergenic
1173776263 20:45709443-45709465 CCTCCAGGATGAAATCTTGAAGG + Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1177951697 21:27545991-27546013 TCTGATGGATGAAATCCAGATGG + Intergenic
1178898935 21:36583726-36583748 TCCCCTGGATGGGATCCTGTGGG - Intergenic
1180687778 22:17683489-17683511 TTTCCTGGAGGATATGTTGATGG + Intronic
1182392798 22:30013334-30013356 TCTCCTGGATGCTTCCCTGCAGG + Exonic
1182928482 22:34150464-34150486 TCTCCTGGTTGAAATGCTGATGG - Intergenic
949456485 3:4244815-4244837 TCTCCTGGATAATATCCTGAAGG + Intronic
951157658 3:19375174-19375196 TCTCCTGGATAATATCCTGCAGG + Intronic
951311064 3:21126437-21126459 TCTCCTGGATAATATCCTGAAGG - Intergenic
954779999 3:53051755-53051777 TGTACTGGATGAGAACCTGAGGG + Intronic
956896062 3:73661160-73661182 TCTTCTGGAATATCTCCTGAAGG + Intergenic
958761534 3:98314947-98314969 TCTTCTGGAATATATCCTGGAGG - Intergenic
959218400 3:103482742-103482764 TCTCCTGGATAATATCCTGCAGG + Intergenic
959290554 3:104468389-104468411 TCCCCTGGATAATATCCTGAAGG + Intergenic
959967182 3:112369630-112369652 TCTCCTGGAATACTTCCTGAAGG - Intergenic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
963620339 3:147598400-147598422 TCTCCTGGATAGTATTGTGAAGG + Intergenic
964229452 3:154446865-154446887 TCTTCTGGATTACCTCCTGAAGG - Intergenic
965323746 3:167276667-167276689 TCTCCTGGATAATATCCTGCAGG - Intronic
966499065 3:180617430-180617452 TCTTCTGGAATATCTCCTGAAGG - Intronic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967638772 3:191836026-191836048 TCTCCTGGATAATATCCTGAAGG - Intergenic
967811497 3:193765029-193765051 TCCCCAGGATGACATCGTGAAGG - Intergenic
967837591 3:193977770-193977792 TCGCCTGGAGGAGATGCTGAAGG - Intergenic
968272174 3:197411481-197411503 TCTCCTGGATAATATCCTGCAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969517086 4:7653884-7653906 TCTCCAGGGTGAAATCCAGAGGG - Intronic
969909026 4:10426676-10426698 TCTCCTGGATAATATCCTGAAGG + Intergenic
970494462 4:16610788-16610810 TCTCCTGGATAATATTGTGAAGG - Intronic
970551044 4:17181366-17181388 TCTTCTGGAAGACTTCCTGATGG - Intergenic
970634912 4:17998619-17998641 TCTTCTGGAATATCTCCTGAAGG + Intronic
970673290 4:18419540-18419562 TCTTCTGGAAGACCTCCTGAAGG + Intergenic
970864233 4:20740158-20740180 TCTCCTGGATAATATCCTGAAGG - Intronic
970889057 4:21021747-21021769 TCTTCTGGAAGACCTCCTGAAGG + Intronic
971441843 4:26695432-26695454 TCTCCTGGATAATATCCTGCAGG - Intronic
972174705 4:36389088-36389110 TGTCCTGGCTGATAGCCTGTTGG + Intergenic
972255718 4:37353411-37353433 TCTCCTGGATAATATCCTAAAGG + Intronic
975154673 4:71058402-71058424 TCTCCTGGATAATATCCTGCAGG + Intergenic
976002896 4:80392938-80392960 TCTTCTGGAATATTTCCTGAAGG - Intronic
976572718 4:86632327-86632349 TCCCCTGGTTTAGATCCTGATGG - Intronic
976837396 4:89390767-89390789 TCTCCTGGATAATATCCTGCAGG - Intergenic
976848039 4:89512426-89512448 TGTCCTGTAAGATATCCAGATGG + Intergenic
977110159 4:92943138-92943160 TCTCCTGGATAATATCCTGCAGG + Intronic
977658380 4:99551711-99551733 TCTTCTGGAATATCTCCTGAAGG - Intronic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
977831691 4:101601855-101601877 TCTTCTGGAATATCTCCTGAAGG - Intronic
978614750 4:110583320-110583342 ACTACTGGATGATATTGTGATGG + Intergenic
979194729 4:117906932-117906954 TCTTCTGGAATATCTCCTGAAGG - Intergenic
979693037 4:123580988-123581010 TCTCCAGGATGATGGCCTCATGG - Intergenic
980433188 4:132730780-132730802 TCTTCTGGAATATCTCCTGAAGG + Intergenic
981618262 4:146665048-146665070 TCTCCTGGATAATATCCTGCAGG - Intergenic
981798881 4:148633128-148633150 TCTTCTGGAACATGTCCTGAAGG + Intergenic
981811322 4:148778949-148778971 TCTTCTGGAATATCTCCTGAAGG + Intergenic
982651089 4:158088812-158088834 TCTCCTGGATAATATCCTGCAGG + Intergenic
983173101 4:164558065-164558087 TCTCCTGGATAATATCCTGCAGG + Intergenic
983326724 4:166266961-166266983 TCTCCTGGATAATATCCTGCAGG - Intergenic
983716464 4:170787555-170787577 TCTCCTGGATAATATCCTGCAGG + Intergenic
983879211 4:172913815-172913837 TCTCCTGAATAATATCCTGAAGG - Intronic
983896065 4:173083393-173083415 TCTCCTGGATAATTTCCTGAAGG + Intergenic
986095025 5:4546020-4546042 CATCCTGATTGATATCCTGATGG + Intergenic
986376970 5:7142184-7142206 ACTCCAGGAAGATTTCCTGAGGG - Intergenic
987077501 5:14397868-14397890 GGTCCTGGATGACATCATGAAGG - Intronic
987593208 5:19960499-19960521 TCTCCTGGAATATCTCCTGAAGG + Intronic
987987544 5:25167652-25167674 TCTTCTGGAATATCTCCTGAAGG + Intergenic
988272852 5:29039533-29039555 TCTCCTGGAATACCTCCTGAAGG + Intergenic
988340239 5:29960982-29961004 TGTCTTGGATAATATCCAGAAGG - Intergenic
989593844 5:43137106-43137128 TCTCCTGGAAGAAAACATGAGGG + Intronic
990334882 5:54762806-54762828 TCTCCTAGATTATATACTGGTGG - Intergenic
990369051 5:55098094-55098116 TCTCCTGGATAATATCCTGAAGG - Intergenic
990837970 5:60043369-60043391 TCTACTGGATAATATCCTGAAGG - Intronic
991065424 5:62419609-62419631 TCTTCTGAATTATCTCCTGAAGG + Intronic
991538959 5:67705232-67705254 TCTCCTGGATTATATCCTGCAGG - Intergenic
991543817 5:67759110-67759132 TCTCCTGGATAATATCCTGCAGG - Intergenic
992032322 5:72734101-72734123 TCCCCCTGAAGATATCCTGAAGG + Intergenic
992284124 5:75215118-75215140 TCTCCCGGATGATTTCCTGCTGG - Intronic
992375222 5:76182116-76182138 GCTCCTGAATCATTTCCTGATGG + Intronic
993380692 5:87203760-87203782 TCTCCTGGATAATATCCTGAAGG + Intergenic
994142694 5:96359901-96359923 TCTCCTGGATAATATCCTGAAGG + Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
995757145 5:115518602-115518624 TCTTCTGGAATACATCCTGAAGG - Intergenic
995790485 5:115881767-115881789 CCTCCTGGATAATATCCTGAAGG + Intronic
995815885 5:116167418-116167440 TCTTCAGGATGTTATCCAGAAGG + Intronic
997036254 5:130195462-130195484 TATCCTTACTGATATCCTGAAGG - Intergenic
999382039 5:151128100-151128122 TCTCCTGGCTCGCATCCTGATGG - Intronic
999622738 5:153489389-153489411 TTTCCTGGATCATCTCCTGTTGG + Intergenic
999784159 5:154876218-154876240 TATCCTGGATTTGATCCTGAAGG + Exonic
1001225289 5:169939390-169939412 TCTTCTGGAATATGTCCTGAAGG + Intronic
1001887387 5:175306221-175306243 TCTTCTGGACAATCTCCTGAAGG + Intergenic
1003584868 6:7378947-7378969 TCTCAAGGAAGATATGCTGATGG + Exonic
1005208370 6:23431329-23431351 TCTCCTGGAAAATATCCGGAAGG + Intergenic
1006836523 6:37002380-37002402 TCTACCTGGTGATATCCTGAAGG + Intergenic
1008789647 6:55214934-55214956 TCTACTTGATGATGTCCTTAGGG - Intronic
1008829183 6:55737094-55737116 TCTCCTGGGTAATATCCTGCAGG - Intergenic
1009264272 6:61533361-61533383 TTTCCTGGATAATATCTTGAAGG - Intergenic
1009290259 6:61871431-61871453 TCTCCTGGATAATATCCTGAAGG - Intronic
1010319050 6:74485441-74485463 TCTCCTGGATAATATCCTGCAGG - Intergenic
1010755538 6:79662714-79662736 TCTCCTGGATAATATCCTGAAGG + Intronic
1011338011 6:86282702-86282724 TCTCCTGGACAATATCCTGTAGG + Intergenic
1012491686 6:99789166-99789188 TCATATGTATGATATCCTGATGG + Intergenic
1012533978 6:100273359-100273381 TCTTCTGGAATATCTCCTGAAGG - Intergenic
1013617955 6:111862227-111862249 TCTTATGGATGAAAACCTGATGG + Intronic
1013909035 6:115251645-115251667 TCTCCGGGATAATATCCTGCAGG - Intergenic
1013939758 6:115646737-115646759 TCTCCTGGATAATATCCTGAAGG - Intergenic
1014007045 6:116430947-116430969 GCTTCTTGAAGATATCCTGAAGG - Exonic
1014084942 6:117331415-117331437 TCTCCTGGATAATATCCCGAAGG - Intronic
1015291247 6:131540132-131540154 TCTCCTGGATAACATCCTGAAGG - Intergenic
1015519150 6:134114223-134114245 TCTCATGGAGGCTATCTTGAGGG + Intergenic
1015721169 6:136243760-136243782 TCTCCTGGAATACCTCCTGAAGG - Intronic
1018378798 6:163239489-163239511 ACTCCTGGACGAAATTCTGATGG - Intronic
1019080180 6:169425035-169425057 TCGCCTGGAGGATATTCTCAGGG - Intergenic
1021615156 7:22495992-22496014 TCTTCTGGAAGACCTCCTGAAGG - Intronic
1021693010 7:23248250-23248272 TGTCCTGGGAGGTATCCTGAGGG - Intronic
1022076096 7:26972644-26972666 TCTCAAGGATGATATTCTCATGG + Intronic
1022644735 7:32219638-32219660 CCTCCTGGTTGATACCCTGGTGG + Intronic
1024190504 7:47002338-47002360 TCTCCTGGATGCTTTTCTTAGGG - Intergenic
1026082295 7:67232618-67232640 TCTGCTGGATCATTTCCTTAGGG + Intronic
1026694778 7:72581376-72581398 TCTGCTGGATCATTTCCTTAGGG - Intronic
1028377340 7:90158631-90158653 TCTTCTGGAAGACCTCCTGAAGG + Intronic
1028508045 7:91591215-91591237 TCTCCTGGATAATATCCTGCAGG - Intergenic
1031314468 7:120239398-120239420 TCTCCTGGATAATACCCTGCAGG + Intergenic
1032445827 7:131982909-131982931 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1034703754 7:153121600-153121622 TCTCCTGGATAATATCCTGCAGG + Intergenic
1039319449 8:36412686-36412708 TCTCCTGGATAATATCCTGCAGG + Intergenic
1040449632 8:47531371-47531393 CCTTCTGGAAAATATCCTGAAGG + Intronic
1041217291 8:55613477-55613499 TATCCTGGAGGATGTCGTGAGGG + Intergenic
1043223696 8:77698267-77698289 TCTCCTGGATAATATCTTAAAGG + Intergenic
1043913899 8:85897928-85897950 TCTCCTTTGTGATATGCTGAAGG + Intergenic
1044774355 8:95672562-95672584 TTTCCTAGATGATCTCCTTAGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045177421 8:99740396-99740418 TCTCCTGGATAATATCCTGCAGG - Intronic
1046338740 8:112824872-112824894 TTACCTGGATAATATCCTGAAGG + Intronic
1046619779 8:116516594-116516616 GCTTCTGGAAGATATCCTTAGGG - Intergenic
1047331925 8:123897227-123897249 TATCCTGGTTGGTATCCAGAGGG - Intronic
1051008074 9:12373622-12373644 TCTCCTTGATGGGAGCCTGAGGG - Intergenic
1051101433 9:13526808-13526830 TCTCTGGGAAGATATTCTGAAGG + Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1051958412 9:22727505-22727527 TCTCCTGGATAATATCCTGCAGG - Intergenic
1052514819 9:29466597-29466619 TCTTCTGGAGCACATCCTGAAGG + Intergenic
1052515170 9:29471312-29471334 TCTCCTGGATGGTACTCTGAAGG + Intergenic
1055179779 9:73371183-73371205 TCTTCTGGAATATGTCCTGAAGG - Intergenic
1056122988 9:83507739-83507761 TCTTCTGGAATATTTCCTGAAGG + Intronic
1057469293 9:95343378-95343400 TCTCCTGACTGATTTCCTTAGGG + Intergenic
1058224107 9:102338782-102338804 TCTCCTGGATAATATCCTGCAGG - Intergenic
1058374471 9:104306488-104306510 TATCCTGTATAATATCCTGAAGG - Intergenic
1058408624 9:104705030-104705052 TCTCCTGGATGATATCGTGAAGG - Intergenic
1058511750 9:105726572-105726594 TCTTCTGGAATATTTCCTGAAGG + Intronic
1058761338 9:108136297-108136319 TCTCCTGAAAAATATTCTGAGGG - Intergenic
1059513526 9:114871254-114871276 TCTCCTGGATAATATCCTGAAGG - Intergenic
1186354380 X:8774515-8774537 TCTCCTAGGTAATATCCTGAAGG - Intergenic
1187363772 X:18650391-18650413 TCTCCTGGAAAATATTCAGAGGG - Exonic
1187365643 X:18663854-18663876 TCTACGGGAAGATATCCTGTAGG - Intronic
1189391957 X:40583860-40583882 TCTCCTGTATTCTATCTTGAAGG - Intronic
1189728730 X:43996421-43996443 TCTCCTGGGTGTTCTTCTGAAGG - Intergenic
1190341290 X:49298580-49298602 TCTACTGGATAATATCCTGAAGG + Intronic
1190574065 X:51815269-51815291 TCTCCTGGAATACCTCCTGAAGG - Intronic
1191938836 X:66455397-66455419 TCTCCTGGATAATATCTTGCAGG - Intergenic
1192481854 X:71492741-71492763 TTTCCTGGAGGAGACCCTGAAGG - Intronic
1192701880 X:73482701-73482723 TCTCCTGGATAATATCCCTAAGG - Intergenic
1192712466 X:73606061-73606083 TCTCCTGGCTTATATCCTGAAGG + Intronic
1192900425 X:75490163-75490185 TCTCCTGGATAATATCCTTCAGG - Intronic
1192948996 X:75996685-75996707 TCTCCTGGCTTATATCTTGAAGG + Intergenic
1192977504 X:76301980-76302002 TCTCCTTGATAACATCTTGAAGG + Intergenic
1192984424 X:76381294-76381316 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193243172 X:79196846-79196868 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193338721 X:80320858-80320880 TCTCGGGGATAATATCCTGATGG - Intergenic
1193510171 X:82389656-82389678 TCTCTTGGATAATATCCTGAAGG - Intergenic
1193528256 X:82620149-82620171 TCTCCTGGATGATACCCTGAAGG - Intergenic
1194958897 X:100213342-100213364 TCTCCTGGAAAATATCGTGAAGG + Intergenic
1195805100 X:108756772-108756794 TCTCCTGGAATACTTCCTGAAGG + Intergenic
1195810467 X:108823781-108823803 TCTCCTGGATAATATCCTTATGG + Intergenic
1196474624 X:116068464-116068486 TCTCCTGGATAATATCCTGCTGG + Intergenic
1196944803 X:120813084-120813106 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197576779 X:128222730-128222752 TCTTCTGGATTTAATCCTGAAGG + Intergenic
1197649164 X:129045803-129045825 TCTCCTGGATAATATCCTGCAGG - Intergenic
1198704836 X:139437242-139437264 TCTCCTGCATAATATCCTGCAGG - Intergenic
1199373088 X:147074410-147074432 TCTTCTGGAATATCTCCTGAAGG + Intergenic
1200365250 X:155656165-155656187 TCTCCTGGATAATATACTGAAGG + Intronic
1201541430 Y:15109350-15109372 TCTCCTGGATAATATCCTGAAGG + Intergenic
1202020666 Y:20461841-20461863 TCTCCTGGGTAATATCCTGATGG + Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic
1202362452 Y:24125738-24125760 TCTGCTTGATGAGATCCTGCTGG + Intergenic
1202508157 Y:25542755-25542777 TCTGCTTGATGAGATCCTGCTGG + Intergenic