ID: 917424569

View in Genome Browser
Species Human (GRCh38)
Location 1:174900860-174900882
Sequence TCTCCTGGATGATATCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 4, 1: 43, 2: 66, 3: 46, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917424564_917424569 24 Left 917424564 1:174900813-174900835 CCCAGGCTGAATTTGAATGTTGA 0: 1
1: 0
2: 2
3: 28
4: 307
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199
917424565_917424569 23 Left 917424565 1:174900814-174900836 CCAGGCTGAATTTGAATGTTGAC 0: 1
1: 0
2: 1
3: 22
4: 214
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199
917424567_917424569 1 Left 917424567 1:174900836-174900858 CCTGTCTTGCTAGGTTGACGAAG 0: 1
1: 59
2: 1036
3: 2424
4: 5595
Right 917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG 0: 4
1: 43
2: 66
3: 46
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917424569 Original CRISPR TCTCCTGGATGATATCCTGA AGG Intronic