ID: 917430647

View in Genome Browser
Species Human (GRCh38)
Location 1:174964648-174964670
Sequence TGCTGTATGTGGGACTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917430647_917430653 23 Left 917430647 1:174964648-174964670 CCTTAATAGTCCCACATACAGCA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 917430653 1:174964694-174964716 AAACAGCAATGTGGAGAGGGAGG 0: 1
1: 0
2: 1
3: 47
4: 475
917430647_917430652 20 Left 917430647 1:174964648-174964670 CCTTAATAGTCCCACATACAGCA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 917430652 1:174964691-174964713 TGTAAACAGCAATGTGGAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 291
917430647_917430651 19 Left 917430647 1:174964648-174964670 CCTTAATAGTCCCACATACAGCA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 917430651 1:174964690-174964712 CTGTAAACAGCAATGTGGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 184
917430647_917430650 14 Left 917430647 1:174964648-174964670 CCTTAATAGTCCCACATACAGCA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 917430650 1:174964685-174964707 GCAAACTGTAAACAGCAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917430647 Original CRISPR TGCTGTATGTGGGACTATTA AGG (reversed) Intronic
916204145 1:162299065-162299087 TGCTGTTTGAAGGACTACTATGG + Intronic
917389482 1:174519014-174519036 TGCTGTTTATGGAAGTATTATGG + Intronic
917430647 1:174964648-174964670 TGCTGTATGTGGGACTATTAAGG - Intronic
922008027 1:221551712-221551734 TGCTTAAAGTGGGAATATTAAGG + Intergenic
1068244885 10:54351880-54351902 TGCTGTATTGGGTCCTATTATGG - Intronic
1071328948 10:84541827-84541849 TGCTCTATGTGTGCTTATTATGG - Intergenic
1072748626 10:97959859-97959881 TGCTGTCTGTGTGACTACTGGGG - Intronic
1080115921 11:28621602-28621624 TGCTGTATGTTGGAGAGTTAGGG + Intergenic
1097158232 12:57028077-57028099 TGCTGTGTGTGGGAGTAGAAGGG + Intronic
1098937940 12:76501936-76501958 TGCTGTATGTATTACTATTATGG - Intronic
1099026475 12:77470243-77470265 TGGTGTTTGTGGTACTATAATGG - Intergenic
1101333523 12:103776704-103776726 TGATGTTTGTGCGACTATTTGGG - Exonic
1101889085 12:108695983-108696005 AGCTGTGTGTGGGAATATTTGGG - Intronic
1109098295 13:58145305-58145327 TGCTGCAGGTGGGACTCTCATGG + Intergenic
1109213591 13:59563096-59563118 TTGTGTATGTGGGAGGATTATGG + Intergenic
1111075234 13:83226994-83227016 TGCTGAATGTGGGATTTTCAGGG - Intergenic
1113396293 13:109950694-109950716 TGCTGTATGTAATACTATGATGG - Intergenic
1115513597 14:34162719-34162741 TACTGTATGTGATACTATAATGG + Intronic
1120369789 14:83618374-83618396 TGATGTATCTGTGACTATTAAGG - Intergenic
1124589130 15:31037490-31037512 TGGTGTATTTGGGACTAGGATGG + Intronic
1126466111 15:48962956-48962978 TGCTGTATGTAGGACTCTTCGGG - Exonic
1126944376 15:53802618-53802640 TGAAGTATGTGGGATTTTTAGGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1129908378 15:79205969-79205991 TGCTGGATGTGGGAAAATTCAGG + Intergenic
1130082818 15:80749410-80749432 TGGTGGATGTGGGAATTTTATGG + Intronic
1131237586 15:90710480-90710502 TCCTGGATGTGGGACTAGGAGGG - Intergenic
1134305353 16:13027050-13027072 TGCTGTATCTGGGTCTTTTGGGG + Intronic
1142860294 17:2756634-2756656 TGCTGTGTGTGGGATGATTTGGG - Intergenic
1149686267 17:58537066-58537088 TTCCCTATGTGGGACTATTCTGG + Intronic
1152929849 17:83103944-83103966 TGCTGTACGTGGGGCTTTTCAGG - Intergenic
1153449213 18:5208020-5208042 AGCTGTCTCTGGGACTATTGGGG + Intergenic
1163593665 19:18208426-18208448 TGCGGTAAGTGGGACCATCAGGG + Exonic
1167113786 19:47476937-47476959 TGCTGTATTTGGGACCCTCAGGG - Exonic
925418220 2:3688526-3688548 TGGTGTATGAGGCACTACTAAGG + Intronic
925673893 2:6339854-6339876 TGCTGTAATTGGGACTATCTAGG + Intergenic
927007677 2:18866931-18866953 TGCTGTATTTCAGACTTTTATGG + Intergenic
927401814 2:22720843-22720865 TGCTGTATTTCAGACTTTTATGG - Intergenic
931774702 2:65530586-65530608 TGCTGTGTCTGGGACTAGTTTGG + Intergenic
931970523 2:67580973-67580995 TGCTGTTTGAGGTACTATTTTGG - Intergenic
932547952 2:72735182-72735204 TGCTGAATTTAGGAGTATTATGG - Intronic
940353116 2:152710660-152710682 TGCTTTATGTGGGAGATTTATGG + Intronic
1169041597 20:2499974-2499996 TGTTGAATGTGGTAATATTATGG + Intronic
1169847847 20:10015145-10015167 GGCTGGATGTTGGAATATTATGG + Intronic
1170894925 20:20404273-20404295 TGCTGTTTGAGGGACTTTAAAGG + Intronic
1174828703 20:53793121-53793143 GGCTGTATGTTGGTCTATGATGG - Intergenic
1177691941 21:24521656-24521678 TGCTGTATGTGGAAGTATTCAGG - Intergenic
1179450258 21:41463699-41463721 TGCTGGATTTTGGACTTTTAAGG + Intergenic
1179769724 21:43605682-43605704 TTGTATATGTGGGACTATGAGGG - Intronic
1180895566 22:19329547-19329569 GGCTGCAAGTGGGACTCTTAAGG - Intergenic
1182194384 22:28500149-28500171 TGATGGATGTGGAACTTTTAGGG - Intronic
949685816 3:6568783-6568805 TGTAGTATGTGGGACAAATAAGG - Intergenic
953659586 3:44882380-44882402 TGCTGTATGTTGGTTTCTTAGGG + Intronic
960119842 3:113936747-113936769 TGCTGTAAGTGGCACAATCATGG + Intronic
964434005 3:156633451-156633473 TACAGTCTGTGGGACTCTTAGGG + Intergenic
965191457 3:165534973-165534995 TTCTGTATGTTTGATTATTATGG - Intergenic
967191236 3:186986591-186986613 AGCTGTATGTGGTTCTATTTTGG + Intronic
967718066 3:192786414-192786436 TAGTGTATGTGGAACAATTATGG + Intergenic
971126452 4:23760505-23760527 TGCTGGATTTGGGACTTTCATGG - Intronic
978644165 4:110908930-110908952 TGATGTATGTGGGAGTATAAAGG + Intergenic
980069825 4:128232089-128232111 TTCTGTATGTGGTATAATTAAGG - Intergenic
981329549 4:143492545-143492567 TGGTGTATGTTGTACTATTCTGG - Intergenic
983202523 4:164876876-164876898 TTCTGCATGTGGGACCAATATGG + Intergenic
987027479 5:13941771-13941793 TGCTGTATGTGTTTCTGTTAGGG - Intronic
987274794 5:16350959-16350981 CGCTGTGTGTGAGACAATTAAGG + Intergenic
990521368 5:56584672-56584694 AGCTGTATGTGTAACTTTTAAGG - Intronic
998757495 5:145397114-145397136 TCCTGAATGTGAGACTATAATGG + Intergenic
1000137892 5:158370513-158370535 TGGTTTATGTGGGGATATTAGGG - Intergenic
1002338052 5:178494023-178494045 TCCTGTATGTGGGAACATGAAGG + Intronic
1008488490 6:52061055-52061077 TGGTGTATTTGGGAGTGTTAAGG - Intronic
1026382335 7:69812125-69812147 TCCTGTAATTGAGACTATTATGG - Intronic
1027973470 7:85117962-85117984 TGCTCTTTGTGTGACTATCATGG - Intronic
1030459823 7:109819973-109819995 TGCTTTCTGTGGGCCTGTTATGG - Intergenic
1032335109 7:131017951-131017973 TGCTGTATGAGGGTGTAATAAGG - Intergenic
1043476461 8:80610470-80610492 TGCTGTATGAGCGACTATTTTGG - Intergenic
1044051886 8:87515610-87515632 TGCTGTATTTCGGACTTATATGG + Intronic
1044752113 8:95426349-95426371 ATGTGTATGTGGGAATATTAGGG + Intergenic
1044775263 8:95680085-95680107 TGCTGTATGTGGGACCATCCAGG + Intergenic
1044884759 8:96765429-96765451 TGGTGTCTGTGGGACTCTAAGGG + Intronic
1045010893 8:97957558-97957580 TGCTGTTTGTGGGACAGTTCTGG + Intronic
1049741224 8:144241930-144241952 TGCTGTAACTGGGACAGTTACGG - Intronic
1051690143 9:19703574-19703596 CACTGTAAGTTGGACTATTAGGG + Intronic
1054929757 9:70623792-70623814 TGCTGTATACTGAACTATTATGG + Intronic
1203372533 Un_KI270442v1:321967-321989 TGGCGTGTGTGAGACTATTACGG - Intergenic
1186210458 X:7245074-7245096 TGCTATATGTTGCACTCTTATGG + Intronic
1186874357 X:13802613-13802635 TGCTGTATATGGCACTTTTTTGG + Intronic
1188346977 X:29079160-29079182 TGTTGTTTGAGGGCCTATTATGG + Intronic
1189650406 X:43183204-43183226 TGCTTTAAGAGAGACTATTATGG - Intergenic
1190625363 X:52332186-52332208 TACTGTATGTGATACTATAATGG - Intergenic
1194306730 X:92257635-92257657 TGCTGTATTTGGGACTTGCATGG - Intronic
1197482255 X:127001916-127001938 TGCTCTAGGTGGGCCCATTAAGG + Intergenic
1198980848 X:142394078-142394100 TTGTGTATGTTGGACTATTGTGG + Intergenic
1199432556 X:147777457-147777479 TGCTGACTTTGGGACTTTTAAGG + Intergenic