ID: 917431289

View in Genome Browser
Species Human (GRCh38)
Location 1:174972252-174972274
Sequence CTGTTAGACCAGAAGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917431285_917431289 12 Left 917431285 1:174972217-174972239 CCAGGGGTCTAGGTTCCCTCTCA 0: 1
1: 0
2: 1
3: 7
4: 187
Right 917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG 0: 1
1: 0
2: 0
3: 12
4: 123
917431283_917431289 23 Left 917431283 1:174972206-174972228 CCTGCTGAGGACCAGGGGTCTAG 0: 1
1: 0
2: 0
3: 13
4: 183
Right 917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG 0: 1
1: 0
2: 0
3: 12
4: 123
917431287_917431289 -4 Left 917431287 1:174972233-174972255 CCTCTCACCATAGCAAGTTCTGT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG 0: 1
1: 0
2: 0
3: 12
4: 123
917431286_917431289 -3 Left 917431286 1:174972232-174972254 CCCTCTCACCATAGCAAGTTCTG 0: 1
1: 0
2: 1
3: 11
4: 159
Right 917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917431289 Original CRISPR CTGTTAGACCAGAAGCTACA TGG Intronic
902225718 1:14995302-14995324 CTCTTAGACCAGGCGCTCCAGGG + Intronic
902452801 1:16508650-16508672 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902472861 1:16661321-16661343 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902485942 1:16746122-16746144 CTGTCAGAACAGAAGTTTCAGGG - Intronic
902942226 1:19808754-19808776 CTTTTAGAACAGAACCTGCAGGG + Intergenic
903015657 1:20360051-20360073 GTGCTAGACCAGAAGCACCAAGG - Intergenic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
908870036 1:68599888-68599910 CTGTAAGACCACAAGCTGTAAGG + Intergenic
909299045 1:73987711-73987733 ATGTTAGATCAGAAGAAACATGG - Intergenic
912282567 1:108331806-108331828 CTTCTAGACTACAAGCTACATGG - Intergenic
913237478 1:116797404-116797426 CTCCTAGACCAGAAGGGACAAGG + Intergenic
914003083 1:143709140-143709162 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914004858 1:143723554-143723576 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914094289 1:144531626-144531648 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914097214 1:144554176-144554198 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914301778 1:146383433-146383455 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914304234 1:146402262-146402284 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914515491 1:148370672-148370694 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914781148 1:150786349-150786371 CTGTTAGCCCATAAAGTACAGGG + Intergenic
916458358 1:164994493-164994515 GTGTCAGATCAGAACCTACAGGG + Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917431289 1:174972252-174972274 CTGTTAGACCAGAAGCTACATGG + Intronic
922190560 1:223315101-223315123 CTGTAAGACTAGAAGCAAGATGG - Intronic
1063376702 10:5558426-5558448 GGGTTAGTCCAGAAGCTAGAAGG + Intergenic
1063518688 10:6721406-6721428 CTGCTGGACCAGAAGCTTCCTGG - Intergenic
1064896252 10:20240573-20240595 CTGTTAAATCTGAAGCTGCAGGG - Intronic
1067267640 10:44759829-44759851 CAGCTAGAACAGAAGATACAAGG + Intergenic
1074717511 10:116233594-116233616 CTGGTAGACTAGAAGCTCCCTGG + Intronic
1074719098 10:116249194-116249216 CTGCTAGACTATAAGCTCCATGG + Intronic
1078657400 11:13254497-13254519 CTATTAGACCATAAGCTTAAAGG + Intergenic
1079257644 11:18846411-18846433 ATGTTAGGCTGGAAGCTACATGG - Intergenic
1081471507 11:43376591-43376613 CTGTAAGTCCAGAAGCAAAAAGG - Intronic
1084915469 11:72425921-72425943 CTGTGAGACAGGAAACTACAGGG - Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1088759237 11:112913492-112913514 CTGTTACCCCAAAATCTACAAGG + Intergenic
1092695598 12:11167735-11167757 TTGTTAGAACTGAAGTTACAAGG - Intronic
1093501876 12:19822681-19822703 CTATTACACCATAAGCTCCATGG - Intergenic
1096468680 12:51863357-51863379 CTGGAAGGCCAGAACCTACACGG - Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098385676 12:69916175-69916197 CTCTTAGACAATAAGCTACTTGG - Intronic
1098664029 12:73137176-73137198 ATTTTAGAACAGAAACTACAAGG - Intergenic
1098711884 12:73773230-73773252 ATGTTATAACAGTAGCTACAAGG + Intergenic
1098963447 12:76762850-76762872 CTGTTAGGCCAGAAACCACCAGG - Intergenic
1099052077 12:77792448-77792470 CACTCAGACCACAAGCTACAGGG + Intergenic
1100854968 12:98750349-98750371 CTGTGAGACCAGATGCTGGAGGG + Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1106770763 13:32958742-32958764 CTGTTAGGCCAGCAGCTTCAGGG + Intergenic
1109396683 13:61767082-61767104 CAGTTAGAAAAAAAGCTACAGGG + Intergenic
1110307726 13:74009505-74009527 CTCACAGACCAGAAGCTTCAGGG - Intronic
1115907860 14:38221342-38221364 CACCTAGACCAGAGGCTACAAGG - Intergenic
1118157863 14:63258290-63258312 CTATTAGACCAGAAGGTTAAAGG - Intronic
1119909961 14:78340591-78340613 CTGGAAGACGAGAAGCCACATGG - Intronic
1120501321 14:85300595-85300617 CAGTGAGAGCAGAAGCTACAAGG + Intergenic
1122897611 14:104768311-104768333 CTGTTAGAACTGAAGCAATAAGG + Intronic
1125733684 15:41909005-41909027 CTGTCAGCCCAGAAGCCAGATGG + Intronic
1132758843 16:1499299-1499321 CTGTAAGAACAGAAGCTTCTGGG - Exonic
1137791760 16:51180891-51180913 ATGTCAGACCTGAAGCCACAAGG + Intergenic
1140981243 16:80111899-80111921 TTGTTAGACCTGAAGGAACAAGG + Intergenic
1143354844 17:6319190-6319212 CAGTTAGAACAGAAACCACATGG + Intergenic
1146231579 17:31115612-31115634 CTGTTAGACCAGCTGCTTCTGGG + Intronic
1147862301 17:43530692-43530714 CTGTTAGACCTGAAAAAACAAGG - Intronic
1163420814 19:17212728-17212750 CTGTCAGAGCAGAAGCCACTAGG + Exonic
1164024383 19:21337859-21337881 CTGTTATACCAGTAGCTAAAAGG - Intergenic
1168298807 19:55391413-55391435 CTCTTAGTCCAGTAGCTGCATGG + Intronic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
928740554 2:34347227-34347249 CTGATAAAACAGAATCTACATGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931952344 2:67379439-67379461 CTGTTATCCCAGCAGCTACTTGG - Intergenic
932862151 2:75305361-75305383 GTGTAAGACCAAAAGCTTCAGGG + Intergenic
935153782 2:100464098-100464120 CAGTGAGAGGAGAAGCTACAAGG - Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
937139354 2:119586043-119586065 CAGGGAGACCAGAAGCTAAAAGG + Intronic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938654393 2:133415987-133416009 GTGTTAGACCAGTAGTCACATGG + Intronic
939403363 2:141724347-141724369 CTCTTTTACCAGCAGCTACATGG - Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
946486636 2:220106798-220106820 CAGTTAGGCTAGAAGCTACAAGG + Intergenic
946762062 2:223004522-223004544 CTAGTAGACTAGAAGCTGCAGGG - Intergenic
1169197357 20:3690462-3690484 CAAGTAGAGCAGAAGCTACAAGG - Intronic
1169919976 20:10724849-10724871 CTATTAGAGCAGAAGTTCCAAGG - Intergenic
1171989346 20:31684025-31684047 GTGTTAGACCAGGATCTTCAAGG - Intronic
1172704846 20:36875632-36875654 GTGTTAGAACAGAAGCTAGAAGG - Intergenic
1174220982 20:48955292-48955314 CTGAGAGACCTGAAGATACAAGG - Intronic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
954696238 3:52428550-52428572 CTGCTAGATCAGAAGCTCCAGGG + Intergenic
957233865 3:77559027-77559049 TTGTTAGTCCAGTAGCCACAAGG - Intronic
957395506 3:79631737-79631759 CTGATAATCCAGAATCTACAAGG + Intronic
961738983 3:129020765-129020787 CTGTGAGCCCAGAGGCTCCAGGG + Intronic
962061793 3:131935651-131935673 CTGTATGACCAGAAGATTCAGGG + Intronic
966677042 3:182600785-182600807 CTCTGAGACATGAAGCTACATGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
976563902 4:86531880-86531902 GTCTTAGACAAGAAGCTCCAGGG + Intronic
980143621 4:128952585-128952607 CTGCTAGAACATAAGCCACAAGG + Intronic
981676112 4:147344945-147344967 GTGTGAGAGCAGAAGCTGCAAGG - Intergenic
987211458 5:15687944-15687966 CTGTTACATCACAAGCAACATGG - Intronic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
999745045 5:154585489-154585511 CTGCTAGACCATATGCTCCATGG + Intergenic
1001362095 5:171097377-171097399 CTGTTAGACCATAAGCTCCTTGG + Intronic
1005949563 6:30621485-30621507 GTATTAGAGCAGAAGCTATATGG + Intronic
1009466282 6:63973354-63973376 CTTTTTGCCCAGAATCTACAAGG + Intronic
1011536894 6:88385520-88385542 CTTTTAAAGCAGAAGCTACAAGG + Intergenic
1012183087 6:96179348-96179370 CTATTAAACCATAAGCTCCATGG - Intronic
1013829125 6:114251930-114251952 CTGTTATAACAGAAGACACAAGG - Intronic
1014797641 6:125745584-125745606 TTGTTACAGCAGAAGCTTCAAGG - Intergenic
1015738873 6:136431816-136431838 CTGTTAGAAAAGAAGCATCAAGG - Intronic
1019229246 6:170544286-170544308 CTGTGAGAACAGAAGACACAGGG + Intronic
1021181514 7:17511444-17511466 GTGGTTCACCAGAAGCTACAAGG + Intergenic
1021263875 7:18495145-18495167 CTGTTAGTCCTGAAACTAGAAGG + Intronic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1024486706 7:49927723-49927745 CTATTACCCCAGATGCTACAAGG + Intronic
1026671198 7:72392115-72392137 CTGTCAGAACACAAGCCACATGG + Intronic
1031599721 7:123692363-123692385 CTGTTAGACCAGATACGACAGGG - Exonic
1033387839 7:140896200-140896222 CTGTAAGACCCAAAACTACAAGG - Intronic
1035308150 7:157946637-157946659 CAGTTAGGCCAGCAGCCACAGGG + Intronic
1040040273 8:42909587-42909609 CTGTGCTCCCAGAAGCTACAAGG - Intronic
1040314422 8:46253486-46253508 CTCTTATACCAGAAGCCACCAGG + Intergenic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1047397663 8:124516974-124516996 CTGTAAGAACAGAAGTTACATGG + Intronic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1057828744 9:98391418-98391440 TAGTTAGACCATAAGCTTCAGGG - Intronic
1061639121 9:131937483-131937505 CTATTAGGACAGAAGCTCCATGG + Intronic
1185953152 X:4458589-4458611 CCGTCAGACCTGAAGGTACAGGG - Intergenic
1186885966 X:13914070-13914092 TAGTTATACCATAAGCTACATGG + Intronic
1191640783 X:63428373-63428395 ATGTTAGTCCAGAAGCTATTAGG + Intergenic
1191880801 X:65842261-65842283 CTCTAAAACCAGAAGCTATAAGG + Intergenic
1192058128 X:67794017-67794039 TTCTTAGACCAGAAGCTCCTGGG + Intergenic
1192150279 X:68707831-68707853 CTGAGTGACCAGAAGGTACAAGG + Intronic
1195544909 X:106103315-106103337 CTATTAGGCCAGATGCTTCAGGG - Intergenic
1200132193 X:153856497-153856519 CTGTTAGCCCTGCAGGTACAAGG - Intergenic