ID: 917431790

View in Genome Browser
Species Human (GRCh38)
Location 1:174976922-174976944
Sequence CTCATAATCTAATCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917431790 Original CRISPR CTCATAATCTAATCTGTGTC AGG (reversed) Intronic
906299281 1:44670411-44670433 CTCAGAAGCTAAGCAGTGTCAGG - Intronic
906676310 1:47696021-47696043 CTTAGAATCTAAGCTGTGACAGG - Intergenic
908187544 1:61667081-61667103 CTCATCACCTACTCTGTGTCGGG - Intergenic
908242220 1:62196958-62196980 CTTATAATCTAGTGTGGGTCAGG + Intronic
909239350 1:73192309-73192331 CTCATAAGCTACTCTGTTTATGG + Intergenic
910054007 1:83009792-83009814 CTGAAAATCTATTGTGTGTCAGG - Intergenic
910976691 1:92914177-92914199 CTGATAATCTAGTATGTGTCAGG - Intronic
913442122 1:118909197-118909219 CTCAGAATCTATTCTGTGGAAGG + Intronic
915513126 1:156397679-156397701 CTGAAAATGTAGTCTGTGTCAGG - Intergenic
917431790 1:174976922-174976944 CTCATAATCTAATCTGTGTCAGG - Intronic
918194702 1:182210326-182210348 TTCAAAATATAATCTGTGCCTGG - Intergenic
918425960 1:184410203-184410225 CTGATAATTATATCTGTGTCTGG + Intronic
919824503 1:201493875-201493897 TTCATAAACAAATCTTTGTCAGG + Intronic
921665912 1:217870382-217870404 ATCATAAACTTATGTGTGTCTGG - Exonic
1063494966 10:6498606-6498628 CTCCTATTCTAAGCTGGGTCAGG + Intronic
1065315276 10:24457898-24457920 CTCATGAGCTACTCAGTGTCAGG + Intronic
1065797635 10:29321841-29321863 CCCAGAATCTAACCTGTTTCTGG + Intergenic
1072024078 10:91436530-91436552 TTTATAACCTCATCTGTGTCTGG + Intronic
1072462616 10:95633756-95633778 CTAATCTTCTAATCTGTGTGGGG - Intronic
1072483310 10:95830203-95830225 CACATGATATAATCTTTGTCTGG - Intronic
1073926660 10:108524288-108524310 CTAAGAATCTACTGTGTGTCAGG + Intergenic
1078483344 11:11699650-11699672 CTAATAATCCACTGTGTGTCAGG + Intergenic
1078648807 11:13168130-13168152 CTCATAATCAAATCTATGGGAGG - Intergenic
1079468765 11:20758255-20758277 GTCATACTCTAAGCTGTGGCAGG + Intronic
1080027294 11:27627947-27627969 CACTTAAGCCAATCTGTGTCTGG - Intergenic
1080236777 11:30079167-30079189 CACATAGTGTAATCTGTGTGTGG + Intergenic
1081317972 11:41654035-41654057 GTCATATTCTTATCTGTCTCTGG + Intergenic
1085355291 11:75831190-75831212 CTCATAATCTAGTGGGTGGCCGG + Intronic
1087241137 11:95781869-95781891 CTCATAATCTAATAGGTGATTGG + Intronic
1087793000 11:102427094-102427116 TTCACAATCTAGTCTGTGGCTGG + Intronic
1090358182 11:126154601-126154623 CTCATGATCTCATCCGAGTCGGG + Intergenic
1095154654 12:38837756-38837778 ATCTTAATCTAACCTATGTCAGG + Intronic
1095235965 12:39796066-39796088 CTACTAATCTACTCTGTGTATGG + Intronic
1096713048 12:53471786-53471808 CTCAATATCTAATCAATGTCAGG + Exonic
1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG + Intergenic
1097945297 12:65361194-65361216 CTCAACTTCTAATATGTGTCAGG + Intronic
1099978250 12:89568987-89569009 CTGATTAGCTAATCTGGGTCAGG - Intergenic
1100246453 12:92762755-92762777 CTCATGATCTTATCTATGTAAGG - Intronic
1102860489 12:116331882-116331904 TTCTTATTTTAATCTGTGTCTGG - Intergenic
1103002999 12:117400381-117400403 CTCATTTTCTCATCTCTGTCAGG - Intronic
1108206256 13:48093482-48093504 CTCTGAATGTAATTTGTGTCTGG - Intronic
1109423325 13:62142168-62142190 CTGATAATCTAATCCGGGTAGGG + Intergenic
1111494523 13:89031039-89031061 TACATAATCTAATTTGTTTCAGG - Intergenic
1116080985 14:40171717-40171739 CTCATATTCTGATCTGAGTGAGG - Intergenic
1116510925 14:45745863-45745885 CTCATTCTCTATTCTCTGTCAGG + Intergenic
1117412175 14:55460549-55460571 CTCAGATTTTAATCTGTGTGTGG + Intergenic
1125135203 15:36333196-36333218 ATGAGAATCTAATTTGTGTCTGG + Intergenic
1126327935 15:47502107-47502129 CTCATAATTTCATCTGTCTCTGG - Intronic
1127885105 15:63191992-63192014 TTCCTATTCTAATCTGTTTCAGG - Intronic
1130714001 15:86313960-86313982 CTCATCATCTAACTTGTGTGTGG - Intronic
1134361268 16:13533195-13533217 CTCTGAATCTAAACTGTGTGGGG - Intergenic
1135349730 16:21718507-21718529 CTCATAATTTATTCTGTCTGGGG + Intronic
1137377726 16:47967916-47967938 CTCATGAACTATACTGTGTCTGG + Intergenic
1149165216 17:53743115-53743137 CCCATAATCTGATGTGAGTCTGG - Intergenic
1153151267 18:2096165-2096187 CTCATAATTAAGTCTTTGTCTGG - Intergenic
1157146322 18:45166531-45166553 CTCAGAATAGAATCTGAGTCAGG - Intergenic
1158074168 18:53509525-53509547 CTCATAATCTAATCTGCAGAGGG - Intronic
1158278330 18:55792823-55792845 CTTATAATGTAATCTGTGAATGG - Intergenic
1161299965 19:3537815-3537837 CTCATAAGCTTCTCTGTCTCTGG - Intronic
1162908285 19:13836194-13836216 CTCAGAATCAGACCTGTGTCTGG - Intergenic
1163990817 19:20997819-20997841 TTCATAAACTACTCTGTTTCAGG - Intergenic
1164116414 19:22223645-22223667 CTAATAATCTAATTTATTTCAGG - Intergenic
1164149357 19:22535999-22536021 CTCTGAATCTATTCTGTTTCAGG - Intergenic
1166124970 19:40709548-40709570 CAGATAATCTAATATGTGGCTGG + Intronic
927865085 2:26583056-26583078 CACATAACCTAATCTCTGTGGGG - Intronic
933321723 2:80783639-80783661 CTCAATATCTGCTCTGTGTCTGG + Intergenic
935686835 2:105691384-105691406 CTGAGAGTCTACTCTGTGTCTGG + Intergenic
939297448 2:140286580-140286602 GTCATAATCTAATCTGTGCATGG + Intronic
940581453 2:155585052-155585074 CTGCTAATCTAATCTGGGTAGGG - Intergenic
940745042 2:157557616-157557638 CTGATCATCTACTATGTGTCAGG - Intronic
942887919 2:180951199-180951221 TTCATATTTTAATCTGTGTTTGG + Intergenic
943496853 2:188631057-188631079 CTGTTAATCTAATCAGAGTCAGG - Intergenic
944229169 2:197376085-197376107 CCCATAATCCACACTGTGTCAGG + Intergenic
944263881 2:197703523-197703545 CTCATGATGAAATCTTTGTCAGG + Intronic
945730558 2:213527230-213527252 CTCATAATCTCATATTTTTCAGG + Intronic
1170663171 20:18362673-18362695 CTGATAATCTACTTTGTGCCAGG + Intergenic
1171093178 20:22305493-22305515 CTCATAAAATAATGTGTGACAGG - Intergenic
1173213601 20:41058164-41058186 CTGAGCATCTATTCTGTGTCAGG - Intronic
1175079558 20:56407860-56407882 CTCTGAATTTAATCTGTGTCTGG - Intergenic
1178071246 21:28969246-28969268 CTAAGAAACTAATCAGTGTCTGG - Intronic
1179030355 21:37714624-37714646 CTCTTAATCCAATCTGTGTTGGG - Exonic
1180572456 22:16740381-16740403 TTCATATTTTAATCTGTGCCAGG - Intergenic
1184957192 22:47897059-47897081 CTAATAATCTATTGTGTATCTGG - Intergenic
949615782 3:5752463-5752485 CTCATCATCAAATATGTGCCTGG - Intergenic
951721700 3:25706192-25706214 TTGACAGTCTAATCTGTGTCAGG - Intergenic
952189999 3:31012916-31012938 CACATCATCTAATCTGTTTAGGG + Intergenic
957105230 3:75878511-75878533 TTCATATTTTAATCTGTGCCAGG + Intergenic
957609719 3:82451434-82451456 CTCATTTTTTAATGTGTGTCAGG - Intergenic
960346173 3:116535864-116535886 CTCACAGCCTAATATGTGTCAGG + Intronic
961813933 3:129538287-129538309 CTCATGATCTAATATGGGTGCGG - Intergenic
964885515 3:161477601-161477623 CAAATAATACAATCTGTGTCAGG - Intergenic
970453848 4:16201867-16201889 CTCACAAGCTAATCAATGTCGGG + Intronic
971494252 4:27247233-27247255 CTCAGAATCTAATCTGGGATGGG - Intergenic
975855558 4:78620850-78620872 TTGATAATCTAATATGTGCCAGG - Intergenic
977839012 4:101678389-101678411 CTCTGAGTCTACTCTGTGTCCGG + Intronic
982081576 4:151795313-151795335 ATCATTATCTAGTTTGTGTCTGG + Intergenic
985365503 4:189227388-189227410 CTCCCCATCGAATCTGTGTCTGG + Intergenic
988883376 5:35529625-35529647 CTCATGACCTAATCAGAGTCAGG - Intergenic
993196751 5:84758325-84758347 CTCAAATTGTAATATGTGTCAGG + Intergenic
994640628 5:102404553-102404575 CACATAATCTTATATGTTTCTGG - Intronic
998548464 5:143052629-143052651 CTCATAACCCAGTATGTGTCAGG + Intronic
1000090022 5:157922238-157922260 CTCTCAATCTCTTCTGTGTCTGG + Intergenic
1005089858 6:22045053-22045075 CTCAGAATTTAATATTTGTCAGG - Intergenic
1005420495 6:25643422-25643444 CTCATAGTCTAATTTGGGTTAGG - Intergenic
1007866645 6:44977574-44977596 CTCACAAGCTAAACTGGGTCAGG + Intronic
1007911693 6:45521660-45521682 CTCATAGTCTTATCTTTTTCAGG + Intronic
1008120402 6:47609378-47609400 GTAAAAATCTAATCTGTGGCTGG + Intronic
1008418457 6:51270111-51270133 CATAAAATCTAATCTGTGGCAGG - Intergenic
1010144406 6:72650157-72650179 CTTATAATTTAATCTGTATTAGG + Intronic
1013117146 6:107112255-107112277 CACCTAATCAAACCTGTGTCAGG + Intronic
1015379149 6:132547127-132547149 CCCATAATCTCATCTGTGGTTGG + Intergenic
1017329734 6:153182356-153182378 CTCATACTCTATTCTGTTGCAGG + Intergenic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1021158763 7:17245648-17245670 CTCATAAAAAAATCTGAGTCTGG + Intergenic
1021205310 7:17772870-17772892 CTCCTAATTTAATTTGTGTCGGG - Intergenic
1024705355 7:51952639-51952661 CTCATCATCTCATCTGTATCAGG - Intergenic
1028155982 7:87429879-87429901 ATCATCATCTAATTTGTGTCAGG + Intronic
1032215784 7:129956031-129956053 ATCATAACCTAACCTGTTTCTGG - Intergenic
1033382323 7:140834289-140834311 TTCATTATCTAATGTGTGTCAGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033693096 7:143758013-143758035 ATCATTATATAATCTGTTTCTGG + Intergenic
1034051444 7:147988461-147988483 CTCATAATGTTATATGAGTCAGG + Intronic
1036010375 8:4715237-4715259 TTCATAACCTAACCTGTGTTTGG + Intronic
1036674023 8:10814250-10814272 CTCATAAACTGTTCTGTGTGGGG - Intronic
1037514725 8:19619159-19619181 CTCAGACTCAAATCTGAGTCAGG + Intronic
1040686024 8:49874537-49874559 CTCATCCTCAAATGTGTGTCTGG - Intergenic
1042987771 8:74603324-74603346 CTCAATATCTAATCAATGTCAGG - Intronic
1047038815 8:120970052-120970074 CTCACAATTTTATCTGTCTCTGG + Intergenic
1049489462 8:142887242-142887264 TTCATAAACTACTCAGTGTCAGG - Intronic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050240995 9:3635090-3635112 CACACAATCTACTCTGTGTAGGG + Intergenic
1050379680 9:5014505-5014527 ATCATAATCTAATCTATGGTGGG + Intronic
1051673052 9:19531645-19531667 CTCAGCATCTACTCTGTGTAAGG + Intronic
1059290561 9:113220644-113220666 CTCATAATCTAATAGGTGCGGGG + Intronic
1059380683 9:113921068-113921090 TTCAACATCTGATCTGTGTCAGG - Intronic
1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG + Intronic
1062152048 9:135024938-135024960 CTCATAATCTGGTCTGTCTTAGG - Intergenic
1062299059 9:135854031-135854053 CTCATAGCCTACTCAGTGTCAGG + Intronic
1189817782 X:44841405-44841427 CTGAGCATCCAATCTGTGTCAGG - Intergenic
1189852152 X:45188468-45188490 GTCATAATTTAATTTGTGCCGGG - Intronic
1192046314 X:67677741-67677763 CTCATTGTGTAATCTGAGTCAGG + Intronic
1192694155 X:73397161-73397183 CTCATTATCTCATCTCTCTCAGG + Intergenic
1193743247 X:85243989-85244011 ATCACAATCTACTCTGCGTCTGG - Intergenic
1194073354 X:89355614-89355636 TTGATAAACTACTCTGTGTCTGG - Intergenic
1194417815 X:93635431-93635453 CACATAATGTAATTTGAGTCTGG + Intergenic
1195102072 X:101564861-101564883 CTCATAATATCTTCTGTCTCTGG + Intergenic
1195511401 X:105719776-105719798 CTGAAAATCTGTTCTGTGTCAGG - Intronic
1198848725 X:140942127-140942149 TTGATAATCTACTATGTGTCAGG - Intergenic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199303227 X:146237148-146237170 ATCATCATCTAAGTTGTGTCTGG - Intergenic
1200728737 Y:6707192-6707214 TTGATAAACTACTCTGTGTCTGG - Intergenic