ID: 917433293

View in Genome Browser
Species Human (GRCh38)
Location 1:174993695-174993717
Sequence TGATTAGGGGGGCCCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917433281_917433293 14 Left 917433281 1:174993658-174993680 CCCACCAACCTTTGCATCAAACA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 44
917433285_917433293 6 Left 917433285 1:174993666-174993688 CCTTTGCATCAAACACTTAGGTA 0: 1
1: 0
2: 0
3: 13
4: 127
Right 917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 44
917433282_917433293 13 Left 917433282 1:174993659-174993681 CCACCAACCTTTGCATCAAACAC 0: 1
1: 0
2: 0
3: 23
4: 201
Right 917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 44
917433283_917433293 10 Left 917433283 1:174993662-174993684 CCAACCTTTGCATCAAACACTTA 0: 1
1: 0
2: 3
3: 13
4: 154
Right 917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917433293 Original CRISPR TGATTAGGGGGGCCCCTTTA AGG Intronic
903470972 1:23587264-23587286 TGATCAGGGGGGTCTCTTTCAGG - Intronic
907487875 1:54789584-54789606 CAATTAGTGGGGCCCCTTTTGGG - Intronic
917433293 1:174993695-174993717 TGATTAGGGGGGCCCCTTTAAGG + Intronic
920230943 1:204469263-204469285 GGATGAGGGGGACCCCTTTCTGG + Exonic
920296197 1:204958647-204958669 TTTTTTGGGGGGCTCCTTTATGG - Intronic
1066843716 10:39969029-39969051 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1066852281 10:40138439-40138461 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1066868056 10:40451850-40451872 TGATTAGTTGGACCCCTTTGAGG + Intergenic
1066881386 10:40716746-40716768 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1066893073 10:40946438-40946460 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1066899719 10:41078205-41078227 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1066905267 10:41186888-41186910 TGATTAGTTAGACCCCTTTAAGG + Intergenic
1069966232 10:72119485-72119507 TGGTTAGAGGGGCCCCTATGTGG - Intronic
1075641189 10:124065630-124065652 TGATTCTGCGGGCCCCATTACGG + Intronic
1079159046 11:17975581-17975603 TTCTTAGGGGAGCCCCTTTCAGG - Intronic
1079749709 11:24181899-24181921 TCATTAGTGGTGCCCTTTTATGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1095734359 12:45540333-45540355 TGCTTAGGGGGTCCTCTTTGAGG - Intergenic
1099823467 12:87745257-87745279 TAATTAGGGCTGCCACTTTATGG + Intergenic
1125923557 15:43542064-43542086 TGATTAGGGGTGATCCTTTGAGG + Intronic
1138598900 16:58043596-58043618 TGCTCAGGAAGGCCCCTTTAGGG - Exonic
1147166937 17:38598523-38598545 TGAGTCTGGGGGCCCCTCTATGG + Intronic
1149185197 17:53989539-53989561 GGATTCAGGTGGCCCCTTTAAGG + Intergenic
1158497943 18:57973736-57973758 TGGCTAGGGGAGCCCCTTCAAGG + Intergenic
1165734962 19:38170080-38170102 GGGTTAGGGGGGCCCCCTTTGGG - Intronic
926643804 2:15266362-15266384 AGATTACTGGGGCCCCTTAAGGG - Intronic
926778306 2:16444022-16444044 AGATTAGGGGAGCCATTTTAGGG - Intergenic
937228207 2:120381877-120381899 TGACTAGGCTGGCCCCTTTTTGG + Intergenic
941427116 2:165361713-165361735 TGATGAATGGGGCCTCTTTAAGG - Intronic
947897746 2:233691402-233691424 TGATTAGAGGGGCCACTCCAAGG - Intronic
948460858 2:238129308-238129330 TGCTTAGGGGGCCCCCTCTGGGG + Intronic
1169573207 20:6928641-6928663 TAATTTGGGGGGCCCATTGATGG - Intergenic
1179910532 21:44445075-44445097 TGACTTTGGGGGCCCCTTTTTGG - Intergenic
1181986682 22:26804843-26804865 TGGTTGGGGGGGCCCCATTTGGG - Intergenic
1183538681 22:38417440-38417462 GGAATAGGGGGGCCACTTTTGGG - Intergenic
986275940 5:6275030-6275052 TCATTAGGGGAGCCCCTAAAAGG + Intergenic
996416323 5:123214539-123214561 TGAGTAGGTGCGCCCCTCTAGGG - Intergenic
999435164 5:151557941-151557963 GGATTAGTGGGTCCCCTGTAAGG - Intronic
1012104144 6:95132001-95132023 TTATTTGGGAGGGCCCTTTAGGG - Intergenic
1018489663 6:164279323-164279345 TGATGGGAGGGGCTCCTTTAAGG - Intergenic
1047500045 8:125433288-125433310 AGAGAAGGGGGGCCCGTTTAGGG - Intronic
1061715711 9:132517677-132517699 GGATTAGAGGGGCCCTTTCATGG - Intronic
1190445578 X:50520568-50520590 TGATAAGGGTGTCCCCTTTAAGG - Intergenic
1194849938 X:98857731-98857753 TGATGAAGGGTGCCCCATTAAGG + Intergenic
1195101203 X:101555538-101555560 TGATTAAGGTGGGGCCTTTATGG + Intergenic
1195702467 X:107715726-107715748 TGATTAGAGTGGCACCTTTTAGG - Intronic