ID: 917434438

View in Genome Browser
Species Human (GRCh38)
Location 1:175005277-175005299
Sequence TCCCAACCACAACATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917434438 Original CRISPR TCCCAACCACAACATGAGCA AGG (reversed) Intronic
901793166 1:11664862-11664884 TCCCCACCACAAAATGCCCAGGG + Intronic
902721595 1:18307893-18307915 TCTGAAGCACAGCATGAGCAAGG - Intronic
903288826 1:22294462-22294484 TGCCAACAACCACATGAGCTTGG + Intergenic
903858822 1:26353212-26353234 TCCCAACCATCCCATGAGTAGGG - Intronic
905330123 1:37188944-37188966 TCACAACCACCCCATGAGCTAGG + Intergenic
905431392 1:37926944-37926966 TCCTAACCACTAGATGACCAGGG - Intronic
907993450 1:59605688-59605710 TTCCAACCACAAAATGGGAAGGG - Intronic
908293994 1:62694724-62694746 TCACAATCACAACAACAGCACGG + Intergenic
910785344 1:90991726-90991748 TCACTACCACAACAACAGCAAGG + Intronic
915672048 1:157497881-157497903 TCCCCAGCACAACATGCCCAGGG + Intergenic
916191295 1:162180717-162180739 TGCCAACGACAACGTGAGCTTGG + Intronic
917142795 1:171854313-171854335 TTACAACCACCACATGAGGAGGG - Intronic
917434438 1:175005277-175005299 TCCCAACCACAACATGAGCAAGG - Intronic
918054995 1:181013320-181013342 TCTCAACCACAACAGGAAAAAGG - Intronic
920927371 1:210355073-210355095 TCCCAATCACAAAAGGAGAAAGG - Intronic
921453833 1:215342611-215342633 TCCAAACCATATCAAGAGCATGG + Intergenic
924856099 1:247876401-247876423 TGCCACCCACAACAATAGCAGGG + Exonic
1064413272 10:15126651-15126673 TGCCAACAACTACAGGAGCATGG + Intronic
1064922382 10:20532895-20532917 TCCTCACCAGAACATGACCATGG + Intergenic
1066199281 10:33129633-33129655 ACACAACCACAGCATGAGGATGG - Intergenic
1066491731 10:35900966-35900988 TCCCCACCACATCATGAGGTGGG - Intergenic
1068571158 10:58630630-58630652 TCCCAACTACATCAGGAGAAGGG - Intronic
1070675856 10:78410737-78410759 ACCCGCCCACAGCATGAGCAAGG - Intergenic
1070991544 10:80737473-80737495 TCACAACCACAGCTAGAGCAAGG + Intergenic
1071123216 10:82304607-82304629 TGCCAACAACCACATGAGCTAGG - Intronic
1071165824 10:82805213-82805235 TACCTACCACAATATTAGCAAGG - Intronic
1073132141 10:101196421-101196443 CCCCCACCACAACGTGGGCACGG + Intergenic
1073743747 10:106441642-106441664 TGACAAACACAACATCAGCAAGG - Intergenic
1073881298 10:107983428-107983450 TGCCAACAACGACATGAGCTTGG + Intergenic
1075968417 10:126632513-126632535 TCACAACCACTACATGAGAATGG - Intronic
1076161518 10:128247562-128247584 TCCCCACAACTACATGGGCAAGG + Intergenic
1076527463 10:131121130-131121152 TCCAAGACAGAACATGAGCAGGG + Intronic
1077401969 11:2363383-2363405 CCCCAACAACAACTTGAGCTTGG - Intergenic
1077984535 11:7337988-7338010 TACCAACCAAAACAAGTGCAGGG - Intronic
1079626226 11:22619859-22619881 TCCCTACCACAAGAACAGCATGG - Intergenic
1080447203 11:32348242-32348264 TACCAGCCACAGCATGAGGAAGG - Intergenic
1080879095 11:36302453-36302475 TCCCAACCACAGCATAACTAGGG + Intronic
1080891023 11:36409370-36409392 TCCCAACAAGAACAGAAGCAGGG - Intronic
1082661106 11:55912402-55912424 TCCCAACCAAAGCATCTGCATGG - Intergenic
1084270629 11:68027384-68027406 TCCCCACCACAACCTTAGGAGGG + Intronic
1084894291 11:72254210-72254232 TCCCACCCTCAACATCAACAGGG - Intergenic
1085817035 11:79748792-79748814 TTCTAGCCACAACATCAGCATGG + Intergenic
1087085583 11:94214974-94214996 TGCCAACCACAAAATAAGGATGG - Intergenic
1088721037 11:112591919-112591941 TCATAACCACACCATCAGCAGGG - Intergenic
1090692298 11:129196660-129196682 TCCCAACCACCTCATGAGGCAGG + Intronic
1097296872 12:57975022-57975044 TCCCAACCACTGCATGAAAAGGG - Intergenic
1099772038 12:87073297-87073319 TGCCAACAACTACATGAGCTTGG - Intergenic
1104100115 12:125599586-125599608 TCCCTGCCACAGAATGAGCATGG - Intronic
1104134676 12:125925833-125925855 TCATAAGCACATCATGAGCACGG + Intergenic
1105473724 13:20713875-20713897 TCACTATCACAACATGAGCCTGG - Intronic
1105529095 13:21202051-21202073 TCACTACCACAAGAAGAGCATGG + Intergenic
1110071731 13:71186193-71186215 TACCATTCACAACATAAGCATGG + Intergenic
1111629386 13:90829774-90829796 TCACAGCCACCCCATGAGCATGG + Intergenic
1114746672 14:25155767-25155789 TCCCAACCACTACATTTGAATGG - Intergenic
1114921582 14:27338831-27338853 GCCAAACCAAAACAAGAGCAAGG - Intergenic
1117370877 14:55077416-55077438 TCCTCACAACAACATAAGCAAGG + Intergenic
1121238520 14:92411327-92411349 TCCCACCCACCCCATGATCAGGG + Intronic
1122324697 14:100875243-100875265 GCCCAATGGCAACATGAGCAGGG + Intergenic
1122853166 14:104547571-104547593 TCCCAGGCCCAACATGAGCCAGG - Intronic
1124662077 15:31558027-31558049 TCCCCACCCCAGCAGGAGCAGGG + Intronic
1128409437 15:67379638-67379660 TCCCTACCACAAGAAAAGCAAGG - Intronic
1130155118 15:81343845-81343867 TCCCAGCCACAACATGAGAAAGG + Intronic
1130562503 15:84969598-84969620 TCCCAAGCACAACATGCAGAGGG + Intergenic
1130817425 15:87452610-87452632 TACCAACAACAACAGGAGCTTGG - Intergenic
1130836574 15:87655597-87655619 GCCCCACTACAACATCAGCAAGG + Intergenic
1131033549 15:89206255-89206277 TCCCAACGTCCACATTAGCATGG + Intergenic
1133394501 16:5435434-5435456 TCCCAACGCCAACATGAGTAGGG + Intergenic
1133413056 16:5584290-5584312 TCCCAAGGACAAGAAGAGCAGGG - Intergenic
1133434190 16:5765231-5765253 TCCCAAACCCAACAAGAACAGGG + Intergenic
1138114159 16:54347022-54347044 TCCCAACCACAAAAAGACTAAGG - Intergenic
1143451713 17:7040704-7040726 TCACAACCTCAAAATGAGCTGGG + Intergenic
1144439756 17:15271147-15271169 TCCAACCCACAGCAAGAGCATGG + Intergenic
1144638853 17:16926751-16926773 TCCCAACCACAGCCTGACCTGGG - Intergenic
1149469454 17:56903911-56903933 TGCCAACAACCACATGAGCCTGG + Intronic
1150991757 17:70267833-70267855 TGCCAACAACCACATGTGCACGG + Intergenic
1154049212 18:10937441-10937463 TCCCAGCCACAGGATGAACATGG - Intronic
1156377198 18:36525356-36525378 TGCCAACAACCACATGAGCTTGG + Intronic
1157091033 18:44637332-44637354 TCCCCACCCCAACCTGAGCTAGG - Intergenic
1157848528 18:51026661-51026683 TGCCAACAACCACATGAGCTTGG + Intronic
1158441379 18:57477261-57477283 TCACAGCCACAACATCAGAATGG + Exonic
1158614669 18:58975563-58975585 TCCCAAGCACAGCAGCAGCATGG + Intronic
1160219032 18:76959096-76959118 TGCCAATCACAACAGGAGAAGGG + Intronic
1160336175 18:78042355-78042377 TCACAACCACCACATCAGCATGG - Intergenic
1160910514 19:1471770-1471792 TCCCATCCCCAGCATGGGCAAGG + Exonic
1161017651 19:1991209-1991231 TCCCGACCACAACATGCCCTTGG + Intronic
1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG + Intronic
1163427748 19:17248321-17248343 GCCCCACCCCAACACGAGCAAGG + Intronic
1163781466 19:19251473-19251495 TCACAACCACGACAGGAGTAAGG + Exonic
1165004106 19:32790147-32790169 GCCCAACCCCAACATGGGTAAGG - Intronic
1165482478 19:36072835-36072857 TCACAACCACAATAAGAGCTAGG - Intronic
1165873422 19:38989248-38989270 TCACAACCCCAACATCAGCCTGG - Intergenic
925026833 2:615763-615785 TCCCCTCCCCAACATGATCAGGG + Intergenic
925106661 2:1297905-1297927 TCCCAACCAGGGCTTGAGCAGGG + Intronic
927415739 2:22878756-22878778 TGCCAACCACAGCAAGAGCATGG + Intergenic
927766937 2:25819109-25819131 TTCCAACAACCACATGAGCTTGG + Intronic
929929176 2:46238863-46238885 TCACAATCACAAGATCAGCATGG - Intergenic
930094164 2:47554067-47554089 TCCCAACCACCACATGATACAGG + Intronic
930551347 2:52838720-52838742 TACCAACCACAGCATAAGCCAGG + Intergenic
931919962 2:67004336-67004358 TCCCAACCACATCCAGACCACGG - Intergenic
934051742 2:88216997-88217019 TGTCAACCACCACATGAGCTTGG + Intergenic
935646476 2:105339916-105339938 TCCCATCAAAAATATGAGCAGGG - Intronic
938995520 2:136673806-136673828 ACCCTACCACCACATTAGCAGGG + Intergenic
940662183 2:156560189-156560211 CCCCACCCACAATATGGGCACGG - Intronic
941158241 2:162004195-162004217 TCCCACCCACAACATGTTCATGG - Intronic
942988290 2:182167440-182167462 TCCCCACCGCAAAATGAACATGG + Intronic
947225480 2:227835770-227835792 TGCCATCCACAACATAACCATGG - Intergenic
1170385688 20:15813937-15813959 TTCCAAAAACAACATGAACATGG - Intronic
1171906028 20:30900146-30900168 TCCCAACCACTCCAGGAGCCGGG - Intergenic
1173644744 20:44626410-44626432 TCCCAGCCACACCCTCAGCATGG + Intronic
1173920553 20:46741604-46741626 ACCCAACCAGAAGCTGAGCATGG - Intergenic
1174949654 20:55029954-55029976 TCACAATCACAACAGGACCAAGG + Intergenic
1175194371 20:57232230-57232252 TCCCAACAACTCCATGAGAAAGG - Intronic
1175578455 20:60080213-60080235 TCCCAACCACAAAAAGGGAAAGG + Intergenic
1178052664 21:28765214-28765236 TACCAACGACCACATGAGCTTGG + Intergenic
1178663124 21:34523122-34523144 CCCCCAGCACCACATGAGCAGGG + Intronic
1179830497 21:43993402-43993424 TCCCAACCAGAAAATAAGGATGG + Intergenic
1179836957 21:44041535-44041557 TCCAAACTACAAAATTAGCAGGG - Intronic
1182328029 22:29529144-29529166 TCCCAACCACCACATTACCTTGG + Exonic
1184923677 22:47623197-47623219 TCCCAACCCCACCATTAGAAGGG - Intergenic
951959094 3:28295284-28295306 TCCTAAACACAACATGGGTAAGG - Intronic
953050082 3:39333015-39333037 TCAAAACCACAACAAGACCAAGG + Exonic
953231501 3:41069168-41069190 TCACAACCACAACTTCATCAGGG - Intergenic
953530098 3:43732879-43732901 TCCCAACAACCACATGAGCTTGG - Intronic
953753056 3:45624116-45624138 TCCCAAACACAGCTTGAGCAAGG - Intronic
957606293 3:82403617-82403639 TCACTACCACAAGAAGAGCATGG - Intergenic
960758682 3:121048968-121048990 TCCCAAGGGCAACAGGAGCAAGG + Intronic
964832151 3:160895974-160895996 TCCCTACCCCAACATTAGCTTGG + Intronic
966287632 3:178316099-178316121 TGCCAACAACCACATGAGCTAGG + Intergenic
968054441 3:195680737-195680759 TTCCAACCCCACCATCAGCAGGG + Intergenic
968101449 3:195968421-195968443 TTCCAACCCCACCATCAGCAGGG - Intergenic
968869859 4:3236372-3236394 TCCCCACCACAGCCTGACCATGG + Intronic
968888828 4:3355048-3355070 TCCTAAACAAAACATTAGCAAGG + Intronic
971935828 4:33145755-33145777 TGCCAACAACCACATGAGCTTGG - Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
973987951 4:56374005-56374027 TCCCAACCACCATATGAGGCAGG + Intronic
974437403 4:61874213-61874235 TGCCAACAACCACATGAGCTTGG - Intronic
976855744 4:89603687-89603709 TAACAACAACAAAATGAGCAAGG + Intergenic
980810789 4:137876300-137876322 TACCAACAACCATATGAGCATGG + Intergenic
982418834 4:155169732-155169754 TGCCAACTACCACATGAGCTTGG - Intergenic
983695392 4:170522496-170522518 TTCTAACCACACCATCAGCAAGG - Intergenic
985894318 5:2739806-2739828 TCCCGACCACCACGGGAGCAGGG + Intergenic
986415127 5:7520481-7520503 TCCAAACCACTCCATGAGTATGG - Intronic
986780417 5:11060149-11060171 TCACAACCACAGCATTTGCAGGG + Intronic
987819805 5:22948132-22948154 TGCCAACAACCACATGAGCCTGG + Intergenic
989121333 5:38007556-38007578 TCACGACCACAAGAAGAGCATGG + Intergenic
990857971 5:60292854-60292876 TTCCAACAACAACATGATTATGG - Intronic
991138554 5:63211978-63212000 TTCCATTCAAAACATGAGCAAGG + Intergenic
996146915 5:119987762-119987784 TGCCCACAACACCATGAGCATGG + Intergenic
996641840 5:125763599-125763621 TGCCAGCAACCACATGAGCATGG + Intergenic
998274241 5:140736940-140736962 TCCCCACCCCAAAATGAACATGG + Intergenic
1001204064 5:169745674-169745696 TCACAACCACAGCATGAGGCAGG - Intronic
1003368998 6:5506523-5506545 TCCCAACCAAAACATGGGGAAGG - Intronic
1003488357 6:6599166-6599188 TCCCAAGCATTAGATGAGCACGG - Intronic
1003845404 6:10168712-10168734 TCTCAACCACAGGATGGGCACGG - Intronic
1007091993 6:39190399-39190421 TCCGTACCACAGCAGGAGCAGGG - Exonic
1008549000 6:52609757-52609779 TGCCAACAACCACATGAGCTTGG - Intergenic
1015208854 6:130672563-130672585 TTCCAACAACCACATGAGCTTGG + Intergenic
1015231852 6:130923708-130923730 TCTCAACTAAAACATAAGCAGGG + Intronic
1015250911 6:131126773-131126795 TTGTAACCACACCATGAGCAGGG - Intergenic
1016076604 6:139804082-139804104 TCCAAACTAAAACATGAGGAGGG + Intergenic
1018430494 6:163717957-163717979 CCCCACCCACAACTTGAGCTTGG - Intergenic
1019748737 7:2715442-2715464 TCCCACCCTCAGCATGAGCCAGG - Exonic
1021002563 7:15350928-15350950 TACCAACAACAAGAAGAGCAAGG - Intronic
1021377928 7:19931897-19931919 TCCCTATCACAAGAAGAGCACGG + Intergenic
1024443172 7:49445306-49445328 ACCCAATTAAAACATGAGCAAGG - Intergenic
1026640435 7:72119773-72119795 TCACCACCACAAGAAGAGCATGG + Intronic
1028254766 7:88580635-88580657 ACCCAACTAAAAAATGAGCAAGG - Intergenic
1030700921 7:112639484-112639506 TTCCAATAACAACATGAGCAGGG + Intergenic
1031249665 7:119363557-119363579 TGCTAACCACAACATGAACTTGG + Intergenic
1032960389 7:137026951-137026973 TCTCAACCTCAACATGTTCAAGG + Intergenic
1034718508 7:153265537-153265559 TCACAATCACAACAACAGCATGG + Intergenic
1035958252 8:4107068-4107090 TGTCAACGACAACATGAACAAGG + Intronic
1040396803 8:47008367-47008389 TCCAAATGACAGCATGAGCATGG + Intergenic
1041624657 8:60011787-60011809 TCCCAGGCACAAGATGAGCTTGG - Intergenic
1042661910 8:71163878-71163900 TTCCCACCACAAGATGAGAAGGG + Intergenic
1044391887 8:91661527-91661549 TTCCTCCCACAACATGAACATGG - Intergenic
1044687389 8:94840259-94840281 TCCATAACAAAACATGAGCAAGG - Intronic
1046732783 8:117743530-117743552 TCCTAACCACAATCTTAGCAAGG - Intergenic
1048078868 8:131103008-131103030 TGCCAACAACTACATGAGCTTGG - Intergenic
1048603307 8:135942091-135942113 TCCAGACCACAACAAGAGGAGGG + Intergenic
1056543775 9:87596165-87596187 TCCTAACCCCAACATGTTCACGG - Intronic
1057721525 9:97535608-97535630 TCCCCAGCACAACAGGAACATGG + Intronic
1058187312 9:101869977-101869999 TGCCAACAACCACATGAGCTTGG - Intergenic
1061202594 9:129146282-129146304 TCCCCACCCCACCATGAGCTTGG + Intronic
1062117383 9:134816729-134816751 TCCCCACCACAACCTGGGCAGGG - Intronic
1062206252 9:135339055-135339077 TCCCTTCCACAACAGGAGAACGG + Intergenic
1062468582 9:136692226-136692248 TTCCGACCACATCATGGGCAGGG - Intergenic
1203364175 Un_KI270442v1:243164-243186 TCCCAACCGCTCCATGAGCCAGG + Intergenic
1187008086 X:15251355-15251377 TGCCAAATCCAACATGAGCAGGG + Intronic
1187231994 X:17432187-17432209 TCCCAACAACCACATGAGGTAGG - Intronic
1187438701 X:19296819-19296841 TCAAAACCACAACATGGGCCGGG - Intergenic
1188359408 X:29234028-29234050 TGCCAACAACCACATGAGCTTGG + Intronic
1189484733 X:41421368-41421390 TCCCAAATAAAACCTGAGCAGGG + Intergenic
1194601845 X:95931095-95931117 TCCCAGCCAGAAAATGAGTATGG + Intergenic
1195131447 X:101857934-101857956 TCCCAAGCACAACAAGATTATGG + Intergenic
1197958207 X:131975745-131975767 CCACAACCACTACATGAGGAAGG + Intergenic
1198585439 X:138115609-138115631 ACTCAACTACAAGATGAGCAAGG + Intergenic
1198760799 X:140030321-140030343 TCCCAACAACTACATGAGACTGG + Intergenic
1198971857 X:142290787-142290809 TCCTAACCATAACAAGAGAAAGG + Intergenic